Your SlideShare is downloading. ×
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Libro factores de riesgo cardiovascular Risaralda
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Libro factores de riesgo cardiovascular Risaralda

1,466

Published on

Published in: Health & Medicine
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
1,466
On Slideshare
0
From Embeds
0
Number of Embeds
4
Actions
Shares
0
Downloads
16
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO I INTRODUCCION Y ANTECEDENTESEn Colombia la enfermedad cardiovascular (ECV) es la principal causa de muerteNO violenta y su incidencia aumenta año tras año 1. En la ciudad de Pereira lamuerte por ECV ocupó el primer lugar durante los años de 1994 y 1995; pero sisumamos las causas: Insuficiencia cardiaca, enfermedad cerebrovascular aguda einfarto agudo del miocardio; duplican la mortalidad producida por armas de fuego yexplosivos en los años 1994, 1995, 1996, 1997 2.A pesar de todos los esfuerzos por disminuir su incidencia, la ECV continúa siendola primera causa de muerte en el mundo occidental 3. Es importante identificar losfactores de riesgo que más afectan a nuestra población, con el objeto de adelantaruna campaña que permita prevenir la aparición y el desarrollo de las lesionesateroscleróticas y en aquellas personas que tienen la placa puedan, al conocer yevaluar el riesgo, detener y hacer retroceder el proceso, poniendo en prácticahábitos sanos de dieta y ejercicio o utilizando adicionalmente fármacos si así lorequieren.Grandes avances se han llevado a cabo en los últimos 30 años con el fin deidentificar y valorar los factores de riesgo para la enfermedad cardiovascular.En los años 60 los médicos recomendaban dejar el cigarrillo como medidapreventiva para la ECV y el cáncer de pulmón. En los años 70 en los EstadosUnidos de América se realizó una gran campaña para disminuir la incidencia de lahipertensión arterial. En la década de los 80 se enfocó la lucha contra lahipercolesterolemia, tanto en su diagnóstico como en su tratamiento, y sepublicaron guías y conductas a seguir para controlar los niveles de colesterol sérico.El manejo y control de estos tres factores de riesgo (cigarrillo, hipertensión ehipercolesterolemia) ha contribuido a disminuir la morbimortalidad en paísesdesarrollados. En Estados Unidos se disminuyó la mortalidad por ECV en un 25%entre 1968 y 19874.A pesar de los esfuerzos para controlar la incidencia de la enfermedad, se consideraque en 1991, solo en EUA, el infarto agudo de miocardio (IAM) fue responsable deun millón de muertes. Se sabe que las campañas educativas sobre el colesterol y laECV tienen más efecto sobre las clases media y alta de la sociedad, pues hanaumentado las personas que acuden regularmente a los gimnasios y el consumo dealimentos ligeros o ricos en fibra y bajos en grasa saturada. Es bueno recordar queel efecto logrado tratando un sólo factor de riesgo es poco cuando coexisten variosde ellos, entre los que podemos mencionar: hipercolesterolemia, hipertensión, dietay sedentarismo.Los estudios epidemiológicos muestran que algunos factores de riesgo comocolesterol total elevado, colesterol LDL elevado, colesterol HDL bajo y triglicéridoselevados constituyen elementos importantes en el desarrollo del proceso 1
  • 2. ateriosclerótico5-6. También se han considerado como factores de riesgo lahipertensión arterial, la diabetes7 y el tabaquismo8.A pesar del estudio de los factores de riesgo clásicos mencionados que explican lagénesis y el desarrollo de la ECV, ellos sólo correlacionan con un 40% de lamortalidad. Debido a esto se hace necesario aplicar nuevos métodos deinvestigación al estudio de esta enfermedad y poder evaluar el peso que cada uno delos factores de riesgo tiene sobre su génesis y su evolución.El primer estudio interpoblacional se publicó en 1980, es el conocido estudio de los7 países9, analizó 12.763 hombres de 16 regiones en 7 países, se encontró unarelación positiva entre los niveles séricos de colesterol total y la incidencia de laenfermedad coronaria. De igual forma se ha demostrado que cambios en el estilo devida conllevan a aumentar el colesterol y la enfermedad 10, la migración de losjaponeses hacia los Estados Unidos demostró esta influencia ambiental. Estudiosintra poblacionales igualmente han demostrado la relación entre estas dosvariables11 12 13 14 15.Para mencionar, de manera especial está el estudio MRFIT (Estudio De IntervenciónDe Múltiples Factores De Riesgo) que observó 160.000 hombres entre 35 y 57 añosde edad en los Estados Unidos y que demostró que en personas con niveles decolesterol total menores a 200 mg/dl se presenta una menor incidencia de laenfermedad. Este riesgo se duplica cuando los niveles de colesterol superan el valorde 240mg/dl y se cuadruplica16 con valores por encima de los 300 mg/dl 17.Otro factor clásico es el alto nivel de colesterol transportado por las lipoproteínas debaja densidad (Col-LDL). El estudio prospectivo cardiovascular de Munster(PROCAM) fue el primero en demostrar, sin lugar a dudas, que el alto nivel de Col-LDL es mejor pronóstico para la enfermedad coronaria que el colesterol total 18.Otros estudios lo han validado y hoy se toma en cuenta que lo ideal es tener Col-LDL < 130 mg/dl y que hay riesgo cuando Col-LDL > 160mg/dl19.El colesterol transportado por las lipoproteínas de alta densidad (Col-HdL) espronóstico para la enfermedad cuando está por debajo de los 35 mg/dl, hay variosestudios como el de Frammingham, el estudio MRFIT, el PROCAM, el estudio deOSLO20 y el Británico regional21 que demuestran la clara asociación inversa entrelos niveles de Col-HDL y la enfermedad coronaria. Un incremento de 0.2 mM (7.14mg/dl) está asociado con una disminución del 2% de riesgo para padecer laenfermedad coronaria. Así como se considera riesgo tener un Colesterol-HDL <35mg/dl, las cifras por encima de 60mg /dl se estiman como un factor de riesgonegativo para la enfermedad22.Es bueno recordar que mientras las LDL transportan colesterol hacia los tejidosextrahepáticos donde son recogidos por receptores específicos que reconocen la apoB100, las HDL transportan colesterol sobrante hacia el hígado para ser metabolizadoa ácidos biliares o reutilizado para la síntesis de VLDL, pues el anillo de ciclopentano perhidrofenantreno no es escindido en el catabolismo del colesterol.Los triacilglicéridos séricos elevados muestran relación positiva con la ECV 23. Larelación ha sido clara siempre en los estudios univariados, es decir, cuando sólo setiene en cuenta el nivel de triglicéridos ya que en análisis multivariado los otros 2
  • 3. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAfactores de riesgo hacen desaparecer la influencia de los triacilglicéridos, pero se hapropuesto que una correlación de bajos niveles de HDL y alto nivel detriacilglicéridos potencia el riesgo a padecer la ECV24. Las técnicas de la biologíamolecular ofrecen mejores posibilidades de aproximación 25 y así se han idodiferenciando nuevos factores de riesgo basados en estudios de tipo molecular comolos relacionados con las apoproteínas de las lipoproteínas26 y sus correspondientesreceptores celulares27 28.En Colombia se han realizado pocas investigaciones sobre factores de riesgo para laECV. Podemos citar las realizadas por Suárez y López 29 en las poblaciones de SanJuan de Pasto y San Andrés. Ellos reportaron los siguientes resultados: Colesteroltotal elevado (>220mg/dl) en el 40% de las personas estudiadas; Col-LDL elevado(>130mg/dl) en el 37.5%; Col-HDL bajo (<45mg/dl en mujeres y <35mg/dl enhombres) en el 41% de las mujeres y el 15% de los hombres; TAG>150mg/dl,considerados altos, en el 24% y el 14.7% de hombres y mujeres respectivamente.En Risaralda ya son varios los estudios realizados en los que se demuestra laexistencia de Col-HDL bajo tanto en hombres como en mujeres. El presente trabajose enfoca en los factores de riesgo clásicos, aunque va más allá. Es el primerestudio en Colombia que utiliza las técnicas de la biología molecular para realizaruna Genotipificación de la apoproteína E y una búsqueda de la mutación apo B3500.AterogénesisEl colesterol es un componente básico de todas las membranas de las célulasanimales y por este motivo todas están en capacidad de sintetizarlo. El colesterol esel precursor obligado de las hormonas esteroides, de los ácidos biliares, del dolicol yes indispensable en el proceso de mitosis para la formación de membranas.El colesterol en el organismo humano proviene de dos fuentes básicas: La dieta y elsintetizado de novo a partir del Acetil-CoA, llamado colesterol endógeno, que puedesuperar al dietario en una persona que consume una dieta mixta. El colesterol dela dieta es absorbido en el intestino en un 50%, este porcentaje de absorción puededisminuir ante altos niveles presentes en la dieta.Los únicos tejidos que tienen la capacidad de sintetizar colesterol para serexportado son el hígado y el intestino. Como el colesterol es una sustanciainsoluble en agua debe acoplarse con proteínas, formar lipoproteínas, que lepermitan su paso a través del plasma. Cuando su concentración en sangre eselevada se acumula en las arterias y da origen a los ateromas, responsables de losgraves problemas de salud en el mundo occidental. En personas mayores de 15años ya aparecen rasgos incipientes de estrías grasa en la pared arterial. La OMSrealizó un estudio en 5 ciudades Europeas, con 17.827 personas menores de 15años, fallecidas por diversas causas; de todos los casos estudiados solamente unvarón y dos mujeres no presentaron lesión arteriosclerótica identificable 30.La arteriosclerosis es producto de una serie de reacciones en cascada queinvolucran varios factores tanto genéticos como medioambientales; en ellasparticipan células de la pared arterial especialmente las células endoteliales y lascélulas musculares lisas; elementos formes de la sangre (monocitos y plaquetas),proteínas del plasma incluyendo las lipoproteínas y en especial las LDL; elementos 3
