Αποτύπωση της γενετικής ποικιλότητας του Κυπριακού κέδρου (Cedrus brevifolia): Σημαντικός παράγοντας για την αειφόρο διαχείριση του

  • 349 views
Uploaded on

Παρουσίαση του Ν.Γ. Ηλιάδη στο συνέδριο «Οικολογία και ∆ιατήρηση της Βιοποικιλότητας», Ιωάννινα 2006. …

Παρουσίαση του Ν.Γ. Ηλιάδη στο συνέδριο «Οικολογία και ∆ιατήρηση της Βιοποικιλότητας», Ιωάννινα 2006.

Ο Κυπριακός κέδρος (Cedrus brevifolia) είναι ένα από τα τέσσερα είδη κέδρου που φύονται σήμερα. Είναι ενδημικό είδος της χλωρίδας της Κύπρου και απαντάται σε έναν και μόνο πληθυσμό στο δάσος Πάφου. Το έντονο ανάγλυφο της περιοχής, σε συνδυασμό με τις διάφορες οικοτυπικές δομές που σχηματίζονται συμβάλουν ώστε να διαχωριστεί ο πληθυσμός αυτός σε πέντε κύρια υποσύνολα. Σε αυτές τις ομάδες έγινε δειγματοληψία σε 700 συνολικά άτομα. Η χρήση τεσσάρων μικροδορυφορικών εκκινητών σε πυρηνικό DNA (n-SSR) παρουσίασαν σημαντικό αριθμό αλληλομόρφων (62), αποτυπώνοντας τη γενετική ποικιλότητα και διαφοροποίηση μεταξύ και ανάμεσα στα υποσύνολα πληθυσμού. Η αποτύπωση αυτή μας έδωσε διευκρινιστικές εικόνες για τα μέτρα που πρέπει να ληφθούν ώστε να υπάρξει μια αειφόρος διαχείριση και προστασία του είδους τόσο εντός, όσο και εκτός των φυσικών ορίων εξάπλωσης του.

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
349
On Slideshare
0
From Embeds
0
Number of Embeds
1

Actions

Shares
Downloads
1
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Institute of Forest Genetics and Forest Tree Breeding Αποτύπωση της γενετικής ποικιλότητας του κυπριακού κέδρου (Cedrus brevifolia): Σηµαντικός παράγοντας για την αειφόρο διαχείριση του. Ηλιάδης Ν.¹, Gailing O. ¹, Παπαγεωργίου Α.Χ.², Finkeldey R. ¹ Τµήµα ∆ασολογίας και ∆ιαχείρισηςΠεριβάλλοντος και Φυσικών Πόρων. Εργαστήριο ∆ασικής Γενετικής
  • 2. Cedrus brevifolia Οικογένεια: Pinaceae Υπο-οικογένεια: Abieteae Γένος: Cedrus – 30-35 m ύψος – ∆ίοικο – Βελόνες: 8-25mm µήκος,1-2mm εύρος – Θηλυκό άνθος: 1-1,5 cm – Αρσενικό άνθος: 3-5 cm – Κώνος: 8-11 cm µήκος, 5-6 cm εύρος2
  • 3. Ιστορική αναδροµή (370-287 π.Χ)→ Θεόφραστος (23-79 µ.Χ)→ Πλίνιος (1730-1818)→ Κυπριανός (1879)→ Ser Samuel Baker (1880)→ Hooker J. H.- Cedrus libani var. brevifolia (1908)→ Louis-Albert Dode, (Αναβαθµίζει το κυπριακό κέδρο στο επίπεδο των ειδών)3
  • 4. ∆ιανοµή-Εξάπλωση Ένας πληθυσµός στο δάσος Πάφου. Εξάπλωση: Στα άνω όρια της µέσο- Μεσογειακής ζώνης και µέχρι τα µέσα της άνω- Μεσογειακής ζώνης. 900-1400m. 34° 58- 35° 10 συνολική έκταση 800 ha 375 ha κέδρα. 150.000 άτοµα C. brevifolia4
