Co-opting the Genetic
Code
DNA Binary Encoding Protocol
Amit Snyderman, ITP Design Frontiers, 2010
Genetic Code
The genetic code is the set of rules by which
information encoded in genetic material is translated
into prot...
DNA
Deoxyribonucleic acid (DNA) contains the genetic
instructions used in the development and functioning
of all known liv...
Units of the Code
Adenosine (A)
Cytosine (C)
Guanine (G)
Thymine (T)
Codons
Mapping between nucleotide triplets and amino acids
43 combinations = 64 possible codons

http://upload.wikimedia.o...
Amino Acids
20 amino acids

Just as the letters of the alphabet can be combined to
form an almost endless variety of words...
Proteins
Every protein is chemically defined by its unique
sequence of amino acid residues, which in turn define
the three-d...
MIME Base64
Encoding scheme that encodes binary data by treating
it numerically and translating it into a base 64
represen...
Remap
Rather than mapping to a character, map to a codon.
VALUE   CHARACTE   CODON     AMINO ACID      VALUE   CHARACTE   CODON    AMINO ACID     VALUE   CHARACTE   CODON     AMINO...
Example: Hello,
world!
    BASE64       SGVsbG8sIHdvcmxkIQo=
  BASE64 INDEX   18 6 21 44 27 6 60 44 8 7 29 47 28 38 49 36 ...
Disk is cheap.
Who cares?
Non-Digital Library
Via recombinant DNA technologies, craft a portable,
reproducible, time-resistant library. Embed, grow ...
Spime
"The key to the Spime is identity. A Spime is, by
definition, the protagonist of a documented process. It
is an histo...
Spime Ingredients
Unique ID code
History of ownership
Geographical position
Customization details
Public discourse
Etc.
Human
Identification
Tools, artifacts, archeology
Bone structure, teeth, dental records, fingerprints, DNA
Yellowpages, resu...
Narrative
Embedded Histories. Family trees and Lineage. Stories.
Junk DNA
Noncoding DNA describes sequences that do not
encode for protein sequences. Much of this DNA has no
known biologi...
Human Spime
Recycle junk DNA by recombining encoded messages
into non-coding DNA regions.
In-vitro manipulation. Gene ther...
DNA Encoding Protocol
DNA Encoding Protocol
DNA Encoding Protocol
DNA Encoding Protocol
DNA Encoding Protocol
DNA Encoding Protocol
Upcoming SlideShare
Loading in …5
×

DNA Encoding Protocol

2,121 views
1,942 views

Published on

Co-Opting the Genetic Code: DNA Encoding Protocol
ITP Design Frontiers in Biology and Materiality, 2010

Published in: Technology
0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
2,121
On SlideShare
0
From Embeds
0
Number of Embeds
243
Actions
Shares
0
Downloads
0
Comments
0
Likes
2
Embeds 0
No embeds

