Lista de exercícios – Ácidos Nucléicos – 1º Ano – Profº Belan01. O que significa: DNA e RNA                         06. Nu...
09. Escreva a sequência de bases da fitacomplementar do DNA dupla fita que apresenta umafita com a sequência:(5) ATGCCGTAT...
Upcoming SlideShare
Loading in...5
×

Lista de exerc - Acidos Nucleicos - 1ano

2,865

Published on

0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
2,865
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
21
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Lista de exerc - Acidos Nucleicos - 1ano

  1. 1. Lista de exercícios – Ácidos Nucléicos – 1º Ano – Profº Belan01. O que significa: DNA e RNA 06. Numa molécula de DNA, a quantidade de... a) adenina mais timina é igual à de citosina mais guanina. b) citosina mais uracila é igual à de timina mais adenina. c) uracila mais adenina é igual à de citosina mais02. As bases nitrogenadas podem dividir-se em dois guanina.grupos. Caracterize esses dois grupos, indicando as d) guanina mais timina é igual à de citosina maisbases constituintes; uracila. e) adenina mais citosina é igual à de guanina mais timina. 07. O esquema seguinte representa duas cadeias de ácidos nucléicos. Podemos concluir que...03. Desenhe a composição de um nucleotídeo,identificando suas partes. a) I e II correspondem a duas moléculas de RNA. b) I e II correspondem a duas cadeias de uma molécula de RNA.04. Os nucleotídeos estabelecem ligações entre si, c) I e II correspondem a duas cadeias de umaformando cadeias polinucleotídicas. Refira como se molécula de DNA.designam essas ligações. d) I corresponde a uma cadeia de DNA e II a uma cadeia de RNA. e) I corresponde a uma cadeia de RNA e II a uma cadeia de DNA. 08. O esquema seguinte é referente à estrutura do05. A molécula de DNA é constituída por... DNA. Os algarismos 1, 2 e 3 representam, respectivamente...a) uma cadeia de polipeptídeos unidos por pontes de hidrogênio.b) duas cadeias de polipeptídeos formando uma dupla hélice.c) uma cadeia de nucleotídeos que tem a capacidade de se replicar.d) duas cadeias de nucleotídeos unidas por pontes de hidrogênio.e) duas cadeias de bases nitrogenadas unidas por polipeptídeos. a) base nitrogenada, desoxirribose e fosfato. b) base nitrogenada, fosfato e desoxirribose. c) fosfato, desoxirribose e base nitrogenada. d) fosfato, base nitrogenada e desoxirribose. e) desoxirribose, fosfato e base nitrogenada.
  2. 2. 09. Escreva a sequência de bases da fitacomplementar do DNA dupla fita que apresenta umafita com a sequência:(5) ATGCCGTATGCATTGCATTC (3)10. Num organismo um pesquisador verificou queuma molécula de DNA continha 22% de GUANINA.Com base nesta informação determine qual opercentual de cada uma das outras bases.11. Cite as principais diferenças entre RNA e DNAquanto à estrutura de nucleotídeos?12. Se uma fita de DNA tiver constituição5’ATAAGCGTTAG 3’, como será a moléculacomplementar de DNA?

×