  • 5. Καθεστώς διαχείρισης 1879-Τµήµα ∆ασών εφάρµοσε µέτρα προστασίας Απαγόρευση υλοτοµίας δέντρων κέδρου Απαγόρευση βοσκής στο δάσος 1984-Υπουργικό Συµβούλιο κήρυξε την περιοχή ως εθνικό δάσος 1991-European Red List of the Threatened Plants and Animals; Χαρακτηρίζεται ως σπάνιο είδος. 1997-Red List of International Union for the Conservation of Nature and Natural Resources. Χαρακτηρίζεται ως τρωτό (ευπρόσβλητο) 1999- Συµπεριελήφθη στο δίκτυο «Natura 2000»5
  • 6. Υπό εξέταση ερώτηµα ΥΠ 5 Είναι ο πληθυσµός του κυπριακού κέδρου ενιαίος σε ΥΠ 1 όλα τα όρια εξάπλωσης του ή ΥΠ 4 διακρίνεται σε υποσύνολα µικρότερων υποπληθυσµών; Αν διακρίνεται σε υποσύνολα, πως κατανέµεται χωρικά αυτή η γενετική παραλλακτικότητα. Ποία µέτρα πρέπει να ληφθούν ΥΠ 2 για την αειφόρο διαχείριση του. ΥΠ 36
  • 7. ∆ειγµατοληψία Σε κάθε ένα από τα πέντε υποσύνολα 14 δειγµατοληπτικές επιφάνειες 6 επιφάνειες στην κυρίως έκταση 2 επιφάνειες στην δεύτερη σε µέγεθος περιοχή 1 επιφάνεια στις υπόλοιπες περιοχές 50 δέντρα/ επιφάνεια (DBH>12cm) Συνολικά 550 άτοµα Για κάθε δέντρο καταγράφηκε: Γεωγραφική θέση (Συν/νες και υψόµετρο) Coordinate System: UTM Datum: WGS 84 DBH7
  • 8. Τα υποσύνολα πληθυσµού Υπ/λ Έκταση Υψόµετρο Κλίση ∆ασοκοµικά ∆ασοκά Αναγέννηση α περιοχής (m) σχέδια λυψη (ha) ΥΠ1 279 1109-1395 Αµιγής Άριστη-πολύ καλή έκταση κέδρων. Στα όρια – κράσπεδα- ε ΥΠ2 50 1130-1295 40% 51% Καλή ΥΠ3 50 1247-1283 69% 61% Πολύ καλή-καλή ΥΠ4 30 1107-1210 59% 18% Απουσιάζει ΥΠ5 30 1195-1249 45% 50% Καλή8
  • 9. 9 Coordinate Y 0 10 20 30 40 50 60 70 0 51 53 52 54 57 56 55 100 20 58 99 98 97 ∆Ε. 1A-Αµιγής 96 78 79 95 40 83 8284 80 81 94 77 Coordinat X 85 86 59 76 87 93 75 73 61 74 60 69 88 91 89 Coordiante Y 70 60 63 62 92 6466 71 90 65 72 0 100 200 300 400 500 600 700 800 900 67 0 488 68 486 80 482 481 480 497 490 477478 479 496 495491 494 4 483 499 472 498 93 474 473 492 4 500471 75 470 468 467 464 465 463 459 460 461 462 469 457 454 453 452 458 200 451 400 Κατανοµή ατόµων µέσα στις επιφάνειες 456 455 600C o o rd ia n te X 466 476 800 489 487 484 485 ∆Ε 4 1 ,0 0 0
  • 10. Μοριακός ∆είκτης-Μικροδορυφόροι Γονιδιακός Κώδικας στη Μοτίβο επανάληψης Forward and reverse primer sequences τόπος GeneBank (5 to 3) CatXIIITcA3 DQ303445 (GA)13(TA)2(GA)2 TTAGAGGGAGACAGAGAGTCACAG (GT)2(GA)2 ACACGCACTCTCTTACACTCAC CatItgD4 DQ303446 (TC)8(AC)6 GCTTTACGCAATTCCTCCTATG TGAGAATTGTGAACCATTGAAAG CatXITcE11 DQ303447 (TC)17 TCACGATAACTCTCACGCAGAC AGAGAGAAAGAAAGGGGGAGAG CatXITcD12 DQ303448 (TC)15 TGGTTTTTCCACCTTAGTTTCC GGGATGGAAGGAATAAGATAGAGG CatXITcE8 DQ303449 (GA)19 CTGTGATGTGGATGGAGAAGAG ACCCCATTCTTACTATCTTTACCTC CatXIITcC6 DQ303450 (GT)27(GA)14 GGGTTATAAGTTTTAATTATATGTGTG CACCACCTTGACTTCCCTTG10
  • 11. Τεχνικές παράµετροι ABI 3100 Genetic Analyser. Genescan 3.7 και Genotyper 3.7 “Applied Biosystems” CatITgD411
  • 12. Συχνότητα γενοτύπων12
  • 13. Συχνότητες αλληλοµόρφων13
