• Save
Diagnostico Molecular Enf 2 Qca Clin Esp Nov Pdf
Upcoming SlideShare
Loading in...5
×
 

Diagnostico Molecular Enf 2 Qca Clin Esp Nov Pdf

on

  • 3,404 views

 

Statistics

Views

Total Views
3,404
Slideshare-icon Views on SlideShare
3,378
Embed Views
26

Actions

Likes
2
Downloads
0
Comments
0

1 Embed 26

http://www.slideshare.net 26

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Diagnostico Molecular Enf 2 Qca Clin Esp Nov Pdf Diagnostico Molecular Enf 2 Qca Clin Esp Nov Pdf Presentation Transcript

    • Laboratorio de Genética DIAGNOSTICO MOLECULAR DE ENFERMEDADES ADRIANA MARIA GIL ZAPATA Msc. CIENCIAS BASICAS BIOMEDICAS
    • Laboratorio de Genética DESPLIEGUE DIFERENCIAL No se requiere conocer la secuencia del ARN y analiza alteraciones en el ARNm. Es una modificacion de RT-PCR Inicia con cDNA-a partir de mRNA. Usa 4 poli de timidina diferentes unen a las colas de poliadenilacion de los mRNA
    • DESPLIEGUE DIFERENCIAL Laboratorio de Genética
    • Laboratorio de Genética DESPLIEGUE DIFERENCIAL No tiene reproducibilidad y por tanto no se aplica en el dx clinico. La cantidad de ARN es pequeña. Se observa la presencia o ausencia de una banda no como en PCR por intensidad.
    • Laboratorio de Genética Enfermedades hereditarias Confirmación a nivel molecular del defecto Detectada la mutacion y confirmado el diagnostico El efecto de la mutación en la proteína codificada: Cambio de conformación Alteración o perdida de función Disminución en su expresión.
    • Laboratorio de Genética Diagnostico molecular Actualmente no se detectan a los patógenos mediante técnicas de cultivo que aislan al agente infeccioso, podemos simplemente detectar la presencia del ADN del patógeno directamente del espécimen clínico, lo cual conlleva a un considerable ahorro de tiempo y dinero.
    • Laboratorio de Genética PARASITOLOGIA El diagnóstico molecular consiste en extraer ADN y analizarlo con la técnica PCR y detectar, en tiempo real, la amplificación del genoma de interés. El método clásico consiste en la detección del parásito en sangre o en heces, pero este procedimiento es poco sensible, sobre todo cuando el paciente tiene una baja carga parasitaria, lo cual puede ocurrir incluso cuando los síntomas de la enfermedad son claros. Un método de diagnóstico más avanzado es el inmunológico, que se basa en la reacción que producen los antígenos en las muestras de sangre, una técnica más sensible, pero poco específica, ya que también se pueden producir reacciones con otros microorganismos similares a los que se intentan detectar.
    • Laboratorio de Genética MICROBIOLOGIA El diagnóstico serológico de utilidad en la clínica se tiene solamente disponible para N. Brasiliensis pero en todos los otros casos estos no es posible. Los avances de la Biología Molecular a través de la técnica de la reacción en cadena de la polimerasa permite detectar un número muy pequeño de bacterias en cultivos aislados de pacientes infectados.
    • Laboratorio de Genética ADN Las tecnicas que utilizan el ADN, tiene ventajas sobre las proteinas, debido a que el ADN tiene la propiedad de autoreplicarse y es posible obtner millones de copias en el laboratorio clinico en horas gracias a la tecnica de PCR
    • 5´ 3´ TIPOS DE POLIMORFISMOS DE LONGITUD DE SECUENCIA Se producen por inserciones o delecciones Provocado por el cambio de uno o mas de uno o mas nucleótidos. nucleotidos en la secuencia de ADN. Se observa mas frecuentemente en el ADN Ej: mutaciones puntuales en el ADN-mt repetitivo: minisatélites y microsatélites. GGTTTTACATCACTGGAATCTTCCAAA TTCTTGCTGGTAAGTTGTGGATGGTAA AGTCCATGTGGAAG C/T GGGGTGCAT GATA GATA GATA GATA GATA CCAAGTCTGCGGAATG GATA GATA GATA UNIDAD DE REPETICIÓN GATA REGIÓN DE FLANQUEO
    • Laboratorio * POLIMORFISMOS DE ADN HIPERVARIABLE de Genética STRs: Short tandem repeat ADN Repetitivo Microsatélite Secuencias repetidas en tándem Unidades de repetición: entre 2-7 pb Tamaño: comprendido entre 80-550pb. 5´ 3´ TATC TATC TATC TATC TATC
