Your SlideShare is downloading. ×
  • Like
Lista de exerc - Acidos Nucleicos - 1ano
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Now you can save presentations on your phone or tablet

Available for both IPhone and Android

Text the download link to your phone

Standard text messaging rates apply

Lista de exerc - Acidos Nucleicos - 1ano

  • 2,691 views
Published

 

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
No Downloads

Views

Total Views
2,691
On SlideShare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
18
Comments
0
Likes
1

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Lista de exercícios – Ácidos Nucléicos – 1º Ano – Profº Belan01. O que significa: DNA e RNA 06. Numa molécula de DNA, a quantidade de... a) adenina mais timina é igual à de citosina mais guanina. b) citosina mais uracila é igual à de timina mais adenina. c) uracila mais adenina é igual à de citosina mais02. As bases nitrogenadas podem dividir-se em dois guanina.grupos. Caracterize esses dois grupos, indicando as d) guanina mais timina é igual à de citosina maisbases constituintes; uracila. e) adenina mais citosina é igual à de guanina mais timina. 07. O esquema seguinte representa duas cadeias de ácidos nucléicos. Podemos concluir que...03. Desenhe a composição de um nucleotídeo,identificando suas partes. a) I e II correspondem a duas moléculas de RNA. b) I e II correspondem a duas cadeias de uma molécula de RNA.04. Os nucleotídeos estabelecem ligações entre si, c) I e II correspondem a duas cadeias de umaformando cadeias polinucleotídicas. Refira como se molécula de DNA.designam essas ligações. d) I corresponde a uma cadeia de DNA e II a uma cadeia de RNA. e) I corresponde a uma cadeia de RNA e II a uma cadeia de DNA. 08. O esquema seguinte é referente à estrutura do05. A molécula de DNA é constituída por... DNA. Os algarismos 1, 2 e 3 representam, respectivamente...a) uma cadeia de polipeptídeos unidos por pontes de hidrogênio.b) duas cadeias de polipeptídeos formando uma dupla hélice.c) uma cadeia de nucleotídeos que tem a capacidade de se replicar.d) duas cadeias de nucleotídeos unidas por pontes de hidrogênio.e) duas cadeias de bases nitrogenadas unidas por polipeptídeos. a) base nitrogenada, desoxirribose e fosfato. b) base nitrogenada, fosfato e desoxirribose. c) fosfato, desoxirribose e base nitrogenada. d) fosfato, base nitrogenada e desoxirribose. e) desoxirribose, fosfato e base nitrogenada.
  • 2. 09. Escreva a sequência de bases da fitacomplementar do DNA dupla fita que apresenta umafita com a sequência:(5) ATGCCGTATGCATTGCATTC (3)10. Num organismo um pesquisador verificou queuma molécula de DNA continha 22% de GUANINA.Com base nesta informação determine qual opercentual de cada uma das outras bases.11. Cite as principais diferenças entre RNA e DNAquanto à estrutura de nucleotídeos?12. Se uma fita de DNA tiver constituição5’ATAAGCGTTAG 3’, como será a moléculacomplementar de DNA?