  • 14. Σύγκριση ποικιλοµορφίας ανάµεσα στους γονιδιακούςτόπους Na Ne Ho He Ht Fis Fit Fst Nm CatITgD4 6.64 3.44 0.72 0.70 0.74 -0.026 0.029 0.053 4.455 CatXIITcC6 6.00 2.42 0.61 0.57 0.62 -0.070 0.002 0.067 3.470 CatXITcE11 7.45 2.31 0.52 0.55 0.58 0.057 0.103 0.048 4.941 CatXITcD12 14.18 6.08 0.80 0.82 0.87 0.017 0.072 0.056 4.193 Mean -0.005 0.051 0.056 4.199 Na:Αριθµός αλληλοµόρφων Ne:Λειτουργικός αριθµός αλληλοµόρφων Ho:Παρατηρούµενη ετεροζυγωτία He:Αναµενόµενη ετεροζυγωτία Ht:Συνολική γενετική διαφοροποίηση Fis:Απόκλιση από την αναλογία Hardy-Weinber εντός του υποπληθυσµού Fst:Συντελεστής γενετικής παραλλακτικότητας Nm:Αριθµός µετανάστευσης ανά γενία14
  • 15. Υπολογισµός γενετικών παραµέτρων εντόςυποσυνόλων Υποπληθυσµός N Na Ne Ho He Fis ΥΠ 1 300 8.92 3.54 0.70 0.68 -0.026 ΥΠ 2 100 8.63 3.08 0.58 0.61 -0.062 ΥΠ 3 50 8.75 4.45 0.68 0.70 0.034 ΥΠ 4 50 6.75 3.34 0.64 0.64 -0.020 ΥΠ 5 50 8.00 4.01 0.72 0.70 -0.029 Mean 8.57 3.56 0.66 0.66 -0.04 Ν:Μέγεθος δείγµατος Na:Αριθµός αλληλοµόρφων Ne:Λειτουργικός αριθµός αλληλοµόρφων Ho:Παρατηρούµενη ετεροζυγωτία He:Αναµενόµενη ετεροζυγωτία Fis:Απόκλιση από την αναλογία Hardy-Weinber εντός του υποπληθυσµού15
  • 16. Υπολογισµός γενετικών παραµέτρων εντόςδειγµατοληπτικών επιφανειών N Na Ne Ho He Fis ∆Ε 1A 50 7.50 3.27 0.64 0.63 -0.010 ∆Ε 1B 50 9.00 3.29 0.70 0.64 -0.112 ∆Ε 1C 50 10.50 3.28 0.68 0.66 -0.027 ∆Ε 1D 50 10.50 4.40 0.70 0.74 0.060 ∆Ε 1E 50 9.75 4.05 0.75 0.71 -0.048 ∆Ε 1F 50 6.25 2.97 0.65 0.63 -0.021 ∆Ε 2A 50 9.25 3.36 0.52 0.60 0.149 ∆Ε 2B 50 8.00 2.80 0.64 0.62 -0.025 ∆Ε 3 50 8.75 4.45 0.68 0.70 0.034 ∆Ε 4 50 6.75 3.34 0.64 0.64 -0.020 ∆Ε 5 50 8.00 4.01 0.72 0.70 -0.029 Ν:Μέγεθος δείγµατος Na:Αριθµός αλληλοµόρφων Ne:Λειτουργικός αριθµός αλληλοµόρφων Ho:Παρατηρούµενη ετεροζυγωτία He:Αναµενόµενη ετεροζυγωτία Fis:Απόκλιση από την αναλογία Hardy-Weinber εντός του υποπληθυσµού16
  • 17. ∆ιαφοροποίηση της αναµενόµενης ετεροζυγωτίας (Ηe)εντός των δειγµατοληπτικών επιφανειών17
  • 18. Γενετική διαφοροποίηση µεταξύ δειγµατοληπτικώνεπιφανειών (Dj) Plot5 0.4 Plot4 0.34 Plot1A 0.3 0.37 Plot1B 0.22 0.2 0.25 Plot3 0.22 Plot1C 0.1 0.16 0.21 0.22 0 Plot2B 0.17 Plot1D 0.21 0.28 Plot1E Plot2A δ=0.24 Plot1F18
  • 19. Fst διαφοροποίηση 0.070 0.061 0.061 0.063 0.064 0.065 0.058 0.060 0.051 0.050 0.040 0.030 0.020 0.010 0.000 Plot4 Plot5 Plot5 Plot4 Plot5 Plot4 Plot5 Plot1A Plot1F Plot2B Plot1B Plot4 Plot1F Plot2A19
  • 20. Γενετική απόσταση Nei (UPGMA)20
  • 21. Analysis of molecular variance (AMOVA) Τµήµα Βαθµοί ∆ιαφοροποίηση Ποσοστό P-value παραλλαγής ελευθερίας παραλλαγής Μεταξύ 7 0,05305Va 3,92 P<0.001 πληθυσµών Μέσα στους πληθυσµούς 1382 1,30139Vb 96,08 P<0.001 Συνολικό 1389 1.354421