  • 4. del tejido conectivo (fibrilar y no fibrilar) y los factores mecánicos del fluidohemodinámico.La aterogénesis considerada holísticamente, es la interacción de los factores queconllevan a la injuria de la arteria y la respuesta anormal que se produce en unmedio hiperlipémico. La modulación de la respuesta está determinada por unaserie de factores y componentes que se dan en la inflamación, tales como:Citoquinas, agentes quimiotácticos y mitógenos.La placa aterosclerótica exhibe una topografía focal que sirve de evidencia parapostular la participación de la hemodinámica local tanto en su iniciación como ensu evolución31.Cómo las señales hemodinámicas son reconocidas por las células de la paredarterial y subsecuentemente son transducidas para modificar su función; es unainteresante pregunta en la fisiología de la aterogénesis. En el mismo contexto esválido preguntarse cómo los factores hemodinámicos modifican el comportamientode algunos componentes sanguíneos como monocitos, plaquetas, y lipoproteínas.El estrés provocado por los cambios de flujo hemodinámico altera la geometría delas células endoteliales, elongación celular y orientación en dirección del flujo, esmuy probable que estos cambios se reflejen in vivo y provoquen un aumento en elnúmero de receptores y la acumulación de LDL en un sitio específico de la íntima 32.Esta probabilidad ha sido explorada con células de la aorta bovina en cultivossometidos a flujos hemodinámicos variables. Es pertinente anotar que estoscambios en la geometría de las células endoteliales ocurren bajo concentracionesnormales de LDL y se hace más dramático cuando utilizan suerohipercolesterolémico.Otro cambio que se deriva de la célula endotelial modificada es la variación delsistema fosfoinosítido que incrementa la actividad de la fosfolipasa C, que produceel trifosfato de inositol (IP3), agente regulador del flujo intracelular de calcio, que asu vez provoca cambios en el citoesqueleto y en la función de los receptores. Seinduce un aumento en el contacto endotelio-macrófago que provoca un incrementoen la liberación de interleucina-1, estimula la adhesión de leucocitos al endotelio yla migración de monocitos y liberación del factor de crecimiento de las célulasmusculares lisas (SMC-CF). Una vez los monocitos han ingresado a la intimaarterial sufren diferenciación y asumen las características funcionales yestructurales de los macrófagos.Bajo condiciones fisiológicas normales, un pequeño número de monocitos esreclutado en el espacio subendotelial; allí cumplen su papel de recoger detritos paraluego catabolizarlos. En la aterogénesis, el reclutamiento de monocitos es muy altoy se convierten en una buena fuente de células espumosas. El endotelio vascularque tapiza la cara interna de los vasos sanguíneos se le considera actualmentecomo un órgano complejo que cumple funciones endocrinas, paracrinas yautocrinas; actúa como barrera semipermeable para el paso de sustancias hacialos tejidos y al estar en contacto continuo con la sangre tiene actividadesantiadherentes y de respuesta a los cambios circulatorios locales o sistémicos. 4
  • 5. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAEl endotelio elabora diversas sustancias de capital importancia para la economíalocal y general, prostaciclina (PGI2), factor relajante del endotelio (NO), endotelina(ET), factor hiperpolarizante derivado del endotelio (EDHF) y tromboxano A 2 (TXA2).La síntesis de estos elementos está regulada principalmente por los estímulosfísicos y químicos captados por el endotelio, los estímulos celulares provenientes dela interacción del endotelio con leucocitos o plaquetas, bien directamente o porintermedio de las moléculas de adhesión (ELAM, ICAM, VCAM, GMP) 33, producenuna respuesta endotelial marcada por la liberación de citoquinas.El endotelio presenta las siguientes actividades entre otras: Transporte selectivo deagua y solutos, prevención de la adhesión de células sanguíneas a la paredvascular, producción y liberación de factores hemostáticos (factor VIII), regulaciónde lípidos (especialmente triacilglicéridos), producción y liberación de inhibidores yactivadores del crecimiento del músculo liso, activación e inactivación de sistemashormonales, síntesis y liberación de sustancias vasoactivas34.El cambio en laproducción de oxido nítrico altera la respuesta vasomotora normal de estaestructura, también se produce pérdida en la inhibición de la adhesividadplaquetaria y leucocitaria35.Las causas más frecuentes de disfunción endotelial, son consideradas tambiénfactores de riesgo para la enfermedad aterotrombótica: Diabetes mellitus,hipertensión arterial, tabaquismo, dislipidemia, turbulencia de flujo, estrés en lapared arterial y niveles elevados de homocisteina. Como factor adicional seencuentra la lipoproteína de baja densidad oxidada (LDLox), que ocasiona liberaciónde sustancias inflamatorias y quimiotácticas, a su vez producen adherencia demonocitos a la pared vascular. Una vez allí, se convierten en macrófagos que através de receptores no saturables se llenan de esas LDL oxidadas y luego encélulas espumosas, que al aglomerarse se transforman en las estrías grasas.La presencia de células espumosas, plaquetas y endotelio disfuncional estimula laliberación de factores de crecimiento que inducen la proliferación de célulasmusculares lisas y forman una cápsula lisa de núcleo lipídico, que con ayuda deltejido fibroso permite establecer de manera definitiva la placa ateromatosa. Luegovienen el crecimiento y la ruptura de la placa que es la causa directa de lossíndromes coronarios agudos. La lesión de la placa es favorecida por la presenciade factores de riesgo.El síndrome coronario se presenta en el 7% de individuos que no tienen factores deriesgo cardiovasculares conocidos, en el 17% de personas con más de un factor y enun 75% de personas con eventos isquémicos previos 36.Hipertensión arterial sistémica (HTS)Existe una clara relación entre hipertensión arterial y enfermedad coronaria, lahipertensión incrementa los eventos coronarios por daño vascular directo; además,su efecto no es solo cuantitativo, sino cualitativo, pues induce daño en órganosblanco y potencia otros factores de riesgo como el tabaquismo, la dislipidemia y ladiabetes.Basados en esta evaluación y en el nivel de presión arterial puede establecerse elriesgo del paciente. Luego se realiza una estratificación de los pacientes hipertensos 5
  • 6. en grupos de riesgo que permite tomar las decisiones terapéuticas correspondientesy una evaluación del riesgo absoluto 37.El grupo A incluye los pacientes con presión arterial normal–alta o estados 1,2 o 3pero sin enfermedad cardiovascular, daño en órganos blanco o presencia de otrosfactores de riesgo. Las personas del grupo A con HTA de estado 1, deben controlarsu presión y modificar el estilo de vida.El grupo B incluye las personas con HTA que no tienen enfermedad cardiovascularen curso o daño en órgano blanco, pero si tienen al menos uno de los factores deriesgo que se presentan en la tabla 1, a excepción de la diabetes mellitus. A estegrupo pertenece la gran mayoría de los pacientes hipertensos.El grupo C incluye los pacientes de riesgo con hipertensión y manifestaciones deECV, con o sin factores de riesgo adicionales. Pacientes con presión arterial normalalta (tabla 2) e insuficiencia renal, insuficiencia cardiaca o diabetes mellitus debenser considerados en este grupo.Tabla 1. COMPONENTES DE RIESGO CARDIOVASCULAR PARAESTRATIFICACIÓN DE PACIENTES CON HIPERTENSIÓNFACTORES DE RIESGO MAYORESTabaquismoDislipidemiaDiabetes mellitusEdad mayor de 60 añosGénero masculinoMujeres posmenopáusicasHistoria familiar de ECVDAÑO EN ORGANO BLANCO / ECV CLÍNICA.Enfermedades cardiacas:Hipertrofia ventricular izquierdaAngina o infarto previoRevascularización coronaria previaFalla cardiacaTabla 2. CLASIFICACIÓN DE LA PRESIÓN ARTERIALCATEGORÍA SISTÓLICA (mm Hg) DIASTÓLICA (mm Hg)Optima <120 Y < 80Normal <130 Y <85Normal-alta 130-139 O 85-89Hipertensión:Estado 1 140-159 O 90-99Estado 2 160-179 O 100-109Estado 3 >180 O >110 6
  • 7. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDASi las tensiones se ubican en diferentes categorías, a la persona siempre se leclasifica según el valor más alto. La hipertensión debe ser tratada para disminuir elriesgo de enfermedad cardiovascular y de accidente cerebrovascular.ObesidadEl índice de masa corporal (I.M.C) resulta de la división del peso en kilogramosentre la altura en metros elevada al cuadrado (kg /m2) y hoy es utilizado como basepara la clasificación de la obesidad. La tabla 3 se utiliza para la interpretación:Tabla 3. ÍNDICE DE MASA CORPORAL Y GÉNERO CATEGORÍA MUJERES HOMBRESNormal 18.3-23.8 20-25Sobre peso 24-27 25-27ObesidadGrado 1 27-30 27-30Grado 2 31-40 31-40Grado 3 >40 >40La obesidad está definida como un índice de masa corporal mayor al 120% delnormal y se acompaña de un aumento del riesgo para la enfermedad cardiovascular38.Cuando la obesidad va acompañada de otros factores metabólicos el riesgo de ECVaumenta sinergisticamente. En pacientes con resistencia periférica a la insulina, sepresentan por lo general LDL pequeñas y densas que son más aterogénicas, susHDLs son ricos en triacilglicéridos y cuentan con una capacidad catabólica para laslipoproteínas ricas en triacilglicéridos bastante disminuida, con episodios dehiperlipidemia post-prandial. Ocurre glucosilación de HDL y LDL que hace que losmacrófagos las acepten ávidamente y que se conviertan en células espumosas,elemento iniciador del proceso aterogénico.TabaquismoEl tabaquismo está relacionado al 90% de los cánceres del pulmón, tráquea, faringey lengua. Es un factor de riesgo primario en todas las enfermedadescardiovasculares y con frecuencia la isquemia de los miembros inferiores estápresente39. El uso de anticonceptivos orales en mujeres fumadoras incrementa elriesgo de infarto al miocardio, trombosis y otros desórdenes coronarios. Hammonady Garfinkel realizaron el mayor y mejor estudio que correlaciona el fumar con elinfarto y la enfermedad isquémica (358.854 hombres y 445.835 mujeresfumadoras). Ellos concluyeron que el riesgo para la enfermedad aterosclerótica estres veces mayor en fumadores y la muerte súbita está presente en fumadores conuna incidencia cuatro veces superior que en personas no fumadoras. 7
