• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
DNA Encoding Protocol
 

DNA Encoding Protocol

on

  • 2,103 views

Co-Opting the Genetic Code: DNA Encoding Protocol

Co-Opting the Genetic Code: DNA Encoding Protocol
ITP Design Frontiers in Biology and Materiality, 2010

Statistics

Views

Total Views
2,103
Views on SlideShare
1,870
Embed Views
233

Actions

Likes
2
Downloads
0
Comments
0

6 Embeds 233

http://blogs.nyu.edu 222
http://www.linkedin.com 4
http://amitsnyderman.com 3
http://prose.io 2
http://www.slideshare.net 1
http://localhost 1

Accessibility

Categories

Upload Details

Uploaded via as Apple Keynote

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />
  • <br />

DNA Encoding Protocol DNA Encoding Protocol Presentation Transcript

  • Co-opting the Genetic Code DNA Binary Encoding Protocol Amit Snyderman, ITP Design Frontiers, 2010
  • Genetic Code The genetic code is the set of rules by which information encoded in genetic material is translated into proteins by living cells.
  • DNA Deoxyribonucleic acid (DNA) contains the genetic instructions used in the development and functioning of all known living organisms. The main role of DNA molecules is the long-term storage of information.
  • Units of the Code Adenosine (A) Cytosine (C) Guanine (G) Thymine (T)
  • Codons Mapping between nucleotide triplets and amino acids 43 combinations = 64 possible codons http://upload.wikimedia.org/wikipedia/en/d/d6/GeneticCode21- version-2.svg
  • Amino Acids 20 amino acids Just as the letters of the alphabet can be combined to form an almost endless variety of words, amino acids can be linked together in varying sequences to form a vast variety of proteins. http://upload.wikimedia.org/wikipedia/commons/3/37/Aa.svg
  • Proteins Every protein is chemically defined by its unique sequence of amino acid residues, which in turn define the three-dimensional structure of the protein.
  • MIME Base64 Encoding scheme that encodes binary data by treating it numerically and translating it into a base 64 representation. TEXT M a n ASCII 77 97 110 BIT PATTERN 010011010110000101101110 INDEX 19 22 5 46 BASE64-ENCODED T W F u
  • Remap Rather than mapping to a character, map to a codon.
  • VALUE CHARACTE CODON AMINO ACID VALUE CHARACTE CODON AMINO ACID VALUE CHARACTE CODON AMINO ACID R R R 0 A AAA Lysine (K) 22 W CCG Proline (P) 43 r GGT Glycine (G) 1 B AAC Asparagine (N) 23 X CCT Proline (P) 44 s GTA Valine (V) 2 C AAG Lysine (K) 24 Y CGA Arginine (R) 45 t GTC Valine (V) 3 D AAT Asparagine (N) 25 Z CGC Arginine (R) 46 u GTG Valine (V) 4 E ACA Threonine (T) 26 a CGG Arginine (R) 47 v GTT Valine (V) 5 F ACC Threonine (T) 27 b CGT Arginine (R) 48 w TAA STOP 6 G ACG Threonine (T) 28 c CTA Leucine (L) 49 x TAC Tyrosine (Y) 7 H ACT Threonine (T) 29 d CTC Leucine (L) 50 y TAG STOP 8 I AGA Arginine (R) 30 e CTG Leucine (L) 51 z TAT Tyrosine (Y) 9 J AGC Serine (S) 31 f CTT Leucine (L) 52 0 TCA Serine (S) 10 K AGG Arginine (R) 32 g GAA Glutamate (E) 53 1 TCC Serine (S) 11 L AGT Serine (S) 33 h GAC Aspartate (D) 54 2 TCG Serine (S) 12 M ATA Isoleucine (I) 34 i GAG Glutamate (E) 55 3 TCT Serine (S) 13 N ATC Isoleucine (I) 35 j GAT Aspartate (D) 56 4 TGA STOP 14 O ATG Methionine (M) 36 k GCA Alanine (A) 57 5 TGC Cystine (C) 15 P ATT Isoleucine (I) 37 l GCC Alanine (A) 58 6 TGG Tryptophan (W) 16 Q CAA Glutamine (Q) 38 m GCG Alanine (A) 59 7 TGT Cystine (C) 17 R CAC Histidine (H) 39 n GCT Alanine (A) 60 8 TTA Leucine (L) 18 S CAG Glutamine (Q) 40 o GGA Glycine (G) 61 9 TTC Phenylalanine (F) 19 T CAT Histidine (H) 41 p GGC Glycine (G) 62 + TTG Leucine (L) 20 U CCA Proline (P) 42 q GGG Glycine (G) 63 / TTT Phenylalanine (F) 21 V CCC Proline (P)
  • Example: Hello, world! BASE64 SGVsbG8sIHdvcmxkIQo= BASE64 INDEX 18 6 21 44 27 6 60 44 8 7 29 47 28 38 49 36 8 16 40 DNA CAGACGCCCGTACGTACGTTAGTAAGAACTCTCGTTCTAGCGTACGCAAG ACAAGGA PROTEIN QTPVRTLVRTLVLAYARQG Any binary data can be represented: text (unicode), bitmap, audio, video, etc. Try It: http://amitsnyderman.com/school/designfrontiers/ encoder.php
  • Disk is cheap. Who cares?
  • Non-Digital Library Via recombinant DNA technologies, craft a portable, reproducible, time-resistant library. Embed, grow and spread in bacteria. Package as a pill. Organic time capsule.
  • Spime "The key to the Spime is identity. A Spime is, by definition, the protagonist of a documented process. It is an historical entity with an accessible, precise trajectory through space and time." –Bruce Sterling, Shaping Things
  • Spime Ingredients Unique ID code History of ownership Geographical position Customization details Public discourse Etc.
  • Human Identification Tools, artifacts, archeology Bone structure, teeth, dental records, fingerprints, DNA Yellowpages, resume, Facebook/LinkedIn/etc, Google
  • Narrative Embedded Histories. Family trees and Lineage. Stories.
  • Junk DNA Noncoding DNA describes sequences that do not encode for protein sequences. Much of this DNA has no known biological function and is sometimes referred to as "junk DNA". More than 98% of the human genome is non-coding.
  • Human Spime Recycle junk DNA by recombining encoded messages into non-coding DNA regions. In-vitro manipulation. Gene therapy. Hereditary storytelling.