  • 22. Γενετική και Γεωγραφικά απόσταση Mantel Test: Tests for association: Matrix correlation: r = 0.89821 The one-tail probability is: P [random Z >= observed Z] = 0.015422
  • 23. Συµπεράσµατα-Συζήτηση Εξελικτικοί παράγοντες Αναπαραγωγικό Ροή γονιδίων σύστηµα Εκτροπή Μεταλλάξεις Επιλογή Γενετική ποικιλότητα Εντός Μεταξύ πληθυσµών πληθυσµών Εξελικτική προσαρµοστική ικανότητα23
  • 24. Συµπεράσµατα-Συζήτηση Υψηλά ποσοστά ποικιλότητας για ενδηµικό είδος. Υψηλά ποσοστά ποικιλότητας σε επίπεδο πληθυσµού. Πληθυσµός παρουσιάζει υποσύνολα (υποπληθυσµούς) – Αποτέλεσµα κατακερµατισµού παλαιότερου ενιαίου πληθυσµού Γενετική διαφοροποίηση µεταξύ υποσυνόλων συσχετίζεται και δεν είναι τυχαία (AMOVA) Μεταξύ υποσυνόλων διαφοροποίηση – Λόγω γεωγραφικής απόστασης και παρεµβολής (φραγµός) δάσους πεύκης – Πρόβληµα αναπαραγωγικού συστήµατος – Χαµηλή ροή γονιδίων-µετανάστευση24
  • 25. Συµπεράσµατα-Συζήτηση Υποπληθυσµός 2 και 4 – Παρουσιάζουν χαµηλά ποσοστά ποικιλότητας Αµιγείς πληθυσµοί Άτοµα σε απόσταση µεταξύ τους (3-200µ.) (3-800µ) Καχεκτικά και µεγάλα σε ηλικία Υποβαθµισµένος σταθµός (διαβρωτικά φαινόµενα) Μεταξύ αυτών και κυρίους πληθυσµού µεσολαβεί έντονο ανάγλυφο µε αρκετές βουνοκορφές και δάσος πεύκης Ο υποπλ. 2 ιδιαίτερα µικρός (50 άτοµα) – Προβληµατικό αναπαραγωγικό σύστηµα – Μικρή εισροή γονιδίων – Μικρό µέγεθος πληθυσµού απώλεια αλληλοµόρφων25
  • 26. Συµπεράσµατα-Συζήτηση Υποπληθυσµοί 3 και 5 – Ιδιαίτερα ψηλά ποσοστά ποικιλότητας Ιδιαίτερα γόνιµοι σταθµοί (επικράτηση πεύκης) Βρίσκονται σε µίξη µε πεύκη Άτοµα κέδρου σε οµάδες ή λόχµες – Ο «3» βρίσκεται σε άµεση επικοινωνία µε τον κυρίως πληθυσµό –Εισροή γονιδίων (για υποπληθυσµό 3) –Βαθµός µίξη επιτρέπει ικανοποιητική κίνηση γύρης εντός πληθυσµών26
  • 27. Συµπεράσµατα-Συζήτηση Κυρίως υποπληθυσµός – Παρουσιάζει πρότυπα γενετικής ποικιλότητας – ∆ειγµατοληπτικές επιφάνειες Α,Β,D αµιγείς κέδρο – ∆ειγµατοληπτικές επιφάνειες C,E,F σε µείξη – (F) από το σηµείο αυτό ξεκινά η περιοχή των κέδρων. Γράφηµα δείχνει την κατανοµή των δέντρων του F στο χώρο. – …… 60 – ….. 299 300 256 40 255 251 298 293 252 297 257 291 262 253 258 254 292 259 … 289 263 288 – 290 264 294 260 295 265 287 20 261 286 278 Coordiante Y 266268 275 277 279 285 283 274 276 284 280 282 267 273 281 269 272 271 0 270 Individual -20 -40 -60 296 -80 0 10 20 30 40 50 60 70 Coordinate X27
  • 28. Μέτρα προστασίας Αποσκοπούν στην αειφόρο δασοπονία: – Προστασία ποικιλότητας που υπάρχει στο σύνολο του πληθυσµού και όχι σε επίπεδο ατόµων ή αλληλοµόρφου – ∆ιαφύλαξη εξελικτικής προσαρµοστικότητας του είδους Μακροχρόνια ύπαρξη του στο άγνωστο µέλλον Αντικείµενο προστασίας – ∆ιαφύλαξη της γενετικής ποικιλότητας – ∆ιατήρηση της προσαρµοστικότητας28