  • 8. DiabetesEl 75% de los diabéticos fallecen por enfermedad coronaria. Austin y colaboradoresdemostraron que la presencia predominante de LDL pequeñas (subclase de LDL delfenotipo B) es un factor de riesgo para el desarrollo de diabetes mellitus nodependiente de insulina y de enfermedad arteriocoronaria en personasprediabéticas40.La ECV es la causa mayor de mortalidad en los pacientes diabéticos,particularmente en los países occidentales donde la aterosclerosis es lacomplicación más común. La aterosclerosis es generalizada y aparece antes que enel resto de la población. Se ignora la causa de esa evolución acelerada; al parecer,las lesiones ateroescleróticas se inician por acción de las lipoproteínas de bajadensidad (LDL) que se oxidan. Tanto las HDL como los antioxidantes son capaces dereducir la oxidación de las LDL, ejercen así un efecto antiaterógeno.En los pacientes diabéticos ocurre una mayor oxidación de las LDL lo que puedecolaborar con el temprano desarrollo de la enfermedad cardiovascular. Aunque laslipoproteínas suelen estar dentro de los límites normales, los niveles de HDLtienden a ser bajos, mientras que los de colesterol-LDL son normales-altos o altos.Un cociente HDL/LDL bajo favorece la aterosclerosis, posiblemente porque haymenor aclaramiento del colesterol de las arterias.La aterosclerosis produce síntomas en diversos sitios, las lesiones periféricaspueden causar claudicación intermitente, gangrena y en los varones impotenciaorgánica de origen vascular. La reparación quirúrgica de las lesiones de los grandesvasos en algunos casos fracasa debido a que la enfermedad puede haberseextendido simultáneamente a los pequeños vasos.Los factores de riesgo en la población general incluyen tabaquismo, hipertensión,hiperlipidemia, hipercoagulación, obesidad, sedentarismo, género masculino,historia familiar relacionada y tratamiento con estrógenos; mientras que en laspersonas diabéticas se considera que los factores de riesgo que juegan un papelimportante son: hiperglicemia, dislipidemia, hiperinsulinemia y proteinuria. Esinteresante resaltar que, en contraste con la población no diabética, ambos sexosestán afectados por igual. Recientemente se ha atribuido el papel más importante ala glicosilación y especialmente al estado pretrombótico causado por anormalidadesen la hemostasis41 quizá sea determinante la glucosilación no enzimática de laslipoproteínas.Las lipoproteínas son complejos macromoleculares que transportan los lípidosplasmáticos hidrófobos, en especial el colesterol y los triacilglicéridos en el plasma;su superficie está ocupada también por una familia de proteínas, las apoproteínas,que sirven de interfase adicional entre el medio lipídico y el medio acuoso42. Estasproteínas desempeñan papeles cruciales en la regulación del transporte de lípidos yel metabolismo de las lipoproteínas. Entre ellas se encuentra la apoproteína E(apoE) la cual está involucrada en la homeostasis del colesterol y varios fenotiposejercen diferente influencia en el nivel sérico, síntesis y eliminación del mismo; en laremoción de los remanentes de quilomicrones e inclusive en el riesgo deenfermedad de las arterias coronarias. 8
  • 9. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDALa apoE se encuentra en las lipoproteínas ricas en triacilglicéridos, quilomicrones yVLDL y sus remanentes; también está presente en pequeñas cantidades en las HDL.La apoE es una glicoproteína rica en arginina y, al igual que apoB, sirve comoligando para el receptor de las lipoproteínas de baja densidad (LDL) y receptoresrelacionados; tiene un peso molecular de 34.200 Da y forma parte de laslipoproteínas con alto contenido de colesterol; en estas lipoproteínas actúa comoligando para varios tipos de receptores.La molécula de apoE ubicada sobre la superficie de los remantes de QM y de las IDLes el ligando que determina la depuración mediada por receptores de estaspartículas. Tres tipos de receptores pueden interactuar con apoE: el receptor deIDL; la proteína relacionada con el receptor de LDL (LRP), la cual también actúacomo receptor de alfa 2-macroglobulina; y el proteoglicano heparan sulfato (HSPG),recientemente postulado como receptor para estas lipoproteínas 43ApoE participa en la distribución de los lípidos entre los diferentes órganos delcuerpo por su asociación a VLDL y quilomicrones. Aunque, como ya se dijo, lamayor tasa de síntesis se presenta en el hígado, también es sintetizada por cerebro;en este órgano se ha encontrado que las células encargadas de su síntesis son losastrocitos y las células de la microglia. ApoE es la principal apoproteína encontradaen cerebro y liquido cefalorraquídeo, por esto se piensa que participa en lamovilización y distribución de lípidos durante el normal desarrollo del sistemanervioso y en la regeneración de nervios periféricos después de su lesión.Existen tres alelos de apoE denominados e4, e3 y e2 que difieren uno de otro poruna unidad de carga neta debida a la sustitución de un único par de bases y doscodones en los cuatro exones del gen de apoE en el brazo largo del cromosoma 19.En consecuencia, pueden ser detectados seis fenotipos de apoE en el plasma: apoE2/2, E3/2, E3/3, E4/2, E4/3, E4/4, los cuales difieren por la sustitución deaminoácidos en uno o ambos sitios (residuos 112 y 158).Las isoformas de apoE también difieren en su interacción con el receptor de LDL.Mientras que apoE3 y apoE4 se unen normalmente, apoE2 presentaaproximadamente el 2% de la capacidad normal de unión. Esta unión defectuosaestá asociada con una dislipidemia conocida como hiperlipoproteinemia tipo III,entidad que cursa con niveles elevados de colesterol y triglicéridos y con una mayorpropensión a padecer enfermedad cardiovascular 44.En estudios realizados con variaciones de dieta en niños se ha comprobado que elfenotipo de apoE tiene varias implicaciones clínicas; el grupo E2 se asocia con unabaja concentración y el grupo 4 con una alta concentración de colesterol LDL sérico.Además el grupo E4 en comparación con el grupo E2 presenta mayor eficiencia enla absorción del colesterol y menor nivel de síntesis de colesterol y remoción deapoB de LDL. A causa de las diferentes afinidades de apoE4 y apoE2 al receptor deLDL y a los receptores proteicos relacionados, el nivel de aclaración de losremanentes de las lipoproteínas se mostró bajo en sujetos con el fenotipo apoE2/2y alta en los del fenotipo 4/4. Según estos datos los sujetos del grupo E4, encomparación con los del grupo E2, responden generalmente, mas no siempre, amodificaciones del colesterol en la dieta45. 9
  • 10. Además de la asociación con los niveles de colesterol, la variabilidad de apoE hasido relacionada con un extenso grupo de factores metabólicos implicados en laresistencia a la insulina. Algunos autores sugieren que la variación en el gen deapoE puede ser un factor relacionado con la hipertrigliceridemia y la insuficienciarenal presente en pacientes con NIDDM y que la presencia de apoE2 puede agravarlas anormalidades lipídicas en NIDDM con falla renal.En un estudio para apoE2 en pacientes diabéticos tipo 1 y 2 con hiperlipidemiaspersistentes se concluyó que a pesar de encontrarse irregularidades similares, estasson inducidas por heterocigotos en la diabetes insulinodependiente y porhomocigotos en NIDDM. Otros reportes señalan que los fenotipos E4/4 y E4/3modulan el riesgo de enfermedad coronaria en hombres con NIDDM, también hayquienes han encontrado relación entre la ECV y apoE4 en sujetos no diabéticospero no en individuos con NIDDM e inclusive en algunos grupos de estudio no seha logrado establecer una relación entre el polimorfismo de apoE y lahipertrigliceridemia en pacientes con NIDDM 46.Lo anterior nos da una imagen del interés que ha suscitado apoE como factor deriesgo cardiovascular en la NIDDM, sugiere una etiología multifactorial de laexpresión de las complicaciones CVs y muestra diferencias sustanciales en distintaspoblaciones; lo cual da pie a futuras investigaciones para determinar el conjunto defactores que asocian a apoE con las alteraciones cardiovasculares en NIDDM.Algunos autores sostienen que el descenso en los índices de mortalidad porenfermedad coronaria se debe fundamentalmente a las medidas higiénico-dietéticasbien conducidas, tales como la dieta controlada, abandono del hábito del cigarrillo,la reducción del peso corporal y el control de la presión arterial.RETENCIÓN Y AGREGACIÓN DE LIPOPROTEÍNASNo se conocen con exactitud los mecanismos que dan lugar a la retención delipoproteínas, pero el tejido conectivo (colágeno, elastina, glicosaminoglicanos yproteoglicanos) sintetizado por las células musculares lisas del tejido vascular(CMLV), parece desempeñar un papel muy importante. La LDL que ha interactuadocon los glicosaminoglicanos cuando se disocia presenta numerosas modificacionesestructurales, como exposición de residuos de lisina anteriormente no expuestosque dan lugar a mayor susceptibilidad a proteólisis y a oxidación. También se hademostrado que la lipoproteinlipasa forma puentes entre LDL y ciertosglicosaminoglicanos como el heparán sulfato lo que facilita la retención de la LDL eimpide su salida del tejido vascular.La esfingomielinasa también incrementaría la asociación de LDL conglicosaminoglicanos mediada por lipoproteinlipasa. Los agregados están organizadosen gotitas lipídicas que se componen de lípido neutro, colesterol libre y fosfolípidos.Estos hallazgos dieron lugar a la teoría de que el núcleo lipídico hallado en laslesiones ateroscleróticas podría formarse sin intervención celular (hipótesis de ladeposición extracelular de lípido en la aterosclerosis). Otros resultados apoyan estateoría ya que los ácidos grasos del colesterol esterificado encontrado en el núcleolipídico de la placa fibrosa son similares a los encontrados formando parte de lasLDL plasmáticas. Queda sin embargo por descubrir qué estímulos dan origen a la 10