    • (ATGA)n STRs 2 VECES A T G A A T G A 3 VECES A T G A A T G A A T G A 4 VECES A T G A A T G A A T G A A T G A 5 VECES A T G A A T G A A T G A A T G A A T G A
    • Laboratorio de Genética PARA QUE QUEREMOS OTROS MARCADORES? • Metodologías de alto rendimiento para: Bases de datos de ADN (1 millón de perfiles por año) Necesidad de grandes estudios de mt-ADN/ cromosoma Y • Automatización-Miniaturización • Mayor sensibilidad • Mayor información (origen geográfico) • Características físicas • Análisis de ADN degradado
    • Laboratorio de Genética SNPs: Single Nucleotide Polimorphism • Son polimorfismos de secuencia • Es la variación mas frecuente en el genoma humano • Se encuentran tanto en el ADN nuclear como en el mtDNA • Presentan una tasa de mutación baja (Mutation rate 10-8)(STR 10-3) • Son marcadores facilmente amplificables en multiplex • Se analizan facilmente con técnicas de alto rendimiento (ej:microarrays) • 1 SNP cada 279 pb HapMap Bases : 13 millones SNPs • Indels, Inserciones ALU NCBI Database: http://www.ncbi.nlm.nih.gov/SNP/
    • Laboratorio de Genética Sequence variation G ATCGGCTAGCTGATCGACGATGACCGTAGCGTTGAT T CGGTAGGCTAGCTGAAACTTAACGGA . SNPs ATTACTGATCGGTAGCTGAGCCAATGGCAGTGATGG GATA GATA GATA GATA GATA GATA GATA GATA ATGGTAGCTGAGTGCTGGACAT Minisatel Microsatellites or STRs ATCGGCTAGCTGATCGACGATGACCCGGTAG ATCTACGGATGGCTGACTGATG ATCTACGGATGGCTGACTGATG ATCTACGGATGGCTGACTGATG Minisatellites ATCTACGGATGGCTGACTGATG GTAGCGTCTGATCGTGATGGCTCGTTAGA GTAGC[300bp -- 6.1kb units]ATCGGC SINES (Alu) / LINES
    • Laboratorio de Genética SNPs Posibilidad de analizar características físicas Predicción mas segura del origen geográfico de un vestigio Análisis de muestras degradadas (amplicones mas pequeños Resolución de casos complejos de parentesco
    • Laboratorio de Genética ¿Por que son importantes los SNPs específicos de población? AUMENTO DE MEZCLA DE POBLACIONES EN TODO EL MUNDO Europeos 92% Iberoamericanos 3.9% Africanos 1.5% Asiáticos 0.6% Mezcla de población 1.9% EL AUMENTO DE INMIGRACIÓN: africana, iberoamericana, etc.
    • Laboratorio de Genética SNaPshot G AZUL A VERDE C NEGRO T ROJO
    • Laboratorio Preparación del chip para de Genética análisis MALDI-TOF Dispensador SpectroPOINT™ SpectroCHIP™ : 384 puntos
    • Laboratorio de Genética MALDI-TOF Chip: muestra + matriz Espectómetro: 1) láser, volatiliza la muestra 2) campo eléctrico acelera los iones 3) vuelo en columna de vacío 4) sistema de detección TOF: el tiempo de vuelo en la columna es proporcional a la masa
    • Laboratorio de Genética SNPs Autosómicos: 52-plex Selección de SNPs Comprobación de frecuencias Contenido polimórfico Ligamiento Calidad de la secuencia
    • Laboratorio de Genética Estrategia inicial SELECCIONAR SNPs EN EL BRAZO CORTO Y EN EL BRAZO LARGO DE CADA CROMOSOMA AUTOSÓMICO PRUEBA PILOTO CON 22 SNPs EN UN MULTIPLEX CON SNapShot HACER ESTUDIO DE LAS FRECUENCIAS ALÉLICAS
    • Laboratorio de Genética Validacion de SNPs elegidos Los SNPs deben: – Estar fuera de regiones repetitivas
    • Laboratorio de Genética Validacion de SNPs elegidos Los SNPs deben: – Estar fuera de regiones repetitivas – Ser únicos: que solo se encuentren una vez en el genoma
    • Laboratorio de Genética Validacion de SNPs elegidos Los SNPs deben: – Estar fuera de regiones repetitivas – Ser únicos: que solo se encuentren una vez en el genoma – Tener buenas estimas de frecuencia
    • Laboratorio Ligamiento de Genética Límite de proximidad de los SNPs candidatos a genes es 100Kb.
    • Laboratorio de Genética Posicion de los SNP
    • PowerPlex16 system AmpFlSTR Identifiler AmpFlSTR Minifiler NIST’s MiniNC01
    • Laboratorio de Genética • El saber si los SNPs van a sustituir o no a los STRs es difícil de predecir. Sin embargo son una herramienta complementaria a los STRs en aplicaciones como el estudio de muestras degradadas, paternidades deficientes o para determinar el origen geográfico de un vestigio biológico e incluso para inferir características físicas • La creación de grandes multiplexes es la llave para el análisis forense, que con los SNPs y las nuevas tecnologías se flexibiliza y se hace posible
