DNA Essential Questions: 1) What is DNA and why is it important? 2) What does the structure of DNA look like? 3) How and why does DNA replicate? 4) How is DNA a genetic code? 5) What is protein synthesis? 6) How are genes on the DNA strands used to make proteins in a cell?

Guided Note Packet #1- What is DNA and why is it important? What does DNA look like? Guided Note Packet #2- How and why does DNA replicate? Guided Note Packet #3- What is protein synthesis? How is DNA a genetic code?

What does DNA look like? DNA Extraction Lab

DNA Extraction Demonstration What does DNA from a banana look like? DNA Source: Banana DNA Soup = 1 c banana, 1 c water, pinch of salt and blended Why is salt needed? Why is pineapple juice needed? Why is liquid soap needed? Why is alcohol needed?

Procedure: 1. Filter DNA soup into beaker 2. Pour contents into test tube up to 1/3 full 3. Add soap to test tube (10 drops) and swirl 4. Wait 5 minutes 5. Observe everyone else's soup and record in the chart 6. Add 3 drops of pineapple juice 7. Have Ms. Bennett pour in rubbing alcohol 8. Start to see particles of DNA

Cell Nucleus Cell Membrane *Salt and Blender break membrane *Soap breaks the nuclear membrane *Enzyme in pineapple juice neutralizes digestive enzymes found in the cell and prevent DNA from being broken apart *Alcohol allows the DNA to seperate from the cell contents and become visible to us

What is DNA and What does it look like?

Class Notes on DNA Why are Chromosomes Important? 1. We have mentioned that traits are passed from _______________ to _______________. 2. Genetic information, or ___________ is located on chromosomes. 3. Chromosomes are made up of _______________. 4. Chromosomes are divided into ________________. Chromosome gene gene gene GCATTAGCTGACTAGGTCAGCAGTCATCATGGGCCATATAAAATTTTGGGCCTGTCTGATCA CGTAATCGACTGAT CCAGTCG TCAGTAGTAC CCG GTATATTTTAAAAC CCGGACAGACTGT DNA bases

5. A chromosome can have _______________ genes or more. 6. Each gene determines a certain ______________, such as hairline. 7. Scientists usually ________________ the chromosomes in an organism. 8. The only chromosomes that are not numbered are the ____________ chromosomes, they are called X and Y. 9. Chromosomes that are assigned the same number are called __________________. Ex: chromosome number 3 from mom is homologous with chromosome number 3 from dad 10. Homologous chromosomes have the same __________ on them. Ex: In pea plants, the gene for plant height is found on chromosome number 4

12. When an organism produces sex cells (sperm and egg), genes are mixed up due to crossing over during meiosis, and __________________ ____________________ occurs in the offspring. 11. Homologous chromosomes may have different ______________ (dominant or recessive), but the types of genes are the same.

Why is DNA so important? 1. The DNA in genes is the directions or blueprints for making _______________. 2. Proteins are essential for ______________. They allow us to run, think, digest, etc. The Structure of DNA 1. We have learned that DNA is a _____________ ______________ made up of nucleotides. 2. The DNA in one chromosome can be ______________ of nucleotides long. 3. Because of this, it can hold a lot of _________________.

Nucleotides 1. Nucleotides have three parts: a ____________, a ________________ group, and a ______________ base. 2. The sugar in DNA is called _________________. 3. The phosphate looks like this: 4. A nucleotide can have 4 different bases: ______, ______, _____, _____ 5. The nitrogen bases are what make one nucleotide ______________ from another.

7. We draw it this way as a shortcut: 8. It is sometimes called the _________, the _________________ pool and the ___________________. 9. When you put many _____________________ together, you get a chain or strand of DNA. 10. The sugars and the phosphates form the _________________ of the chain and the bases stick out like ______________ on a ______________. pool house garage C T G A

6. This is what a nucleotide looks like with all the parts together.

How is DNA a genetic code? The sequence of bases on a strand of DNA tells us a lot of information. Let's think of the sequence of bases as the DNA alphabet, there are four letters (A, T, C, G). In this alphabet, there are 64 possible words (AAA, TTT, GCG, GTC, etc.) All words have only 3 letters. This is called a CODON. When you put many of these words together, you form a sentence. (AAAGCTCCCGAA). This is known as a gene.

DNA Alphabet Letters- Nitrogen bases (A,T,C,G) Words- Codons (TTC,TTT,GGG,GCG, etc. up to 64) Sentences- genes (TTCTTTAAAGCGATGCGT) These letters are specific codes that hold a lot of information: Codons = particular amino acids Genes = chains of amino acids, which are proteins and can determine certain traits or characteristics of an organism What information does this genetic code tell us?

DNA RNA nucleic acid Uracil adenine guanine cytosine single stranded double stranded sugar = ribose sugar= deoxyribose thymine mRNA = messenger RNA tRNA = transfer RNA