  • 11. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAagregación de la LDL en la pared vascular. Se sabe que la LDL oxidada pormieloperoxidasa, así como el hipoclorito generado por la actuación de esta enzima,inducen la agregación de LDL. La esfingomielinasa también puede dar lugar a laagregación de LDL in vivo47.OXIDACIÓN DE LA LDLDiferentes mecanismos podrían conducir a la oxidación de la LDL. Uno de ellossería por medio de la enzima mieloperoxidasa que se expresa en los macrófagospresentes en las lesiones ateroscleróticas. Otro sería la glicosilación, ya que laglucosa promovería la oxidación acelerada de la LDL. La mayor parte de laspartículas de LDL aisladas de lesiones humanas son mínimamente oxidadas ypresentan muchas propiedades aterogénicas, entre ellas el reclutamiento demonocitos en sitios específicos de la pared arterial y su diferenciación enmacrófagos.Recientemente se ha descrito que el componente biológicamente activo en la LDLmínimamente oxidada posee las mismas características que el factor activador deplaquetas (FAP))48. La oxidación de las LDL mínimamente oxidadas hasta una formareconocida por los receptores “basureros” (scavenger) de los macrófagos es un pasoregulador de la formación de células espumosas. El grado de oxidación de la LDLresultaría del balance entre las propiedades oxidantes y las antioxidantes de lapared arterial.El óxido nítrico producido básicamente por las células endoteliales desempeña unpapel muy importante en el mantenimiento del tono vascular y puede suprimir laoxidación de lipoproteínas. En las arterias normales existe suficiente óxido nítricocomo para impedir la oxidación lipoproteica. En condiciones de hipercolesterolemiao en las lesiones ateroscleróticas, la síntesis de óxido nítrico es normal o inclusoelevada, pero una proporción muy importante de este óxido nítrico puede serconsumido por un exceso de radicales superóxido. A su vez, la LDL oxidada puededisminuir las concentraciones de óxido nítrico, por lo que existe menos óxido nítricopara proteger la LDL que entra en la pared.Influencia de ApoE sobre los niveles de LDLLos niveles de colesterol-LDL pueden estar influenciados por una variación del genpara apo E. En humanos este gen tiene una longitud de 3,7 Kb y está localizadosobre el cromosoma 19 q13. El gen tiene cuatro exones, tres intrones y los codonespara el polipéptido apo E que incluye un péptido señal de 18 aminoácidos y unaproteína madura de 299 aminoácidos.Apo E es producida principalmente por el hígado, aunque virtualmente todos lostejidos hacen pequeñas cantidades de esta proteína. La molécula de apo E ubicadasobre la superficie de los remanentes de QM y de las IDL es el ligando que gobiernala depuración, mediada por receptores, de estas partículas. Los tres alelos comunesy sus frecuencias son: e4, 15%; e3, 77%; y e2, 8%. Estos producen seis fenotiposcomunes con las siguientes frecuencias: E4/4, 2%; E3/3, 59%; E2/2, 1%; E4/3,23% E372, 12%; y E4/2, 2% según estudios realizados en una muestra poblacionalAlemana49. En la población turca el alelo e3 se presenta con una frecuencia del86% y la frecuencia encontrada para cada uno de los fenotipos es de 1.1% paraE4/4, 12.9% para E4/3, 74.2% para E3/3, 10.6% para E3/2, 0.4% para E2/2 y 11
  • 12. 0.8% para E4/2. Si se toma el alelo más común, e3, como tipo silvestre, el alelo e4representa una mutación a nivel del aminoácido 112, cisteína que cambia porarginina. e2 resulta de la mutación en el aminoácido 158, arginina cambia porcisteína. La mutación e2 produce una proteína con solo el 2% de la actividad deunión al receptor mostrada por e4 y e3. En las poblaciones estudiadas se hanotado que los individuos con el fenotipo E4/3 tiene niveles de colesterol de 5 a 10mg/dl más altos que personas con el fenotipo E3/3; y aquellos con el fenotipo E3/2tienen niveles de colesterol entre 10 y 20 mg/dl más bajos, comparados con los quepresenta el fenotipo E3/3. La razón exacta para estas diferencias es incierta, peropueden existir dos mecanismos posibles:1) La depuración hepática de la grasa dietaria en la forma de remanentes de QM es más rápida en personas con el fenotipo E4/3 y más lenta en el fenotipo E3/2 comparadas en el fenotipo de E3/3. Esto podría afectar el contenido de lípidos hepáticos y ser la causa por la cual los individuos con el fenotipo E4/3 presentan niveles más bajos de receptores para LDL en hígado con niveles más altos de colesterol-LDL en plasma y, además, que personas con el fenotipo E3/2 presenten niveles más altos de receptores LDL en hígado, acompañados de niveles más bajos de colesterol LDL en plasma.2) Ensayos in vitro sugieren que apo E es necesaria para la conversión eficiente de IDL en LDL y que, en este sentido, e3 funciona mejor que e2. Sí este fenómeno se presenta in vivo, los individuos con el alelo e2 formarán LDL a partir de IDL con más lentitud, lo que conduciría a niveles más bajos de esta partícula en el plasma. Recientemente se ha reportado una asociación entre fenotipo E3/2 y aterosclerosis de las arterias carótidas. Esta observación se explica por un empeoramiento del catabolismo terminal de los remanentes del lipoproteínas, lo que a su vez se debe a la presencia de la isoforma apo e2 funcionalmente defectuosa50.Mutación apo B3500Otro de los factores genéticos que está asociado con niveles elevados de colesterol yLDL, es un tipo de anormalidad a nivel del gen para apo B que se presenta en eldesorden autosómico dominante llamado defecto familiar de apo B-100. La causade este desorden es una mutación en la secuencia de codones para el gen de apo B,la cual cambia el codón CGG para el aminoácido 3500, que es arginina por el codónCAG que corresponde a la glutamina. La mutación se da en la región de unión alreceptor LDL y en consecuencia el resultado es una proteína con una actividad deunión al receptor de sólo un 2 a 4% de lo normal. El nivel plasmático de LDL seincrementa cuando se interrumpe el catabolismo de esta partícula mediado por sureceptor. Los individuos afectados tienen niveles de colesterol –LDL entre 60 a 80mg/dl más altos, comparados con el de los miembros de la familia no afectados.La mutación apo B3500 ha sido identificada en poblaciones de Estados Unidos,Canadá y Europa, donde se estimó que ocurre con frecuencia de aproximadamente1/50051. También se ha reportado que está difundida en la población caucásicadonde su frecuencia ha sido estimada en el rango de 1/700 a 1/500 sin embargo,en un estudio realizado por Mahley y Col.(49) en la población turca con 1.063individuos hipercolesterolémicos y 1.387 individuos de la población general no sedetectó esta mutación 12
  • 13. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO II JUSTIFICACIÓN Y OBJETIVOSLa cardiopatía coronaria, la insuficiencia cardiovascular y la enfermedad oclusivaarterial periférica; todas ellas manifestaciones clínicas de la aterosclerosis son laprimera causa de muerte en los países industrializados. En Colombia sigue siendoel homicidio y las lesiones infligidas intencionalmente por otra persona la primeracausa de muerte en la población comprendida entre 5 y 44 años, pero en lapoblación mayor de 44 años la primera causa de muerte es la enfermedadisquémica del corazón. A pesar de todos los esfuerzos llevados a cabo paradisminuir la violencia en nuestro país, ésta va en aumento según el InstitutoNacional de Salud (INS).La principal causa de muerte no violenta es la aterosclerosis y su incidenciaaumenta año tras año. Según las estadísticas del DANE el infarto agudo delmiocardio fue la causa del 5% del total de defunciones en 1.970, del 6.8% en 1975 ydel 9.8% en 1.988. En 1992, en el grupo de 45 a 64 años de edad, la enfermedadisquémica del corazón fue responsable del 13.0% de las muertes.Este aumento en la mortalidad por la enfermedad cardiovascular tiene variasexplicaciones. La principal de ellas es el cambio de estilo de vida del hombrecolombiano, pues en los últimos 50 años Colombia pasó de ser un país rural a unpaís urbano. La transformación trajo consigo el aumento en los factores de riesgopara la enfermedad arteriocoronaria: Cambio en la dieta, la tendencia alsedentarísmo, el incremento en el estrés, aumento en el consumo de alcohol y ladisminución de la actividad física. De hecho la población urbana representaba en1951 el 39%, mientras que en 1985 representa el 67%, con una tendencia alaumento por la migración del campesino hacia los cordones de miseria de lasgrandes ciudades, ocasionada por la violencia. Por otra parte, la pirámidepoblacional, al igual que en todo el mundo civilizado (excepto la culturaMusulmana), está cambiando al reducir la base infantil y aumentar en los gruposde mediana y mayor edad. La proporción de la población colombiana mayor de 30años se incrementó del 28 al 35% entre 1964 y 1985.Es preciso señalar que Colombia tiende a comportarse desde el punto de vistaepidemiológico igual que los países desarrollados. Si hubiese una pacificación delpaís, la enfermedad aterosclerótica sería de lejos la primera causa demorbimortalidad y tendríamos que enfrentarnos al flagelo sin conocer susprincipales causas, ni el comportamiento genético poblacional y con una granignorancia de nuestros ciudadanos en torno al tema.En los países desarrollados se han emprendido campañas de educación sobre elcolesterol y prevención de la enfermedad. Esta campaña ha rendido sus frutos, seha disminuido la muerte por cardiopatia coronaria y poblaciones sensibilizadas handisminuido los niveles de colesterol, colesterol LDL y triaciglicéridos, mientras quehan aumentado los niveles de colesterol HDL. 13
  • 14. Recientes estudios prueban que incluso una reducción leve de los nivelessanguíneos de colesterol disminuye el riesgo de muerte en pacientes conenfermedad arteriocoronaria establecida. La disminución de la enfermedadarteriocoronaria en los EEUU se correlacionó con la disminución de los niveles decolesterol sanguíneo en la población durante los últimos 5 años, lo que se debe enparte a la vigorosa campaña de salud pública emprendida.Existen otros factores de riesgo como la edad, el género masculino, la diabetesmellitus, la obesidad, el sedentarismo, la historia familiar de las enfermedadescardiovasculares, altos niveles de lipoproteína [a], presencia de las isoformas de laapoproteínas E2 en quilomicrones y las lipoproteínas de muy baja densidad (VLDL),que, aunque son secundarios, no dejan de ser importantes. Estos factores de riesgose dividen en modificables y no modificables. De estos últimos, la edad es un factorde riesgo ya que la aterosclerosis aparece después de muchos años de formación delas placas ateromatosas. El sexo masculino es un factor importante de riesgo. Sedesconoce la causa, pero los hombres desarrollan aterosclerosis con una mayorfrecuencia que las mujeres. Algunos individuos presentan una predisposiciónheredada a padecer aterosclerosis.Los reportes de datos epidemiológicos en el ámbito internacional muestran unaasociación estadísticamente significativa entre varios constituyentes de la dieta y latasa de mortalidad por la enfermedad arteriocoronaria. Se toma como punto departida los datos recogidos en 22 países, publicados en un reporte de laOrganización Mundial de la Salud. Entre los nutrientes encontrados quecorrelacionan positivamente con la enfermedad cardiovascular se incluyen grasasaturada, colesterol y calorías. Otro factor dietario que induce aterosclerosis es elalto consumo de sal que genera hipertensión en personas genéticamentesusceptibles.Ya que uno de los factores de riesgo no modificables es la edad, se debe detectar elriesgo de padecer la enfermedad lo más temprano posible, con el fin de tratar decambiar aquellos factores modificables que estimulan la aparición de la enfermedad.En Colombia no hay estudios que permitan establecer el riesgo de la población depadecer la enfermedad aterosclerótica. Tampoco hay estudios genéticos queestablezcan la incidencia de factores como la mutación de la apoproteína B-100 o lapresencia de las isoformas tipo2 de la Apo E. Conocer la predisposición genética apadecer la enfermedad es importante para el médico, ya que un hombre cuyospadres desarrollaron la enfermedad aterosclerótica antes de los 60 años enfrenta unriesgo 5 veces mayor que aquel cuyos padres no desarrollaron la enfermedad. Lahistoria familiar de una persona, al tiempo que sirve para determinar su riesgo, esmuy importante en la motivación de los pacientes para que acepten los cambios ensu estilo de vida y prevengan la aparición de la enfermedad.Entre los factores de riesgo modificables, la hipercolesterolemia sigue siendo el másimportante, particularmente el colesterol encontrado en la subfracción de las LDL.Varias investigaciones realizadas en los Estados Unidos han demostrado un mayorriesgo a padecer enfermedades arteriocoronarias con el aumento de los niveles decolesterol. En los países industrializados un alto porcentaje de la población tiene 14