  • 29. Μέτρα προστασίας In-situ Προστασία Τήρηση µέτρων και καθεστώς προστασίας περιοχής – (Αντιπυρικές ζώνες, µέτρα πυρασφάλειας) Τακτική παρατήρηση επιδράσεων βιοτικών παραγόντων – (Προσβολή από έντοµα) ∆ασοκοµικά µέτρα για: – Βελτίωση αναγέννησης και πυκνότητας υποσυνόλων (Φυτεύσεις εµπλουτισµού ή αραιώσεις) Στόχος η συνέχιση της λειτουργίας των γενετικών διαδικασιών – Επιλογή και ροή γονιδίων – ∆ιατήρησης προσαρµοστικότητας του πληθυσµού στο άγνωστο µέλλον29
  • 30. Μέτρα προστασίας Ex-situ Προστασία ∆ηµιουργία φυτειών ή αναδασώσεων εκτός ορίων εξάπλωσης – Θέσεις µε δυνατότητα πρόσβασης και µέτρα προστασίας – Συλλογή δειγµάτων από όλα τα υποσύνολα – Φύτευση σε σύνδεσµο που θα επιτρέπει ροή γύρης µεταξύ ατόµων στο µέλλον – Σχεδιασµός και καταγραφή θέσης προέλευσης δειγµάτων Σποροπαραγωγικοί κήποι Στόχος να ληφθεί το µέγιστο ποσό παραλλακτικότητας, κρατώντας τον αριθµό και το µέγεθος των δειγµάτων µέσα στα πρακτικά όρια.30
  • 31. Ευχαριστώ για την προσοχή σας.31
  • 32. 32
  • 33. ∆.Ε5 ∆.Ε1F ∆.Ε1E ∆.Ε4 ∆.Ε1A ∆.Ε1D ∆.Ε1C ∆.Ε2 ∆.Ε1Β ∆.Ε333
  • 34. Sbp1 Sbp2 Sbp3 Sbp4 Sbp5 Sbp1 0.00 Sbp2 2.48 0.00 Sbp3 2.32 1.38 0.00 Sbp4 4.25 2.56 4.03 0.00 Sbp5 3.67 6.16 5.79 7.55 0.0034
  • 35. Subpopulation 1 F E Extended in an area of 279 ha. Pure: 86 ha Mixed: Cedar+Pine= 62 ha Pine+Cedar= 51ha A D Six surfaces in natural spread and one plantation B Three surfaces: pure (A,B,D) C Three surfaces: mixed (C,E,F) Altitude: 1109-1395m Regeneration: very good- excellent35
  • 36. 36 Coordinate Y 0 20 40 60 80 100 120 140 345 0 348 347 346 344 350 349 341 25 343 342 335 338 337 340 339 330 334 329 332 50 333 331 336 301 302 303 328 325 327 324 304 326 75 305 306 322 Coordinate X 320 321 323 100 316 315 319 318 Plot2A 307314 309 313 308 310 312 317 125 311 Coordinate Y 0 20 40 60 80 100 120 140 160 150 351 0 352 400 353 399 394 397 ∆ιανοµή ατόµων µέσα στις επιφάνειες 354 395 Individual 393 398 391 50 392 396 383 385 384 386 387 388 389 367 390 366 382 371 381 368 369 379 378 380 100 365 375 377 376 370 374 Coordinate X 363 364 372 373 355 359 360362 356 361 357 150 358 Plot2B 200 Individual
  • 37. 37 Coordiante Y 0 100 200 300 400 500 600 700 800 900 0 488 486 482 481 480 497 490 477 478 479 496 495491 494 4 483 499 472 498 93 474 473 4924 500471 75 470 468 467 464 465 463 460 459 461 462 469 457 454 453 452 458 200 451 400 456 455 600 C o o rd ia n te X 466 476 800 489 487 484 485 Plot4 1 ,0 0 0 Coordiante Y 0 20 40 60 80 100 120 140 534 535 0 ∆ιανοµή ατόµων µέσα στις επιφάνειες 536 In d iv id u a l 531 533 532 Plot 5 530 25 529 528 526 50 525 520 527 540 543 519 517 521 541 542 522 523 524 539 544 546 545 75 538 516 550 547 537 548 503 502 549 515 501 Coordinate X 505 506508 511 504 507 100 514 510 509 125 513 512 150 Individual