No notes for slide

























  • DNA Encoding Protocol

    1. 1. Co-opting the Genetic Code DNA Binary Encoding Protocol Amit Snyderman, ITP Design Frontiers, 2010
    2. 2. Genetic Code The genetic code is the set of rules by which information encoded in genetic material is translated into proteins by living cells.
    3. 3. DNA Deoxyribonucleic acid (DNA) contains the genetic instructions used in the development and functioning of all known living organisms. The main role of DNA molecules is the long-term storage of information.
    4. 4. Units of the Code Adenosine (A) Cytosine (C) Guanine (G) Thymine (T)
    5. 5. Codons Mapping between nucleotide triplets and amino acids 43 combinations = 64 possible codons http://upload.wikimedia.org/wikipedia/en/d/d6/GeneticCode21- version-2.svg
    6. 6. Amino Acids 20 amino acids Just as the letters of the alphabet can be combined to form an almost endless variety of words, amino acids can be linked together in varying sequences to form a vast variety of proteins. http://upload.wikimedia.org/wikipedia/commons/3/37/Aa.svg
    7. 7. Proteins Every protein is chemically defined by its unique sequence of amino acid residues, which in turn define the three-dimensional structure of the protein.
    8. 8. MIME Base64 Encoding scheme that encodes binary data by treating it numerically and translating it into a base 64 representation. TEXT M a n ASCII 77 97 110 BIT PATTERN 010011010110000101101110 INDEX 19 22 5 46 BASE64-ENCODED T W F u
    9. 9. Remap Rather than mapping to a character, map to a codon.
    10. 10. VALUE CHARACTE CODON AMINO ACID VALUE CHARACTE CODON AMINO ACID VALUE CHARACTE CODON AMINO ACID R R R 0 A AAA Lysine (K) 22 W CCG Proline (P) 43 r GGT Glycine (G) 1 B AAC Asparagine (N) 23 X CCT Proline (P) 44 s GTA Valine (V) 2 C AAG Lysine (K) 24 Y CGA Arginine (R) 45 t GTC Valine (V) 3 D AAT Asparagine (N) 25 Z CGC Arginine (R) 46 u GTG Valine (V) 4 E ACA Threonine (T) 26 a CGG Arginine (R) 47 v GTT Valine (V) 5 F ACC Threonine (T) 27 b CGT Arginine (R) 48 w TAA STOP 6 G ACG Threonine (T) 28 c CTA Leucine (L) 49 x TAC Tyrosine (Y) 7 H ACT Threonine (T) 29 d CTC Leucine (L) 50 y TAG STOP 8 I AGA Arginine (R) 30 e CTG Leucine (L) 51 z TAT Tyrosine (Y) 9 J AGC Serine (S) 31 f CTT Leucine (L) 52 0 TCA Serine (S) 10 K AGG Arginine (R) 32 g GAA Glutamate (E) 53 1 TCC Serine (S) 11 L AGT Serine (S) 33 h GAC Aspartate (D) 54 2 TCG Serine (S) 12 M ATA Isoleucine (I) 34 i GAG Glutamate (E) 55 3 TCT Serine (S) 13 N ATC Isoleucine (I) 35 j GAT Aspartate (D) 56 4 TGA STOP 14 O ATG Methionine (M) 36 k GCA Alanine (A) 57 5 TGC Cystine (C) 15 P ATT Isoleucine (I) 37 l GCC Alanine (A) 58 6 TGG Tryptophan (W) 16 Q CAA Glutamine (Q) 38 m GCG Alanine (A) 59 7 TGT Cystine (C) 17 R CAC Histidine (H) 39 n GCT Alanine (A) 60 8 TTA Leucine (L) 18 S CAG Glutamine (Q) 40 o GGA Glycine (G) 61 9 TTC Phenylalanine (F) 19 T CAT Histidine (H) 41 p GGC Glycine (G) 62 + TTG Leucine (L) 20 U CCA Proline (P) 42 q GGG Glycine (G) 63 / TTT Phenylalanine (F) 21 V CCC Proline (P)
    11. 11. Example: Hello, world! BASE64 SGVsbG8sIHdvcmxkIQo= BASE64 INDEX 18 6 21 44 27 6 60 44 8 7 29 47 28 38 49 36 8 16 40 DNA CAGACGCCCGTACGTACGTTAGTAAGAACTCTCGTTCTAGCGTACGCAAG ACAAGGA PROTEIN QTPVRTLVRTLVLAYARQG Any binary data can be represented: text (unicode), bitmap, audio, video, etc. Try It: http://amitsnyderman.com/school/designfrontiers/ encoder.php
    12. 12. Disk is cheap. Who cares?
    13. 13. Non-Digital Library Via recombinant DNA technologies, craft a portable, reproducible, time-resistant library. Embed, grow and spread in bacteria. Package as a pill. Organic time capsule.
    14. 14. Spime "The key to the Spime is identity. A Spime is, by definition, the protagonist of a documented process. It is an historical entity with an accessible, precise trajectory through space and time." –Bruce Sterling, Shaping Things
    15. 15. Spime Ingredients Unique ID code History of ownership Geographical position Customization details Public discourse Etc.
    16. 16. Human Identification Tools, artifacts, archeology Bone structure, teeth, dental records, fingerprints, DNA Yellowpages, resume, Facebook/LinkedIn/etc, Google
    17. 17. Narrative Embedded Histories. Family trees and Lineage. Stories.
    18. 18. Junk DNA Noncoding DNA describes sequences that do not encode for protein sequences. Much of this DNA has no known biological function and is sometimes referred to as "junk DNA". More than 98% of the human genome is non-coding.
    19. 19. Human Spime Recycle junk DNA by recombining encoded messages into non-coding DNA regions. In-vitro manipulation. Gene therapy. Hereditary storytelling.

    ×