  • 15. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAniveles elevados de colesterol, especialmente en la subfracción de lipoproteínas debaja densidad, significa que muchas personas se encuentran en un alto riesgo depadecer la enfermedad arteriocoronaria.Para el Departamento de Risaralda y en particular para la ciudad de Pereira no hay,hasta el momento, datos concluyentes que nos permitan determinar el grado deriesgo de su población. Cediel V. y Rodríguez J. valoraron una muestra de 585voluntarios aparentemente sanos de la ciudad de Pereira que no conocían su perfillipídico. Encontraron que el 41.1% de este grupo presentó niveles de colesterolsuperior a 200 mg/dl y el 15% presentó niveles superiores a 240 mg/dl lo cualconstituye una cifra altamente preocupante. Los resultados obtenidos se asemejana los encontrados en las poblaciones de países desarrollados. En este estudio esimportante resaltar los altos niveles de colesterol transportados por la subfracciónLDL en las personas con colesterol superior a 240 mg/dl. el valor promedioencontrado fue de 172.4 mg/dl, que está muy por encima del valor recomendadointernacionalmente que es de 130 mg/dl.En los últimos años se han logrado adelantos importantes en el estudio ytratamientos de la aterosclerosis en los que se destaca la importancia de prevenir omodificar los factores de riesgo. Se ha entendido que la reducción del riesgomediante modificaciones en los hábitos higiénico-dietético es un hecho cierto.Estudios realizados mediante arteriografías han demostrado la regresión de laslesiones ateromatosas en los vasos coronarios mediante la complementación de unadieta y ejercicio adecuados. La prevención primaria es la campaña ideal, y losobjetivos de dicha campaña deben conducir a la reducción del sobrepeso, a lareducción del consumo de cigarrillos; a la modificación de hábitos dietarios asícomo también, a la disminución del consumo de sal en las comidas. 15
  • 16. Objetivos generales1- Determinar la prevalencia de los factores de riesgo para eldesarrollo de la enfermedad aterosclerótica en la población delDepartamento del Risaralda.2- Comparar la frecuencia y la severidad de los factores de riesgo parala enfermedad aterosclerótica por género y su variación con la edad. Objetivos específicos1- Hacer una evaluación de los lípidos sanguíneos en la población de Risaralda, incluyendo colesterol total, colesterol LDL, colesterol HDL y triglicéridos.2- Determinar la presencia y frecuencia de la mutación Arg 3500 Gln de Apo B en la población de Risaralda3- Determinar la frecuencia de la presencia de los alelos e2, e3, e4, de Apo E y los genotipo E 4/4, E 3/3. E 2/2. E 3/2, y E 4/2 en la población de Risaralda4- Determinar la prevalencia de la hipertensión arterial en la población de Risaralda. 16
  • 17. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO III MATERIALES Y MÉTODOSTipo de estudioEste es un estudio de tipo descriptivo que pretende cuantificar la prevalencia yseveridad de algunos factores de riesgo cardiovascular en la población deldepartamento de Risaralda.Población universoSe consideró la población del departamento de Risaralda.Población muestralEl estudio incluye personas mayores de 14 años de edad. Se realizó un muestreoestratificado multietápico basado en el aporte porcentual según la pirámidepoblacional establecida por el censo de 1993. Según el DANE la poblaciónproyectada a 1997 es de 905.780 habitantes, distribuidos de la siguiente manera:Población Urbana 678.797 74.9%Población Rural 226.983 25.1%Hombres 445.552 49.2%Mujeres 460.228 50.8%Población Menor de 15 años 288.674 31.8%Población Mayor de 15 años 617.106 68.2%Las unidades primarias fueron definidas por las condiciones de distribución de lapoblación en el área metropolitana y en los demás municipios.Características de la selección de la muestra- Aleatoria, estratificada, bietápica.- Nivel de confianza del 95%- Error máximo permisible del 10%- Proporción del evento a estudiar del 12.3%.Se tomó el 12.3%, porque a pesar de que en diferentes estudios realizados en elmundo este porcentaje es variable, los estudios hechos para Colombia no estánconsolidados y se considera la prevalencia más conservadora posible.La muestra se tomó en forma estratificada teniendo en cuenta la edad, el sexo y suestrato socioeconómico, definido previamente por la clasificación del barrio realizadapor las empresas públicas del municipio correspondiente. En el área rural no setomó en cuenta el estrato social, así como en los municipios donde tal clasificaciónno se ha realizado.Tamaño de la muestraSe escogió una muestra de tamaño n=782 y se extendió a 1050 encuestas paraprever deserciones en la toma de la muestra sanguínea. 17
  • 18. VariablesLas variables del estudio fueron: Edad: Medida en años cumplidos (variable cuantitativa continua) Sexo: Masculino, femenino (variable categórica) Lugar de residencia: Predominantemente rural o urbano (variable categórica) Estatus de migrante: Últimos dos años en el mismo lugar de residencia (variable categórica). Ocupación: Clasificada por el propio entrevistado (variable categórica) Logros educativos: Ninguno, primaria, secundaria, universitaria, otros- tecnológico. ( variable categórica ordenada). Antecedentes personales de salud: Presencia o ausencia de enfermedades como diabetes, hipertensión arterial, infarto al corazón, accidente cerebrovascular. ( variables categóricas) Hábito de fumar: Si fuma, es exfumador o no fuma (variable categórica ordenada). La duración del hábito (variable cuantitativa continua). Intensidad en cigarrillos por día (variable cuantitativa discreta). Consumo de alcohol: Frecuencia con la que consume alcohol: no consumidor regular, consumidor semanal o consumidor diario (variable categórica ordenada) y la cantidad consumida en mililitros (variable cuantitativa continua). Auto - percepción del estado de salud: excelente, buena, regular, mala y muy mala (variable categórica ordenada) Actividad física: Realiza regularmente actividad física durante la semana por fuera de su actividad laboral (variable categórica) Antecedentes familiares de salud: Si algún familiar padece de diabetes, hipertensión arterial, infarto al corazón, accidente cerebrovascular, identificando el grado de parentesco (Variable categórica), o ha fallecido de alguna de estas enfermedades (variable categórica). Edad a la cual ha fallecido el familiar (variable cuantitativa continua) Peso: En kilogramos, ajustado a un decimal (variable cuantitativa continua). Talla: En metros, ajustado a dos cifras decimales (variable cuantitativa continua). Índice de masa corporal: En Kg de peso por metro cuadrado de talla (variable cuantitativa continua). Tensión arterial sistólica: En mm de Hg (variable cuantitativa continua). Tensión arterial diastólica: En mm de Hg (variable cuantitativa continua). Relación cintura/cadera: Perímetro de la cintura sobre el de la cadera en cm. Se ajustó a dos cifras decimales (variable cuantitativa continua). Colesterol total: Concentración plasmática de colesterol medida en mg/dl después de un ayuno de doce horas (variable cuantitativa continua). Colesterol – LDL: Concentración plasmática de colesterol en mg/dl, calculado por la fórmula de Friedwald (variable cuantitativa continua). Colesterol – HDL: Concentración plasmática de colesterol- HDL medido en mg/ dl después de un ayuno de doce horas (variable cuantitativa continua). Triacilglicéridos: Concentración plasmática de triacilglicéridos, medido en mg/dl después de un ayuno de doce horas (variable cuantitativa continua). Glicemia en ayunas: Concentración plasmática de glucosa, medida en mg/dl después de un ayuno de doce horas (variable cuantitativa continua) 18
  • 19. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA Genotipo de apo E: isoforma correspondiente : E4/4, E3/3, E2/2, E3/2, E4/2, E4/3 (variable categórica). Mutación apo3500: Presencia o ausencia de la mutación (variable categórica)Plan de análisis estadísticoLos resultados de la presente investigación fueron analizados utilizando el programaEpi Info versión 6.04. La prevalencia de las variables categóricas seleccionadas y elnivel promedio de las variables continuas fueron calculadas utilizando el mismoprograma. La significación estadística de las diferencias entre los promedios de losniveles de lípidos distribuidos entre los subgrupos establecidos, fue determinadautilizando el ANOVA para variables con distribución normal y el KRUSKAL- WALLISpara las variables que no presentaron distribución normal.El análisis bivariado se realizó utilizando los cruces de variables en tablas de dospor dos, empleando la prueba de chi2 con un nivel de significancia del 95% comomedia de asociación entre las alteraciones del perfil lipídico y los diferentes factoresde riesgo estudiados. Para variables continuas se utilizaron métodos de correlacióny regresión que evalúan la colinearidad de las variables y establece la magnitud delas asociaciones, particularmente con la variable edad.Muestra de sangreDe cada uno de los participantes en el estudio se obtuvo una muestra de 7 mL desangre venosa, bajo consentimiento previamente firmado, en tubos vacutainerpreparados con EDTA para dar una concentración final del anticoagulante del 0.1%.La muestra se obtuvo siempre al nivel de la fosa cubital bajo condiciones de reposoy después de un ayuno de 12 horas. La sangre fue centrifugada a 3.000 x gdurante 10 minutos para separar el plasma y el paquete de células blancasdestinadas al aislamiento del ADN.El plasma se utilizó para la determinación de los parámetros sanguíneos propuestosen la presente investigación. Se utilizaron métodos enzimáticos e inmunológicos yse realizaron periódicamente curvas de calibración para valorar la estabilidad de losreactivos y cada una de las pruebas se hizo por duplicado, los resultadospresentados son el promedio de dichos duplicados.Parámetros sanguíneos Determinación del colesterol totalSe utilizó el método enzimático que utiliza la enzima colesterol esterasa parahidrolizar los ésteres de colesterol y luego el colesterol libre es oxidado acolestenona por la enzima colesterol oxidasa con liberación de peróxido dehidrógeno. Este último sirve de sustrato para que la enzima peroxidasa forme uncomplejo coloreado con la 4-aminofenazona y el fenol que absorbe a una longitud deonda de 500 nanómetros. Lo anterior se ilustra mediante las siguientes ecuaciones.Esteres de colesterol + agua  Colesterol + ácido grasoColesterol + O2  Colestenona + H2O22H2O2 + 4-aminofenazona + fenol  4-(p-benzoquinonamonoiminofenazona) + 4H2O 19