    • Laboratorio de Genética
    • Laboratorio de Genética
    • Laboratorio de Genética
    • Laboratorio de Genética
    • Laboratorio de Genética
    • Laboratorio de Genética EPIDEMIOLOGIA Síndrome Lesch-nyhan Frecuencia 1 : 380.000 nacidos vivos. Edad de aparición 1 a 2 años. Mas afectados los hombres que las mujeres. Expectativa de vida tiene un promedio de 20 años.
    • Laboratorio de Genética HERENCIA Síndrome Lesch-nyhan Recesiva ligada al cromosoma X Los hombres están afectados o sanos. Las mujeres: sanas, portadoras o afectadas.
    • Laboratorio de Genética Actividad residual HGPRT Variante hiperuricemica: Actividad residual HGPRT Mayor de 8%. Sobreproducción de ácido úrico, asociada con nefrolitiasis y gota.
    • Laboratorio de Genética Actividad residual HGPRT Variante neurológica: Actividad residual HGPRT: 1.5 - 8%. Sobreproducción de ácido úrico, incapacidad neurológica menor.
    • Laboratorio de Genética Actividad residual HGPRT Enfermedad de Lesch-Nyhan: Actividad residual de la enzima HGPRT: menor 1.5 %. Sobreproducción de ácido urico, incapacidad neurologica y cognitiva, anormalidades en el comportamiento caracterizado por automutilacion
    • Laboratorio de Genética AFECTADO Síndrome Lesch-nyhan
    • Laboratorio de Genética AFECTADO Síndrome Lesch-nyhan
    • Laboratorio de Genética GEN HPRT Mapeado Xq26, 57Kb. Clonado y secuenciado más de 300 mutaciones. 9 Exones y 8 Intrones. 30% secuencias no codificantes consisten en STRs y 49 repeticiones Alu.
    • Laboratorio de Genética GEN HPRT INTRÓN 3 Exones Tamaño Intrones Tamaño TCTA TCTA TCTA TCTA (pb) (pb) EXON 1 26 INTRON 1 13075 EXON 2 106 INTRON 2 1715 EXON 3 183 INTRON 3 11103 EXON 4 65 INTRON 4 3659 EXON 5 17 INTRON 5 3301 EXON 6 82 INTRON 6 4794 EXON 7 46 INTRON 7 170 EXON 8 78 INTRON 8 1343 Referencia:Edwars A, Voss H. Rice P. Civitello A. Stegemann J. Schwager C. Zimmermann J, Erfle H. EXON 9 47 Caskey CT. Ansorge W: Automated DNA sequencingOf the human HPRT locus. Genomics 6:593,1990.
    • Laboratorio de Genética MUTACIONES Síndrome Lesch-Nyhan VARIANTE VARIANTE MUTACIONES LESCH-NYHAN HIPERURICEMI NEUROLÓGICA CA Puntuales 111 55 5 Deleciones 60 2 3 Inserciones 19 1 0 Otras 5 5 0
    • Laboratorio de Genética METODOLOGIA n = 16 Síndrome Lesch-nyhan Consentimiento informado Sangre venosa Extracción ADN Extracció PCR STR HPRTB Secuenciación CHELEX Electroforesis capilar Genotipificación
    • Laboratorio de Genética INTRON 3 GEN HPRT STR HPRTB Fluorocro Composició Composició Primer Alelos Longitud mo n secuencia S: 5’TCTCTACTGTCT3’ 5’ TCTCTACTGTCT3 9- 268- 6 FAM 17 300pb (TCTA)n AS:5’TCACCCCTGTCT3’ AS:5’ TCACCCCTGTCT3 TCTA TCTA TCTA TCTA TCTA = Alelo 5 TCTA TCTA TCTA TCTA TCTA TCTA = Alelo 6 TCTA TCTA TCTA TCTA TCTA TCTA TCTA = Alelo 7 TCTA TCTA TCTA TCTA TCTA TCTA TCTA TCTA = Alelo 8 TCTA TCTA TCTA TCTA TCTA TCTA TCTA TCTA TCTA = Alelo 9
    • Laboratorio de Genética ELECTROFEROGRAMA STR HPRTB
    • Laboratorio de Genética ARBOL GENEALOGICO STR HPRTB
    • Laboratorio de Genética SECUENCIACION Delecion de una Adenina en el exon 2, ocasiono un cambio de lectura con un codon de parada
    • Laboratorio de Genética CONCLUSIONES Se caracterizo una mutación en el exón 2 del gen HPRT analizado en los miembros de la familia colombiana afectada por el SLN. El STR del Cromosoma X (HPRTB), localizado en el Intrón 3 del gen HPRT permitió establecer el estado de portadora en las mujeres de la familia afectada por el SLN.
    • Laboratorio de Genética CONCLUSIONES La detección de portadoras es una herramienta valiosa en esta enfermedad en la cual no existe un tratamiento efectivo, y por tanto la consejería genética puede contribuir a disminuir la aparición de nuevos casos. El SLN, tiene diferentes mutaciones en cada uno de los exones e intrones del gen HPRT , esto hace que el abordaje sea muy complejo y costoso a la hora de caracterizar la mutación que dió origen a la enfermedad en cada familia.