Deciphering the regulatory code in the genome

Deciphering the regulatory code in the genome PhD completion seminar Denis C. Bauer Institute for Molecular Bioscience The University of Queensland, Australia By yankodesign by linh.ngân

Research Aim Thermodynamic model Develop a method that translates the regulatory message in the DNA of when and how strong a gene is expressed. AAGAAGGTTTTAGTTTAGCC Express gene with CACCGTAGGTACCTGAAGAA GAAGGTTTTAGTTTAGCCCA 70% capacity when it CCGTAGGTACCTGAAG is hot, Thanks!

Why understanding transcriptional regulation is important? •  Insight in the biology of gene pathways. •  Search for regulatory regions with specific function. •  “Re-programming” of genes has therapeutic potential. A transcription gene promoter DNA Broken regulatory Design and insert a new element regulatory element

What do we need to know for building a model able to translate the regulatory message ?

Background : Enhancer •  Genes can have independent “switches” (Enhancer) beyond the core promoter, which can start the transcription of the target gene under different conditions. transcription gene promoter enhancer regions

Background: Enhancer •  Transcription is regulated by the binding of activator and repressor TFs to an enhancer region. enhancer binding site map Active TF 8 Activators transcription Concentration 2 Repressors

Background: Repression •  Transcriptional regulation is also dependent on the interplay between activators and repressors, i.e. where they bind relative to each other. Repressor range binding site map enhancer

On which system would we test the model’s abiliJes ?

Background: Even-skipped gene (eve) Drosophila melanogaster 1 Embryo stained for eve 2 Function representation 3 1 hLp://insects.eugenes.org/ 2 Small et al. 3 hLp://bioinform.geneJka.ru

Background: Regulation of eve MSE MSE eve MSE MSE MSE Late1 3+7 2 P late2 4+6 1 5 lacZ Janssens, H. et al. QuanJtaJve and predicJve model of transcripJonal control of the Drosophila melanogaster even skipped gene. Nat Genet, 2006, 38, 1159‐1165

Hypothesis TF Bindin ns Genome conce ntraJo g site map re, a rchitectu RNA, n, m ethylaJo … predicts gene activation

Research Goals •  Optimize Thermodynamic models efficiently. •  Analyze robustness of these models. •  Explore the regulation of a particular gene. •  Examine how the regulatory program evolves. •  Extend current thermodynamic model. Cooperphoto/CORBIS

Model definition Site occupancy (Hill function) Kt · K(s, t) · [t] p(s, t) = 1 + Kt · K(s, t) · [t] Free parameters TF PARAMS Total activation K Binding affinity W (S, T ) = Ets p(s, ts ) 1 − Ets · p(s , ts ) · d(s, s ) s∈S A s ∈S R E Effectiveness quenching of the activator activator contribution GENERAL PARAMS Transcription rate (Arrhenius function)  R0 Max. transcription  R exp W (S, T ) − G0 iﬀ W < G0 rate 0 R(S, T ) =  R0 otherwise, G0 Energy barrier ts ts Buena Vista Pictures s s Janssens, H. et al. QuanJtaJve and predicJve model of transcripJonal control of the Drosophila melanogaster even skipped gene. Nat Genet, 2006, 38, 1159‐1165

Training the model 200 100 50 0 < [TF ], [TF ], [TF ], [TF ] > 0 20 40 60 80 100 1 2 3 4 TF Binding TF Concentration Thermodynamic Model predicted Adjust model expression and parameters to 150 100 compare it to improve fit 50 target 0 40 50 60 70 80 90

Optimization methods •  Two optimization paradigms –  Simulated Annealing •  LAM schedule (Reinitz et al. 2003) •  Geometric cooling –  Gradient descent •  Three GD variants approximating the objective function, which was not continuously differentiable. •  Judged on accuracy achieved in the given time –  Drosophila MSE2 data with 400 data points and 7 TF (16 free parameters).

Optimization Simulated Annealing Gradient Descent 1.00 20 20 SA LAM 0.99 SA geom 0.99 15 15 RMS error 0.98 RMS error CC CC 10 10 0.97 0.97 SA_geom 5 5 0.96 GD_softmax SA LAM GD_nomax SA geom 0.95 GD_max 0.95 0 0 1 2 5 10 50 200 1 2 1 5 2 105 20 10 50 100 50 200200500 time [minutes] time [minutes] time [minutes] Suggests: many local minima. Bauer, D. C. & Bailey, T. L. OpJmizing staJc thermodynamic models of transcripJonal regulaJon. BioinformaJcs, 2009, 25, 1640‐1646

If gradient descent gets stuck in local minima all the Jme, how does the opJmizaJon landscape look like ?

Landscape analysis •  Synthetic data based on real MSE2 data –  global minimum and solution (parameter values) are known. –  Measuring distance of the optimization solution to the starting position and the known solution. –  Measuring error reduction at the solution compared to the starting position.