  • 20.  Determinación de colesterol – HDLLos quilomicrones, las lipoproteínas de muy baja densidad y las lipoproteínas debaja densidad que se encuentran en el plasma precipitan en presencia de cloruro demagnesio y ácido fosfotúngstico. Después de centrifugar a 10.000 x g por 20minutos, se determina la concentración de colesterol en el sobrenadante por elmétodo enzimático. Determinación de triacilglicéridosLos triacilglicéridos son hidrolizados por la enzima triacilglicérido lipasa y liberanglicerol que a su vez es convertido en glicerol – 3- fosfato por la glicerolcinasa, laoxidación de este compuesto por la enzima glicerol fosfato oxidasa forma peróxidode hidrógeno que forma un complejo coloreado con la 4 – aminofenazona y elclorofenol en presencia de peroxidasa. Dicho complejo absorbe a una longitud deonda de 500 nm. La secuencia de reacciones es la siguiente:Triacilglicérido + 3 H2O  glicerol +3 RCOOHGlicerol + ATP  glicerol –3- fosfato + ADPGlicerol –3- fosfato + O2 dihidroxiacetonafosfato + H2O2H2O2 + 4-aminofenazona + 4-clorofenol  4-(p-benzoquinonamonoimino) fenazona +H2O + HCl Determinación del colesterol – LDL Para el calculo de la concentración de colesterol se utilizó el algoritmo de Friedwald: C-LDL = CT – C-HDL – TAG/5 Determinación de glucosaLa determinación de glucosa se realizó por el método de la glucosa oxidasa. Laglucosa es oxidada a ácido glucónico por la glucosa oxidasa. En dicha reacción seproduce peróxido de hidrógeno el cual forma un complejo con la 4- aminofenazona yfenol para formar un complejo coloreado en presencia de la enzima peroxidasa. Estecomplejo absorbe a una longitud de 510 nmPruebas de genética molecular Extracción de ADNEl ADN fue preparado a partir de un volumen de células de 0.5 mL separado en untubo eppendorf inmediatamente después de retirar el plasma. Se añadió un mL desolución salina – citrato 1x(0,15M NaCl, 15mM citrato trisódico) y después demezclar se centrifugó durante un minuto a 14.000 x g.Se removió el sobrenadante y se repitió una vez más esta etapa de lavado. Lascélulas se resuspendieron con 0,375 mL de acetato de sodio 0,2 M a pH 7,0 y setrataron con 10 microlitros de una solución de proteinasa K al 1% en Tris 10mM,pH 8,0 y 25 microlitros de dodecil sulfato sódico al 10%. Se incubó durante lanoche a 56 °C. Luego se hizo extracción dos veces con 0,120 mL de fenol/cloroformo(25:1) y una vez con 120 microlitros de cloroformo/alcohol isoamílico (24:1). ElADN fue precipitado de la fase acuosa con etanol y luego se resuspendió con 0,1mLde amortiguador TE 1x. De esta preparación se tomaron 5 microlitros para 20
  • 21. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAestablecer su calidad y concentración aproximada por electroforésis en agarosa al1%. Finalmente se almacenó a –20°C hasta el momento de ser utilizado. Detección de la mutación apoB3500Para la determinación de la mutación apoB 3500 (CGG CAG) un segmento del genpara la apo B fue amplificado por la reacción en cadena de la polimerasa (PCR) y elADN fue digerido por la enzima de restricción Msp 1 según el método descrito porHansen y col.(61). Para la amplificación fueron utilizados los siguientesoligonucleótidos como iniciadores:1. 5´- CCAACACTTACTTGAATTCCAAGAGCACCC – 3´ 10,628 – 10,6572. 5´- CTGTGCTCCCAGAGGGAATATATGGCGTTGG-3´ 10,776 – 10,747 El oligonucleótido 1 termina en la base que precede a la mutación (posición 10,657). Se utiliza porque genera un sitio de clivaje para la endocucleasa Msp I cuando la primera base incorporada por extensión es una guanina (G) (tipo salvaje). Por el contrario la incorporación de una adenina (A) (mutante) no crea el sitio de reconocimiento para Msp I.La PCR se efectuó utilizando el siguiente ciclo de temperaturas: desnaturalización a94°C durante un minuto, ligamiento de los iniciadores a 58°C durante un minuto,extensión de los iniciadores a 74°C durante cuatro minutos. El número de ciclos fuede 40. Se utilizó ADN polimerasa de Thermus aquaticus a una concentración de 20U/mL. La reacción se llevó a cabo en un volumen total de 100 microlitros, quecontenia 20 nmoles de dCTP, dGTP, dATP y TTP, 0,01mL de amortiguador deamplificación (amortiguador de amplificación 10X: KCl 500 mM, Tris-HCl 100mM,MgCl2 15mM, gelatina 0.1% w/v, pH 8,3), 2x10-7 gramos (22pmol) de cada iniciadory entre 0,2 y 0,4 microgramos de ADN genómico.El rendimiento de la amplificación fue determinado por electroforesis en gel deagarosa al 3% de 10 microlitros de la mezcla de reacción final. El gel de agarosa fuepreparado con bromuro de etidio a una concentración de 1mg/L. El ADN sevisualizó en un transiluminador UV.La digestión se realizó con 10 Unidades de Msp I a un volumen de 0,03mL delamplificado en amortiguador 1X de baja concentración salina (amortiguador 10X debaja concentración salina: Tris-HCl 10 mM, MgCl2 10mM, ditiotreitol 1mM, pH 7,5).Luego se incubó durante una noche a 37°C. Los productos de amplificación y clivajefueron analizados por electroforesis en gel de poliacrilamida al 12% a 200 Vdurante 2 horas. Seguidamente los geles se tiñeron con bromuro de etidio ensolución (1mg/L) durante 5 minutos. Los fragmentos de ADN fueron visualizados enun transiluminador UV. Se utilizó como marcador de peso molecular pUC18digerido con Msp I. Detección del genotipo para apolipoproteína ELa tipificación de la apolipoproeína E se realizó con todas las muestras de ADNcongeladas para tal fin. El genotipo para apo E se estableció mediante amplificación 21
  • 22. de un fragmento del gen de apo E por PCR y clivaje del ADN obtenido con la enzimade restricción Hha I tal como lo describen Hixson y Vernier52.Los oligonucleótidos que se utilizaron como iniciadores fueron:F4: 5´-ACAGAATTCGCC CCGGCCTGGTACAC-3´F6: 5´-TAAGCTTGGCACGGCTGTCCAAGGA-3´Además del amortiguador de amplificación descrito anteriormente cada reacción deamplificación contenía 1 ug de ADN de leucocitos, 1 pmol/uL de cada iniciador,dimetil sulfóxido al 10% 0,05 unidades /uL de Taq polimerasa en un volumen finalde 60 uL. Cada mezcla de reacción se calentó a 95°C durante 5 minutos paradesnaturalización del ADN y fue sometida luego a 35 ciclos de amplificación contemperaturas de ligamiento del iniciador de 60°C durante un minuto, extensión a70°C durante dos minutos y desnaturalización de 95°C durante un minuto.Después de la amplificación por PCR se añadió directamente a cada mezcla dereacción 5 unidades de Hha I para la digestión de las secuencias de apo E y seincubó a 37°C por tres horas. Cada mezcla de reacción fue sometida a electroforesisno desnaturalizante en un gel de poliacrilamida al 8% de 1.5 mm de espesor por 20cm de largo. Se trabajó con una diferencia de potencial constante de 210 V durantecuatro horas. Se utilizó como marcador de peso molecular pUC 18 digerido conMspI después de la electroforesis el gel fue tratado con bromuro de etidio (1mg/L)durante cinco minutos y los fragmentos de ADN fueron visualizados con untransiluminador UV.Presión arterialLa presión arterial fue medida de acuerdo con el protocolo aprobado por elMinisterio de Salud y el Programa de Control de la Hipertensión Arterial (manual denormas técnico-administrativas del Ministerio de Salud).Para la medición de la presión se utilizaron tensiómetros de mercurio. Se hicierontres mediciones de presión arterial después de 15 minutos de reposo y se registró elpromedio de las dos últimas para evitar sesgos. 22
  • 23. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACAPITULO IV RESULTADOSCaracterísticas generales de la población estudiada.El Departamento de Risaralda formó parte del Departamento de Caldas desde 1905hasta 1967, cuando surgió como entidad territorial independiente. La comunidadde Risaralda está aún en proceso de formación e integración.Es importante anotar que los Antioqueños jugaron un papel primordial en elpoblamiento de la región y que hoy en día está recibiendo un aporte importante dela raza negra, sobre todo en el corregimiento de Santa Cecilia en Pueblo Rico y en elMunicipio de la Virginia.Una de las preguntas realizadas en la encuesta sobre el lugar de nacimiento nospermite tener una idea de la migración hacia el Departamento de Risaralda en losúltimos años. En la tabla 1, se presenta el aporte de las regiones a la muestrapoblacional. Nótese que los Departamentos de Antioquia, Caldas, Risaralda,Quindio y Valle son los principales aportantes a la muestra, por tal motivoconsideramos que esta población es paisa con los rasgos culturales que lacaracterizan. El Chocó hace un aporte del 7.0% pero es muy localizado en elMunicipio de Pueblo Rico.Tabla 1. NACIMIENTO POR DEPARTAMENTO EN LA MUESTRA ESTUDIADADEPARTAMENTO NÚMERO PORCENTAJEANTIOQUIA 57 5.4CALDAS 86 8.2CHOCO 74 7.0QUINDIO 40 3.8RISARALDA 655 62.7TOLIMA 15 1.2VALLE 80 7.7OTROS 43 4.0TOTAL 1050 100.0Se encuestaron 1050 personas de las cuales 547 (52.1%) eran mujeres, y 503(47.9%) eran hombres. Aspirábamos a que dicho porcentaje correspondieraestrictamente con los porcentajes en la población censada por el DANE, perocuando se visitaban los hogares seleccionados para el estudio se encontraban sobretodo mujeres, que en muchos casos representaban la cabeza de familia. Es buenorecordar que esta cifra está muy por encima del dato muestral, 782, propuesto en elproyecto inicial. 23
