Your SlideShare is downloading. ×
Ecuador influenza
Ecuador influenza
Ecuador influenza
Ecuador influenza
Ecuador influenza
Ecuador influenza
Ecuador influenza
Ecuador influenza
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Ecuador influenza

327

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
327
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
1
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  1. ECUADOR INFLUENZA<br />GenBank: CY052097.1<br />Influenza A virus (A/Guayaquil/5/2009(H1N1)) segment 4 sequence<br />>gi|270655646|gb|CY052097.1| Influenza A virus (A/Guayaquil/5/2009(H1N1)) segment 4 sequence<br />CACATTATGTATAGGTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTA<br />ACAGTAACACACTCTGTTAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAG<br />CCCCATTGCATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTC<br />CACAGCAAGCTCATGGTCCTACATTGTGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGAT<br />TTCATCGATTATGAGGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCC<br />CCAAGACAAGTTCATGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGC<br />AAAAAGCTTCTACAAAAATTTAATATGGCTAGTTAAAAAAGGGAATTCATACCCAAAGCTCAGCAAATCC<br />TACATTAATGATAAAGGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACC<br />AACAAAGTCTCTATCAGAATGCAGATGCATATGTTTTTGTGGGGACATCAAGATACAGCAAGAAGTTCAA<br />GCCGGAAATAGCAATAAGACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTA<br />GAGCCGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGG<br />AAAGAAATGCTGGATCTGGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAGAC<br />ACCCAAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCA<br />AAATATGTAAAAAGCACAAAATTGAGACTGGCCACAGGATTGAGGAA<br />GenBank: CY052095.1<br />Influenza A virus (A/Guayaquil/3/2009(H1N1)) segment 4 sequence<br />>gi|270655626|gb|CY052095.1| Influenza A virus (A/Guayaquil/3/2009(H1N1)) segment 4 sequence<br />CAAAAATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTAT<br />AGGTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACAC<br />TCTGTTAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATT<br />TGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTC<br />ATGGTCCTACATTGTGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTAT<br />GAGGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAAGACAAGTT<br />CATGGCCCAATCATGACTCGAACAAAGGCGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTA<br />CAAAAATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGAT<br />AAAGGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCT<br />ATCAGAATGCAGATGCATATGTTTTTGTGGGGTCATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGC<br />AATAAGACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGAC<br />AAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTG<br />GATCTGGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCCAAGGGTGC<br />TATAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAA<br />AGCACAAAATTGAGACTGGCCACAGGATTGAGGAATGTCCCGTCTATCAA<br />CHILE<br />GenBank: GQ866225.1<br />Influenza A virus (A/turkey/Chile/28317-6504-3/2009(H1N1)) segment 4 hemagglutinin (HA) gene, partial cds<br />>gi|257223439|gb|GQ866225.1| Influenza A virus (A/turkey/Chile/28317-6504-3/2009(H1N1)) segment 4 hemagglutinin (HA) gene, partial cds<br />ATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAGGTT<br />ATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGT<br />TAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGT<br />AAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCATGGT<br />CCTACATTGTGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGA<br />GCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAAGACAAGTTCATGG<br />CCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAA<br />ATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAAGG<br />GAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTATCAG<br />AATGCAGATGCATATGTTTTTGTGGGGACATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAA<br />GACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAAT<br />AACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCT<br />GGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCCAAGGGTGCTATAA<br />ACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAGCAC<br />AAAATTGAGACTGGCCACAGGATTGAGGAATGTCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCCATT<br />GCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGC<br />AGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGTAAA<br />TTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAAAGA<br />ATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGTTGG<br />TTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGTAAG<br />AAGCCAGTTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGATAAC<br />ACGTGCATGGAAAGTGTCAAAAATGGGACTTG<br />GenBank: GQ359771.1<br />Influenza A virus (A/Puerto Montt/Bio87/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds<br />>gi|251833493|gb|GQ359771.1| Influenza A virus (A/Puerto Montt/Bio87/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds<br />AAAATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAG<br />GTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTC<br />TGTTAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTG<br />GGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCAT<br />GGTCCTACATTGTGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGA<br />GGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAAGACAAGTTCA<br />TGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACA<br />AAAATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGAAAATCCTACATTAATGATAA<br />AGGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTAT<br />CAGAATGCAGATGCATATGTTTTTGTGGGGACATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAA<br />TAAGACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAA<br />AATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGA<br />TCTGGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCCAAGGGTGCTA<br />TAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAG<br />CACAAAATTGAGACTGGCCACAGGATTGAGGAATGTCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCC<br />ATTGCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATG<br />AGCAGGGGTCAGGATATGCAGCTGACCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGT<br />AAATTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAA<br />AGAATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGT<br />TGGTTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGT<br />AAGAAGCCAGTTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGAT<br />AACACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAAGCAAAATTAA<br />ACAGAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGATCTATTCAAC<br />TGTCGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTCTAATGGGTCT<br />CTACAGTGTAGAATATGTATTTAACAT<br />GenBank: GQ286175.1<br />Influenza A virus (A/Castro/JXP/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds<br />>gi|240282380|gb|GQ286175.1| Influenza A virus (A/Castro/JXP/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds<br />TTTGTAAAACGAACGGCCAGTATACGACTAGCAAAAGCAGGGGAAAACAAAAGCAACAAAAATGAAGGCA<br />ATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAGGTTATCATGCGA<br />ACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGTTAACCTTCT<br />AGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGTAAATGTAAC<br />ATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCATGGTCCTACATTG<br />TGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGAGCTAAGAGA<br />GCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAAGACAAGTTCATGGCCCAATCAT<br />GACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAAATTTAATAT<br />GGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAAGGGAAAGAAGT<br />CCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTATCAGAATGCAGAT<br />GCATATGTTTTTGTGGGGACATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAG<br />TGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAATAACATTCGA<br />AGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCTGGTATTATC<br />ATTTCAGATACACCAGTCCACGATTGCAACACAACTTGTCAGACACCCAAGGGTGCTATAAACACCAGCC<br />TCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAGCACAAAATTGAG<br />ACTGGCCACAGGATTGAGGAATGTCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCCATTGCCGGTTTC<br />ATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGCAGGGGTCAG<br />GATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGTAAATTCTGTTAT<br />TGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAAAGAATAGAGAAT<br />TTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGTTGGTTCTATTGG<br />AAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGTAAGAAGCCAGTT<br />AAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGATAACACGTGCATG<br />GAAAGTGTCAAAAATGGGACTTATTACTACCCAAAATACTCAGAGGAAGCAAAATTAAACAGAGAAGAAA<br />TAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGATCTATTCAACTGTCGCCAGTTC<br />ATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTCTAATGGGTCTCTACAGTGTAGA<br />ATATGTATTTAACATAGAATCACAAACCGGAGAAGTTCTTAATTC<br />COLOMBIA<br />GenBank: CY049836.1<br />Influenza A virus (A/Bogota/WR0090N/2009(H1N1)) segment 4 sequence<br />>gi|265691496|gb|CY049836.1| Influenza A virus (A/Bogota/WR0090N/2009(H1N1)) segment 4 sequence<br />ATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAGGTT<br />ATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGT<br />TAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGT<br />AAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCATGGT<br />CCTACATTGTGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGA<br />GCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGATTTGAGATATTCCCCAAGACAAGTTCATGG<br />CCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAA<br />ATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAAGG<br />GAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTATCAG<br />AATGCAGATGCATATGTTTTTGTGGGGACATCAAGATACAGTAAGAAGTTCAAGCCGGAAATAGCAATAA<br />GACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAAT<br />AACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCT<br />GGTATTATCATTTCAGATACACCAGTCCACAATTGCAATACAACTTGTCAGACACCCAAGGGTGCTATAA<br />ACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAGCAC<br />AAAATTGAGACTGGCCACAGGATTGAGGAATGTCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCCATT<br />GCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGC<br />AGGGGTCAGGATATGCAGCCGATCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGTAAA<br />TTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAAAGA<br />ATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGTTGG<br />TTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGTAAG<br />AAGCCAGTTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGATAAC<br />ACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAAGCAAAATTAAACA<br />GAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGATCTATTCAACTGT<br />CGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTCTGGTCATCTACAG<br />TGTAGAATATGTATTTAA<br />GenBank: CY044147.1<br />Influenza A virus (A/Bogota/0466N/2009(H1N1)) segment 4 sequence<br />>gi|255689501|gb|CY044147.1| Influenza A virus (A/Bogota/0466N/2009(H1N1)) segment 4 sequence<br />ATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAGGTT<br />ATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGT<br />TAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGT<br />AAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCATGGT<br />CCTACATTGTGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGA<br />GCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGATTTGAGATATTCCCCAAGACAAGTTCATGG<br />CCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAA<br />ATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAAGG<br />GAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTATCAG<br />AATGCAGATGCATATGTTTTTGTGGGGACATCAAGATACAGTAAGAAGTTCAAGCCGGAAATAGCAATAA<br />GACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAAT<br />AACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCT<br />GGTATTATCATTTCAGATACACCAGTCCACAATTGCAATACAACTTGTCAGACACCCAAGGGTGCTATAA<br />ACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAGCAC<br />AAAATTGAGACTGGCCACAGGATTGAGGAATGTCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCCATT<br />GCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGC<br />AGGGGTCAGGATATGCAGCCGATCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGTAAA<br />TTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAAAGA<br />ATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGTTGG<br />TTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGTAAG<br />AAGCCAGTTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGATAAC<br />ACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAAGCAAAATTAAACA<br />GAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGATCTATTCAACTGT<br />CGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTCTAATGGGTCTCTA<br />CAGTGTAGAATATGTATTTAA<br />GenBank: GQ200276.1<br />Influenza A virus (A/Bogota/224/2009(H1N1)) segment 4 hemagglutinin (HA) gene, partial cds<br />>gi|238018155|gb|GQ200276.1| Influenza A virus (A/Bogota/224/2009(H1N1)) segment 4 hemagglutinin (HA) gene, partial cds<br />GTTTTTGTGGGGTCATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAGTGAGGG<br />ATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAATAACATTCGAAGCAAC<br />TGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCTGGTATTATCATTTCA<br />GATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCCAAGGGTGCTATAAACACCAGCCTCCCAT<br />TTCAGAATATACATCCGATCACAATTGGA<br />GenBank: GQ200275.1<br />Influenza A virus (A/Bogota/176/2009(H1N1)) segment 4 hemagglutinin (HA) gene, partial cds<br />>gi|238018153|gb|GQ200275.1| Influenza A virus (A/Bogota/176/2009(H1N1)) segment 4 hemagglutinin (HA) gene, partial cds<br />GTTTTTGTGGGGTCATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAGTGAGGG<br />ATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAATAACATTCGAAGCAAC<br />TGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCTGGTATTATCATTTCA<br />GATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCCAAGGGTGCTATAAACACCAGCCTCCCAT<br />TTCAGAATATACATCCGATCACAATTGGA<br />USA<br />GenBank: CY061283.1<br />Influenza A virus (A/Pensacola/INS108/2009(H1N1)) segment 4, complete sequence<br />>gi|294613850|gb|CY061283.1| Influenza A virus (A/Pensacola/INS108/2009(H1N1)) segment 4, complete sequence<br />AAAAGCAACAAAAATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACA<br />TTATGTATAGGTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAG<br />TAACACACTCTGTTAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCC<br />ATTGCATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACA<br />GCAAGCTCATGGTCCTACATTGTGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCA<br />TCAATTATGAGGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAA<br />GACAAGTTCATGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAA<br />AGCTTCTACAAAAATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACA<br />TTAATGATAAAGGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACA<br />AAGTCTCTATCAGAATGCAGATGCATATGTTTTTGTGGGGACATCAAGATACAGCAAGAAGTTCAAGCCG<br />GAAATAGCAATAAGACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGC<br />CGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAG<br />AAATGCTGGATCTGGTATTATCATCTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCC<br />AAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAAT<br />ATGTAAAAAGCACAAAATTGAGACTGGCCACAGGATTGAGGAATGTCCCGTCTATTCAATCTAGAGGCCT<br />ATTTGGGGCCATTGCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCAC<br />CATCAAAATGAGCAGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACAAGATTA<br />CTAACAAAGTAAATTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCA<br />CCTAGAAAAAAGAATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAAT<br />GCCGAACTGTTGGTTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTAT<br />ATGAAAAGGTAAGAAGCCAGTTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCA<br />CAAATGCGATAACACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAA<br />GCAAAATTAAACAGAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGA<br />TCTATTCAACTGTCGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTC<br />TAATGGGTCTCTACAGTGTAGAATATGTATTTAACATTAGGATTTCAGAAGCAT<br />GenBank: CY061275.1<br />Influenza A virus (A/Pensacola/INS107/2009(H1N1)) segment 4, complete sequence<br />>gi|294612673|gb|CY061275.1| Influenza A virus (A/Pensacola/INS107/2009(H1N1)) segment 4, complete sequence<br />AAAAGCAACAAAAATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACA<br />TTATGTATAGGTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAG<br />TAACACACTCTGTTAACATTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCC<br />ATTGCATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACA<br />GCAAGCTCATGGTCCTACATTGTGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCA<br />TCGATTATGAGGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAA<br />GACAAGTTCATGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAA<br />AGCTTCTACAAAAATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACA<br />TTAATGATAAAGGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACA<br />AAGTCTCTATCAGAATGCAGATGCATATGTTTTTGTGGGGTCATCAAGATACAGCAAGAAGTTCAAGCCG<br />GAAATAGCAATAAGACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGC<br />CGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAG<br />AAATGCTGGATCTGGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCC<br />AAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAAT<br />ATGTAAAAAGCACAAAATTGAGACTGGCCACAGGATTGAGGAATGTCCCGTCTATTCAATCTAGAGGCCT<br />ATTTGGGGCCATTGCCGGCTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCAT<br />CATCAAAATGAGCAGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTA<br />CTAACAAAGTAAATTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCA<br />CCTGGAAAAAAGAATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAAT<br />GCCGAACTGTTGGTTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTAT<br />ATGAAAAGGTAAGAAGCCAGCTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCA<br />CAAATGCGATAACACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAA<br />GCAAAATTAAACAGAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGA<br />TCTATTCAACTGTCGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTC<br />TAATGGGTCTCTACAGTGTAGAATATGTATTTAACATTAGGATTTCAGAAGCAT<br />GenBank: CY061267.1<br />Influenza A virus (A/Brussels/INS106/2009(H1N1)) segment 4, complete sequence<br />>gi|294612654|gb|CY061267.1| Influenza A virus (A/Brussels/INS106/2009(H1N1)) segment 4, complete sequence<br />AAAAGCAACAAAAATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACA<br />TTATGTATAGGTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAG<br />TAACACACTCTGTTAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCC<br />ATTGCATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACA<br />GCAAGCTCATGGTCCTACATTGTGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCA<br />TCGATTATGAGGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAA<br />GACAAGTTCATGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAA<br />AGCTTCTACAAAAATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACA<br />TTAATGATAAAGGGAAAGAAGTCCTAGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACA<br />AAGTCTCTATCAGAATGCAGATGCATATGTTTTTGTGGGGACATCAAGATACAGCAAGAAGTTCAAGCCG<br />GAAATAGCAATAAGACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGC<br />CGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAG<br />AAATGCTGGATCTGGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCC<br />AAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAAT<br />ATGTAAAAAGCACAAAATTGAGACTGGCCACAGGATTGAGGAATATCCCGTCTATTCAATCTAGAGGCCT<br />ATTTGGGGCCATTGCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCAC<br />CATCAAAATGAGCAGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTA<br />CTAACAAAGTAAATTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCA<br />CCTGGAAAAAAGAATAGAGAATTTAAATAAAAAGGTTGATGATGGTTTCCTGGACATTTGGACTTACAAT<br />GCCGAACTGTTGGTTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTAT<br />ATGAAAAGGTAAGAAGCCAGTTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCA<br />CAAATGCGATAACACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAA<br />GCAAAATTAAACAGAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGA<br />TCTATTCAACTGTCGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTC<br />TAATGGGTCTCTACAGTGTAGAATATGTATTTAACATTAGGATTTCAGAAGCAT<br />GenBank: CY061259.1<br />Influenza A virus (A/San Diego/INS105/2009(H1N1)) segment 4, complete sequence<br />>gi|294612636|gb|CY061259.1| Influenza A virus (A/San Diego/INS105/2009(H1N1)) segment 4, complete sequence<br />AAAAGCAACAAAAATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACA<br />TTATGTATAGGTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAG<br />TAACACACTCTGTTGACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCC<br />ATTGCATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACA<br />GCAAGCTCATGGTCCTACATTGTGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCA<br />TCGATTATGAGGAACTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAA<br />GACAAGTTCATGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAA<br />AGCTTCTACAAAAATTTAATATGGCTGGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACA<br />TTAATGATAAAGGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACA<br />AAGTCTCTATCAGAATGCAGATGCATATGTTTTTGTGGGGTCATCAAGATACAGCAAGAAGTTCAAGCCG<br />GAAATAGCAATAAGACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGC<br />CGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAG<br />AAATGCTGGATCTGGTATTATCATTTCGGATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCC<br />AAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAAT<br />ATGTAAAAAGCACAAAATTGAGACTGGCCACAGGATTGAGGAATGTCCCGTCTATTCAATCTAGAGGCCT<br />ATTTGGGGCCATTGCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCAC<br />CATCAAAATGAGCAGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTA<br />CTAACAAAGTAAATTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCA<br />CCTGGAAAAAAGAATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAAT<br />GCCGAACTGTTGGTTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTAT<br />ATGAAAAGGTAAGAAGCCAGTTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCA<br />CAAATGCGATAACACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAA<br />GCAAAATTAAACAGAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGA<br />TCTATTCAACTGTCGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTC<br />TAATGGGTCTCTACAGTGTAGAATATGTATTTAACATTAGGATTTCAGAAGCAT<br />

×