Landscape analysis Experiment Ini$al distance to Final distance to Error Red. solu4on (mean) solu4on (mean) (mean) 1% perturbed 3.4·10−4 2.8·10−4 88% random 0.1 0.11 97% Conclusion: many local minima. Bauer, D. C. & Bailey, T. L. OpJmizing staJc thermodynamic models of transcripJonal regulaJon. BioinformaJcs, 2009, 25, 1640‐1646

Does the model over-fit ? •  Cross-validation (5-fold) Experiment Mean RMS error Mean CC (SE) (SE) training 13.39 (0.004) 0.92 (4.8 · 10−5 ) tesJng 14.04 (0.005) 0.91 (5.7 · 10−5 ) •  Redundancy reduction –  Not enough data to begin with

Summary: Optimization & Analysis •  The objective function is ill-posed. –  It has a plethora of local minima. –  It might have many global minima. •  Hence SA is the method of choice. •  There might be a tendency to over-fit the data. hLp://www2.cmp.uea.ac.uk/~aih/code/SVM/KernelTrickDemo.html hLp://images.nciku.com/

Research Goals •  Optimize Thermodynamic models efficiently •  Analyze robustness of these models •  Explore the regulation of a particular gene •  Examine how the regulatory program evolves •  Extend current thermodynamic model Cooperphoto/CORBIS

Regulation and Evolution of eve •  Mechanism for regulating eve is conserved: –  Stripe 2 elements from other Drosophila species activate eve in D. mel. correctly. –  Despite the substantial difference in the regulatory DNA sequence. hLp://www.bio.ilstu.edu/Edwards/ Hare, E. E. et al. Sepsid even‐skipped enhancers are funcJonally conserved in Drosophila despite lack of sequence conservaJon. PLoS Genet, 2008, 4, e1000106

Evaluate Evolution of MSE2 •  Test if the model can identify the MSE2 in these other species. •  Test if the model correctly predicts the transcriptional output of the homologous MSE2s.

Searching for MSE2 •  Apply a model trained on D. mel. MSE2 to the TFBS-map from sequential windows to find the MSE2 in other species MSE2 promoter eve Other species 150 100 50 0 40 50 60 70 80 90 150 RMS error 100 50 0 40 50 60 70 80 90 < 23 27 43 … 13 … > Bauer, D. C. & Bailey, T. L. Studying the funcJonal conservaJon of cis‐regulatory modules and their transcripJonal output. BMC BioinformaJcs, 2008, 9, 220

Searching for MSE2: Result •  Correctly identified the MSE2 in 6/8 species 40 D. melanogaster 30 20 RMS error 10 40 D.pseudoobscura 30 20 10 rms error Genomic locaJon 40 Bauer, D. C. & Bailey, T. L. Studying the funcJonal conservaJon of cis‐regulatory modules 30 rimshawi and their transcripJonal output. BMC BioinformaJcs, 2008, 9, 220 20

Predicting the output in other species •  Apply a model trained on D. mel. MSE2 to the MSE2s in other species D. melanogaster 15 150 Target 10 D. melanogaster Log odds score (bits) relative RNA concentration 5 D. pseudoobscura 0 D. ananassae !5 100 D. mojavensis !10 !15 0 500 1000 1500 D. mojavensis rel. genomic position 50 bicoid kruppel giant hunchback knirps caudal tailless 0 40 50 60 70 80 90 A!P position (%) Bauer, D. C. & Bailey, T. L. Studying the funcJonal conservaJon of cis‐regulatory modules and their transcripJonal output. BMC BioinformaJcs, 2008, 9, 220

Summary Application •  Model fits the data qualitatively. •  Predictions are biologically meaningful. •  However, there is room for improvement.

Research Goals •  Optimize Thermodynamic models efficiently •  Analyze robustness of these models •  Explore the regulation of a particular gene •  Examine how the regulatory program evolves •  Extend current thermodynamic model Cooperphoto/CORBIS

One role fits them all? •  Dual function is proposed for some of the regulatory TFs. –  E.g. TF Hunchback (Hb) might be an activator when regulating stripe2 and repressor for stripe3. Late1 3+7 2 P late2 4+6 1 5 Papatsenko, D. & Levine, M. S. Dual regulaJon by the Hunchback gradient in the Drosophila embryo. Proc Natl Acad Sci U S A, 2008, 105, 2901‐2906 Schroeder, M. D. et al. TranscripJonal control in the segmentaJon gene network of Drosophila. PLoS Biol, 2004, 2, E271

Determine the regulatory role of TFs •  Different data set: 44 CRMs important for D. mel. development but same set of TFs. •  Determine the best role for each TF in each of the CRMs –  Brute Force: train a model for all TF role-combinations on each of the 44 CRMs. –  Record the correlation achieved. –  Identify TFs that have dual-function. Segal, E. et al. PredicJng expression paLerns from regulatory sequence includes Drosophila segmentaJon. Nature, 2008, 451, 535‐540 Bauer, D. C.; Buske, F. A. & Bailey, T. L. Dual funcJoning transcripJon factors regulated by SUMOylaJon in the developmental gene network of Drosophila melanogaster submiLed for publicaJon, 2009