  • 24. En la tabla 2 se presenta la distribución por municipio de la muestra seleccionada.Tabla 2. RESIDENCIA POR MUNICIPIO DE LA MUESTRA ESTUDIADA MUNICIPIO Frecuencia %APIA 48 4.6BALBOA 7 0.7BELEN DE UMBRIA 45 4.3DOSQUEBRADAS 101 9.6GUATICA 26 2.5LA CELIA 17 1.6LA VIRGINIA 23 2.2MARSELLA 31 3.0MISTRATO 25 2.4PEREIRA 304 29.0PUEBLORICO (Sta. Cecilia) 146 14.6QUINCHIA 55 5.2SANTA ROSA 43 4.1SANTUARIO 26 2.5TOTAL 1050 100Es importante anotar que el número total de encuestados no corresponde alnúmero de muestras sanguíneas obtenidas, que son 798, es decir un 76%, y que esen ellas donde se hicieron los análisis bioquímicos correspondientes con susrespectivas correlacionesEdad y sexoLa distribución por grupos de edades y sexo aparecen en la tabla 3, como se puedeobservar el 74% de la población es menor de 45 años.TABLA 3. DISTRIBUCIÓN DE LA POBLACIÓN POR RANGOS DEEDAD Y SEXO Edad - F/cia % F/cia % % (Años) Mujeres Acumulado Hombres Acumulado Total Acumulado 15 – 24 168 30.7 137 27.2 305 29.0 25 – 34 122 53.0 154 57.9 276 55.3 35 – 44 111 73.3 85 74.8 196 74.0 45 – 54 75 87.4 54 85.5 129 86.3 >55 71 100.0 73 100.0 144 100.0 TOTAL 547 503 1050La tabla 4 muestra la distribución general de la talla por sexo. El promedio para lasmujeres es de 1.534 ± 0.074 metros; para los hombres el promedio es de1.653 ± 0.075 metros, la diferencia es altamente significativa (P<10ˉ8) obsérvese 24
  • 25. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAque el 78.4% de las mujeres presentan una talla menor a 1.6 metros mientras quesolo el 17.4% de los hombres presentan una talla inferior a 1.6 metros.TABLA 4. DISTRIBUCIÓN AGRUPADA DE LAS FRECUENCIAS DE TALLA PORSEXO TALLA (m) MUJERES % HOMBRES % ACUM % ACUM FREC. ACUM FREC. TOTAL < 1.49 147 28.2 13 2.6 160 15.5 1.5 – 1.59 269 78.4 73 17.4 342 48.8 1.6 – 1.69 106 98.7 268 71.8 374 85.1 1,7 – 1.79 14 100.0 126 97.4 140 98.7 > 1.8 0 ------- 13 100.0 13 100.0 TOTAL 536 493 1029PESOLa distribución general del peso por género aparece en la tabla 5 y los promediosfueron de 57.796 ± 12.13 Kg para las mujeres Y para los hombres 65.39 ± 12.1 conuna diferencia altamente significativa (P<10-4). Obsérvese que en el génerofemenino, el peso va en ascenso hasta los 55 años, mientras que para los hombresel aumento va hasta los 45 años y luego disminuye en los dos últimos grupo etarios.TABLA 5. DISTRIBUCIÓN DE LOS PROMEDIOS DE PESO PORRANGOS DE EDAD Y SEXO MUJERES HOMBRES AÑOS Kg. DESV. EST Kg. DESV. EST 15 – 24 54.0 ± 10.25 60.074 ± 10.67 10.67 25 – 34 57.35 ± 11.57 66.637 ± 12.048 12.048 35 – 44 60.16 ± 12.78 70.521 ± 12.975 12.975 45 – 55 62.13 ± 12.23 67.83 ± 9.81 9.81 55 y más 59.17 ± 11.28 64.67 ± 11.85 PROMEDIO 56.79 ± 11.820 65.3911.8512.13 ±La diferencia de peso por género va en aumento en los primeros 3 grupos etarios, lamáxima diferencia está a los 35 – 44 años (10.361 Kgs). En todos los casos ladiferencia de peso por género es altamente significativa (p<10-4). Este aumento depeso en ambos géneros refleja de alguna manera el comportamiento sedentario de lapoblación estudiada.Índice de masa corporalSe entiende como Índice de Masa Corporal (I.M.C.) la relación existente entre elpeso y la talla al cuadrado, cuando se mide en Kilogramos y metro cuadrado se 25
  • 26. consideran que hay obesidad si el I.M.C es superior a 27; para las mujeres el I.M.Cnormal oscila entre 18.3 y 23.8; mientras que para los hombres se consideranormal entre 20 – 25 Kg /m². La obesidad es considerada un factor riesgo para laenfermedad aterosclerótica máxime si va acompañada por otros factores de riesgocomo la intolerancia a la glucosa, el hiperinsulinismo, bajos niveles de HDL y altosniveles de LDL o VLDL.En la tabla 6 se presenta la distribución de la frecuencia porcentual del ÍNDICE DEMASA CORPORAL por sexo, a manera de comparación podemos ver que el IMC parael género femenino es de 24.4 con una desviación estándar de 4.56, para el géneromasculino el promedio es 23.9 con una desviación estándar de 4.13, la diferenciano es significativa (t= 0.55 y p<0,1). De otra parte, es bueno anotar que elincremento en el I.M.C que se da en el mismo género con la edad se debeexclusivamente al aumento en el peso y esto se presenta en poblacionessedentarias.TABLA 6. FRECUENCIA PORCENTUAL DEL ÍNDICE DE MASA CORPORAL PORGÉNERO ( F. Femenino, M: masculino, n: número de datos)IMC Kg/ m2 Género F % Género M % ( n=536) (n=493)15 – 25 62.7 66.126 –30 26.1 27.231 – 33 7.1 3.734- 40 4.1 3.0En la tabla anterior se puede ver que en el género femenino el IMC mayor de 25representa un 37.3%, mientras que en los hombres representa un 32.9%; en elgénero femenino el porcentaje de la población que tiene un IMC mayor a 30 duplicaal género masculino.Presión arterialLa tabla 7 muestra la distribución de las presiones arteriales diastólica y sistólicapara toda la muestra discriminada por género. Se puede observar que el géneromasculino presenta una mayor frecuencia de tensión arterial alta, tanto ladiastólica como la sistólica. La hipertensión diastólica en mujeres es del 18.8 %,mientras que en los hombres es de 22.5%; la hipertensión sistólica en mujeres esdel 19.3% y en hombres es del 23.3%. Independiente del género con la nuevaclasificación de hipertensión el problema regional es preocupante. En poblacionessanas el incremento en las tensión arterial no debería ser tan alto, pero enpoblaciones que ganan peso con la edad debido al sedentarismo, su tensión arterialse incrementa con facilidad. 26
  • 27. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDATABLA 7. DISTRIBUCIÓN POR GÉNERO DE LA FRECUENCIA DETENSION ARTERIAL PRESIÓN MUJERES HOMBRESDIASTÓLICA FRECUENCIA % FRECUENCIA % (mm. Hg) < 80 378 69.1 286 57.2 80 – 85 66 12.1 101 20.3 86 – 89 41 7.5 25 5.0 90 – 99 38 6.9 59 11.7 100 – 109 18 3.2 25 5.0 > 110 6 1.2 4 0.8SISTÓLICA < 120 365 66.9 282 51.6 120 – 129 68 12.6 133 24.3 130 – 139 48 8.3 68 12.5 140 – 159 50 9.0 46 8.4 160 – 179 10 2.0 14 2.4De otra parte se comparan las tensiones arteriales por área y se observan lasdiferencias: Para el sexo femenino los promedios de la Tensión Arterial Diastólicapor sitio de residencia fueron de 70.536 ± 12.24 mm. Hg y 76.839 ± 12.24 rural yurbana respectivamente. La diferencia es altamente significativa con un t = 8.02 yP<10¯4. La presión sistólica para el género femenino fue de 108.724 ± 1628 mm.Hg para el área rural y 118.75 ± 18.91 mm. Hg para el área urbana, la diferencia esaltamente significativa, con un t = 8.02 y un P<10-4. En el género masculino sepresentan las mismas tendenciasLas tensiones arteriales sistólicas fueron de 116.16 ± 13.8 (n=168) y 122.634 ±18.38 (n=331), para el área rural y urbana respectivamente, estas tensiones sonsignificativamente diferentes con un t=41.02 y una p<10-8; de igual manera alcomparar la tensión diastólica 75.91 ± 12.1 (n=168) para el área rural y 78.61 ±11.33 (n=331) para el área urbana, estos resultados presentan una diferenciasignificativa con t = 2.477 y p<0.01. 27
  • 28. TABLA 8. DISTRIBUCIÓN POR AREA (RURAL Y URBANA)Y SEXO DE LA FRECUENCIA PORCENTUAL DE LAS PRESIONES ARTERIALES P. A. MUJERES (FREC.%) HOMBRES (FREC.%) SISTÓLICA RURAL (181) URBANO(366) RURAL (168) URBANO(331 ) <80 mm. Hg 73.5 66.9 56.5 57.1 <85 mm. Hg 89.0 77.3 80.4 73.1 85 – 89 4.4 9.0 4.1 8.2 90 – 99 5.5 7.7 9.5 13.0 100 – 109 1.1 4.1 5.4 4.8 >110 ___ 1.9 0.6 0.9DIASTÓLICA <120 79.6 60.7 56.0 49.2 <130 87.8 75.4 80.4 73.7 130 – 139 6.1 9.3 11.3 13.0 140 – 159 5.0 11.2 7.7 8.8 160 – 179 1.1 5.0 0.6 3.0 >180 — 1.1 — 1.5De la tabla 8 se puede deducir que los habitantes del área urbana, en ambosgéneros, presentan una mayor frecuencia de hipertensión así: las mujeres del áreaurbana presentan hipertensión diastólica del 13.7% mientras que las mujeres delárea rural sólo un 6.6% presentan hipertensión, la hipertensión sistólica en mujeresdel área urbana es del 17.3% mientras que en mujeres del área rural es el 6.1%.En los hombres, también los habitantes del área urbana presentan una mayorfrecuencia de hipertensión sistólica. 13.3% vs 8.3% para los hombres del árearural; para la tensión diastólica aunque la frecuencia de hombres con presión altadel área rural es 15.5%, la diferencia no es tan alta como en los otros gruposcomparados.BIOQUÍMICA SANGUINEA ColesterolLos promedios de Colesterol total para las mujeres son de 172.15 ± 38.57 (n = 410)y para los hombres de 167.71 ± 40.20 (n = 388), estos resultados sonsignificativamente diferentes con un t= 22.48 y p<10-6. Los valores promedio decolesterol LDL fueron de 110.13 ± 34.1 (n=402), para las mujeres y 104.96 ± 32.31(n = 377) para hombres, estas diferencias son significativas con un t = 7.83 y unp<10-5. Los resultados para el colesterol- HDL fueron 37.549 ± 9.58 (n = 410),para las mujeres y 34.36 ± 8.75 (n = 388) para hombres con un valor de t = 4.9 p <10-4. 28
  • 29. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDATABLA 9. DISTRIBUCIÓN DE LOS PROMEDIOS DE COLESTEROLTOTAL, COLESTEROL – LDL Y COLESTEROL HDL, DISTRIBUIDOSPOR EDAD Y SEXO (Colesterol = mg/dl) MUJERESEDAD Colesterol total colesterol – LDL colesterol – HDL (mg/dl)15 – 24 159.54 ± 30.80 100.97 ± 28.67 38.16 ± 9.0425 – 34 166.21 ± 27.57 106.29 ± 35.65 38.88 ± 9.6035 - 44 170.81 ± 36.29 107.49 ± 31.31 36.25 ± 9.2745 – 54 198.88 ± 44.97 124.69 ± 41.53 37.59 ± 9.59 > 55 188.73 ± 56.70 123.39 ± 42.26 36.04 ± 10.6 HOMBRES15 –24 145.21 ± 32.78 90.10 ± 26.84 35.63 ± 7.4425 – 34 169.03 ± 32.38 106.16 ± 28.18 34.00 ± 8.0235 – 44 176.43 ± 44.86 109.30 ± 38.88 34.53 ± 8.1045 – 54 192.06 ± 46.27 118.61 ± 32.69 33.45 ± 12.8> 55 173.23 ± 36.16 114.92 ± 29.55 33.36 ± 8.62La tabla 9 presenta los promedios de colesterol total, colesterol LDL y colesterolHDL, agrupados por edad y género. Se puede observar que ambos géneros tienenun comportamiento similar al aumentar la edad hasta la quinta década. Elcolesterol total aumenta dramáticamente cuando se pasa de los 45 años, lasmujeres aumentan 18.07 mg/dl y los hombres 15,63 mg/dl. Este aumento se debeexclusivamente al colesterol transportado por las lipoproteínas de baja densidad, yaque el colesterol HDL disminuye en ambos géneros; es de anotar que en loshombres el mayor aumento del colesterol transportado por las lipoproteínas de bajadensidad se presenta a los 25 años: pasa de 90.1 a 106.16 mg/dl de colesterol LDL.De igual manera ocurre con los niveles de colesterol LDL, la población rural tienemayor frecuencia de normalidad que la población urbana: para las mujeres 83.3%vs 70.8; y para los hombres, 84.1% vs 74.5. Mientras que para los niveles decolesterol – HDL incluso la población rural presenta una mayor frecuencia deanormalidad col HDL < 35 mg/dl en mujeres 39.5% vs 39.2 y en hombres 55.2% vs52.8%, este último dato es una sorpresa para nosotros que pensábamos que loscampesinos, como personas que realizan una gran actividad física, deberíanpresentar altos niveles de colesterol- HDL. 29