TFs with dual role Bcd Cad Hb Tll Gt Kr Kni TorRE Det. roles s + s ‐ s s ‐ s Literature + + s ‐ (s) s ‐ NA (consensus) “s”: dual-functioning, “+”: activator, “-”: repressor. •  E.g. Hb –  Activator for 17 CRMs –  Repressor for 27 CRMs Perkins, T. J. et al. Reverse engineering the gap gene network of Drosophila melanogaster. PLoS Comput Biol, 2006, 2, e51 Schroeder, M. D. et al. TranscripJonal control in the segmentaJon gene network of Drosophila. PLoS Biol, 2004, 2, E271

Improvement with dual function kr_CD1_ru hb_anterior_actv 1.0 1.0 1.0 target previous roles HbDual Experiment number of mean CC KrDual free (SE) 0.8 0.8 0.8 HbKrDual best parameters Previous 18 0.27 (0.008) 0.6 0.6 0.6 mRNA mRNA mRNA roles HbDual 19 0.35 (0.009) 0.4 0.4 0.4 KrDual 19 0.37 (0.007) 0.2 0.2 0.2 HbKrDual 20 0.38 (0.007) 0.0 0.0 0.0 0 20 40 60 80 100 0 20 40 60 80 100 AP AP Bauer, D. C.; Buske, F. A. & Bailey, T. L. Dual funcJoning transcripJon factors regulated by run_stripe5 SUMOylaJon in the developmental gene network of Drosophila melanogaster submiLed eve_37ext_ru for publicaJon, 2009 .0 .0 .0

Marker motifs for dual function •  Running MEME on the protein sequence of dual- functioning TFs to find short motifs (<6aa) present in all of them. CI KE 4 4 Q 3 3 K D ID bits bits 2 G 2 1 0 L E Y Q 1 0 L V 1 2 3 4 1 2 3 4 MEME (no SSC) 15.07.09 12:07 MEME (no SSC) 15.07.09 12:07 SUMOyla(on mo(f

SUMOylation •  Small Ubiquitin-related Modifier a SUMO protease SU small protein covalently attached ATP to target-proteins. SU SUMO •  Involved in many pathways/ SU pathway mechanisms E1 activating enzyme –  Compartmentisation target protein + E3 ligasis –  Transcriptional regulation SU •  Can reverse the function of a TF e.g. E2 conjugating enzyme Ikaros (the human homologue of Kr) •  SUMO (Smt3) is present in D. mel during development Bauer, D. C.; Buske, F. A.; Bailey, T. L. & Bodén, M. PredicJng SUMOylaJon sites in developmental transcripJon factors of Drosophila melanogaster NeurocompuJng, 2009, in submission del Arco, P. G. et al. Ikaros SUMOylaJon: switching out of repression. Mol Cell Biol 2005, 25, 2688‐2697

Conclusion •  Thermodynamic models can be best optimized using SA but over-fitting is an issue to keep in mind. Bauer, D. C. & Bailey, T. L. OpJmizing staJc thermodynamic models of transcripJonal regulaJon. BioinformaJcs, 2009, 25, 1640‐1646 •  Non-the-less, they are applicable for –  examining the mechanisms of transcriptional regulation, –  explore the evolution of a particular regulatory mechanism Bauer, D. C. & Bailey, T. L. Studying the funcJonal conservaJon of cis‐regulatory modules and their transcripJonal output. BMC BioinformaJcs, 2008, 9, 220 •  Model prediction improves when dual-function is allowed. Bauer, D. C.; Buske, F. A. & Bailey, T. L. Dual funcJoning transcripJon factors regulated by SUMOylaJon in the developmental gene network of Drosophila melanogaster submiLed for publicaJon, 2009 –  SUMOylation seems to be a good candidate for the biological mechanism of role-change. Bauer, D. C.; Buske, F. A.; Bailey, T. L. & Bodén, M. PredicJng SUMOylaJon sites in developmental transcripJon factors of Drosophila melanogaster NeurocompuJng, 2009, in submission

Acknowledgments •  IMB •  Funding –  Timothy Bailey (supervisor) –  Institute for Molecular –  Mikael Bodén (supervisor) Bioscience, The University of –  Sean Grimmond (thesis committee) Queensland –  Nick Hamilton (thesis committee) –  Australian Research Council –  Fabian Buske Centre of Excellence in –  Stefan Maetschke Bioinformatics –  National Institutes of Health •  Stony Brook University –  John Reinitz –  UQ International Research Tuition Award Framework for modeling, visualizing, and predicJng the regulaJon of the transcripJon rate of a target gene www.bioinforma(cs.org.au/stream

www.bioinforma(cs.org.au/stream •  Framework for modeling, visualizing, and predicting the regulation of the transcription rate of a target gene. •  Publicly available •  Modular: New functions can be plugged in Many functions Command line Bauer, D.C. and Bailey, T.L, STREAM ‐ StaJc Thermodynamic REgulAtory Model for transcripJonal. BioinformaJcs, 2008, 24, 2544‐2545.

Deciphering the regulatory code in the genome

by Denis Bauer on Aug 21, 2009

Accessibility

Categories

Tags

Upload Details

Usage Rights

2 Embeds 18

Statistics

Deciphering the regulatory code in the genome — Presentation Transcript

http://streamtr.blogspot.com	17
http://www.slideshare.net	1