  • 30. TABLA 10. DISTRIBUCIÓN DEL PERFIL LIPIDICO POR GÉNERO Y AREACOLESTEROL TOTAL % HOMBRES % MUJERES %Total (mg/dl) Hombres Mujeres Urbano Rural Urbano Rural (388) (410) (271) (117) (296) (114)<200 80.2 79.0 76.8 88.0 75.7 87.7200 - 239 14.7 15.1 16.6 10.3 16.5 11.4>240 5.2 5.9 6.6 1.7 6.1 0.9LDL<130 77.6 74.4 74.2 83.8 70.6 83.3130 -159 16.0 17.3 17.0 13.7 20.0 11.4>160 6.4 8.3 8.9 1.7 9.5 5.3HDL<35 53.6 39.3 52.8 54.7 39.2 30.735 - 44 34.8 38.5 34.7 32.5 34.8 40.4>44 11.6 22.2 13.0 12.0 26.0 29.0TRIGLICERIDOS<200 55.7 83.4 55.4 80.3 84.1 81.6200 - 399 41.5 14.4 41.7 15.4 13.0 18.4>399 2.8 2.2 3.0 3.4 3.0 ---Al realizar un análisis de la variación de colesterol LDL y HDL con la edad y elgénero se puede observar que aumenta el riesgo aterosclerótico con la edad,particularmente preocupante en el género femenino cuando se pasa de la quintadécada, ya que las HDL han caído a 36 mg/dl y la LDL han alcanzado valores de120 mg/dl. La relación entre colesterol - LDL y edad es positiva en ambos géneroscon coeficientes de correlación de 0.38 para mujeres y de 0.24 para los hombres.La correlación de HDL con la edad es negativa con coeficientes de correlación de –0.09 para las mujeres y –0.04 para los hombres.Un análisis de los datos anteriores permiten concluir que la principal diferenciaentre hombres y mujeres se da en el colesterol transportado por las HDL, en lasegunda década donde se halla mayor diferencia t = 4.28 y p<10ˉ³ y en la terceradonde se encuentra la menor diferencia t = 0,598 y p<0.3 (esta ya no essignificativa).Si aceptamos como valores límites normales de colesterol HDL>45mg/dl paralas mujeres y >35 mg/dl para los hombres, tenemos que el 78.9% de lasmujeres y 53.6% de los hombres presentan niveles anormalmente bajos decolesterol HDL. Es preocupante que en la población femenina del Departamentode Risaralda se den valores tan bajos de HDL, pues el 77.8% tiene colesterol HDL,inferior a 45 mg/dl y un 39.3% tiene valores inferiores a 35 mg/dl, se supone queen la población femenina los valores normales están por encima de 45 mg/dl y estosólo ocurre en un escaso 22% de la población. La tabla 10 se construyó con el 30
  • 31. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDApropósito de comparar los habitantes del área rural y los habitantes del áreaurbana, se puede deducir de esta tabla que el colesterol anormal (> 200 mg/dl) sepresenta con mayor frecuencia en hombres y mujeres del área urbanaESTATUS ECONÓMICOLa muestra escogida se dividió en seis estratos de acuerdo al sector donde reside,curiosamente al estrato 6 sólo pertenecen 3 personas, por tal motivo no se tomó encuenta para el análisis. El estrato 1 es el de menor ingreso familiar y el seis el demayor ingreso. La diferencia en los ingresos familiares es muy alta, pues personasdel estrato 2 tienen ingresos familiares de 1 y 1.5 salarios mínimos, <180 dólaresmensuales; mientras que familias del estrato 5 ó 6 pueden tener ingresos familiaresque están por encima de 10 salarios mínimos, >1350 dólares mensuales.En la tabla 11 se presenta la distribución de los promedios de colesterol total y susfracciones lipoproteicas, así como otros parámetros determinados en la presenteinvestigación, por estrato se puede observar que el colesterol en todas susfracciones se encuentra en mayor concentración en el estrato 5. La tensiónarterial diastólica y sistólica se encuentran más elevadas en los estratos 4 y 5con respecto a los estratos inferiores. Igual ocurre con los valores de TAG queaumenta conforme se asciende en estatus económico. Otro dato importante deanotar es que la tensión arterial tanto diastólica como sistólica se encuentran másaltas en los estratos mayores y los estratos 1 y 2 presentan los menores valorespromedio de los parámetros analizados. El ingreso familiar no redunda en unadisminución del riesgo cardiovascular, sino que por el contrario, algunosfactores se ven incrementados.TABLA 11. DISTRIBUCIÓN DE LOS PROMEDIOS POR ESTRATODEL PERFIL LIPIDICO, I.M.C. Y TENSION ARTERIALESTRATO 1 2 3 4 5PARAMETROCOLESTEROL 178.76 176.74 171.94 177.42 182.51 D.E 45.94 38.40 39.23 29.80 40.36 C – LDL 112.29 110.08 109.98 115.34 120.21 D.E 46.69 33.90 32.20 28.16 32.39 C – HDL 39.48 36.16 36.11 35.34 39.11 D.E 10.82 8.78 9.79 7.62 8.63 TAG 140.57 140.68 139.85 139.61 147.78 D.E 82.16 95.51 110.39 53.21 141.94 I.M.C. 24.91 24.61 24.08 26.58 25.30 D.E 2.77 4.33 4.32 4.02 4.69 T.A.D 72.86 78.71 78.19 84.42 81.67 D.E 6.78 11.96 11.08 12.40 14.87 T.A.S. 110.43 121.92 120.27 125.42 123.04 D.E 9.59 18.13 17.14 20.13 20.46 31
  • 32. APOLIPOPROTEINA EEn la figura 1 se muestran los productos de amplificación por PCR de una parte delgen de apo E correspondiente a un segmento de 244 pares de bases. Como sepuede notar las bandas de amplificación se localizan en la región delimitada por losfragmentos de 353 y 242 pares de bases del marcador de tamaño molecular.Los productos de amplificación se sometieron a digestión con la enzima HhaI. Estaenzima reconoce la secuencia 5´-GCG¡C-3´ y corta en el sitio señalado. En el aleloe4 existen seis sitios de corte que generan siete fragmentos, de los cuales se puedenvisualizar los fragmentos de mayor tamaño que corresponden a las bandas de 72,48, 38 y 35 pares de bases (pb). En el alelo e3 no existe el sitio de corte en laposición 112, determinando la aparición de una banda de 91 pb junto con lasbandas de 48, 38 y35 pb. En el alelo e2 se observan las bandas de 91, 38 y 83 pb,esta última resulta de la fusión de las bandas 48 y 35 pb al desaparecer el sitio decorte de la posición 158.Figura 1 Polimorfismo de apo E. Se muestran los sitios de corte para la enzima derestricción Hha 1, los fragmentos que se generan y su separación utilizando laelectroforesis en gel de agarosa al 3%. 32
  • 33. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDALa tabla 12 muestra la distribución de frecuencias de cada uno de los genotipos deapo E para las 654 personas incluidas en el presente estudio. Como se puedeobservar el genotipo de mayor prevalencia corresponde a 3/3 con una frecuencia de72.47%, mientras que la menor prevalencia corresponde al genotipo 4/4 con unafrecuencia de 0.91%.Tabla12. DISTRIBUCIÓN DE FRECUENCIAS DE LOS GENOTIPOS Y ALELOS DEApoE EN LA MUESTRA POBLACIONAL DE RISARALDA Genotipo N Frecuen.% E 2/2 12 1.83 E3/3 474 72.47 E4/4 6 0.91 E2/3 57 8.71 E2/4 14 2.14 E3/4 91 13.91 Alelo Frecuencia % E2 7.29 E3 83.78 E4 8.93En la tabla 13 se presentan los promedios de algunas de las variablesdeterminadas en el presente estudio, correspondientes a los diferentes genotipospara la apo E.Tabla 13. PROMEDIOS DE ALGUNOS PARÁMETROS BIOQUÍMICOS Y FÍSICOSDISCRIMINADOS POR GENOTIPOGeno- Col LDL HDL TAG Glu TAS TAD IMC tipo mg/dl mg/dl mg/dl mg/dl mg/dl mmHg mmHg Kg/m2 3/3 170.80 107.63 36.53 142.04 87.33 117.51 76.05 24.29 2/3 167.10 102.31 34.47 160.07 92.87 118.42 75.33 25.42 4/4 164.00 103.60 39.10 106.50 89.87 116.12 74.37 21.43 2/4 157.10 90.57 36.21 147.07 86.51 119.28 82.50 23.81Dado el bajo número de personas que presentan los genotipos 4/4 y 2/4 (6 y 14respectivamente) no se pudieron establecer diferencias estadísticas, pero es curiosoobservar que en el grupo de personas que tienen el genotipo 2/3 hay sietepersonas, de 57, con los niveles de glucosa por encima de 100 mg/dl y dosfrancamente diabéticas con niveles por encima de 300 mg/dl en el ayuno, esto serefleja en los niveles de triglicéridos que son altos con respecto a los otros grupos.Se necesita una muestra mayor que permita encontrar más personas pertenecientesa estos genotipos escasos y poder hacer análisis estadísticos confiables. 33
  • 34. MUTACION Apo B3500En la propuesta inicial se recomendaba realizar este ensayo para todas lasmuestras que tuvieran colesterol por encima de 250 mg/dl, pero en las 798muestras recolectadas en todo el departamento sólo 32 estuvieron por encima deeste valor; por lo tanto se amplió este análisis a todas las personas que tuvieran elcolesterol por encima de 200 mg/dl, resultaron 153 muestras, de las cuales 81pertenecen al género femenino y 72 al género masculino.La amplificación por PCR con los iniciadores descritos en materiales y métodospermite la obtención de un fragmento de 149 pares de bases cuya presencia semonitoreó en todos los casos por medio de electroforésis en gel de agarosa al 3%.Cuando no existe la mutación en la posición 10.658 (cambio de C por T) dichofragmento se deja cortar por la enzima de restricción MspI a nivel de la secuencia 5’-C/CGG-3’ en el punto indicado, se obtienen dos fragmentos uno de 120 pares debases y otro de 29. La presencia de la mutación cambia el único punto dereconocimiento y en consecuencia no hay digestión por la enzima.El monitoreo de las productos de digestión se realizó mediante electroforésis depoliacrilamida al 12% utilizando siempre como control el amplificado de ADN sintratamiento enzimático. Para todos los casos estudiados se pudo detectar siempreuna banda de menor tamaño concordante con una longitud de 120 pares de bases,utilizando como marcador de peso molecular pUC18 digerido con MspI. Enconsecuencia, no se encontró la mutación en ninguna de las muestras analizadas.Es probable que el número de análisis realizados sean pocos y que para encontrarla mutación se requiera una muestra mucho mayor; pero también es buenorecordar el trabajo realizado en el medio oriente, donde a pesar de haber utilizadouna muestra poblacional amplia (superior a 1000) no encontraron la mutación, loque nos obliga a pensar que en nuestro medio es una mutación extremadamenterara o inexistente. 34
  • 35. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDACORRELACIONESSe estudiaron algunas correlaciones entre los parámetros evaluados y de esta formaencontrar asociación entre los datos del examen clínico con los diferentes valoresbioquímicos estudiados. Cuando solo están en juego dos variables, como es nuestrocaso, hablamos de correlación simple y regresión simple. Si X e Y son las dosvariables, un diagrama de dispersión muestra la localización de los puntos sobreun sistema rectangular de coordenadas. Si todos los puntos del diagrama dedispersión parecen estar en una recta, como es el caso que nosotros analizamos, lacorrelación se llama lineal. Una ecuación lineal es adecuada a efectos deregresión (o estimación). Si Y crece cuando X crece la correlación es positiva; si Ydecrece cuando X crece ( viceversa), la correlación es negativaLa figura 2 muestra la correlación entre el IMC y el colesterol. El coeficiente es de0.24 con límites de confianza 95% de 0.1<R<0.36. Para las mujeres la correlaciónes de 0.32 con límites de confianza para el 95% de 0.1<R<0.45 y para los hombresla correlación es de 0.26 con límites de confianza para el 95% de 0.17<R<0.45. Enambos géneros la correlación es positiva, al aumentar el IMC los niveles decolesterol en sangre también aumentan, ese aumento es más notable en lasmujeres. 350 300 250 Colesterol 200 Serie1 Lineal (Serie1) 150 100 50 0 0 5 10 15 20 25 30 35 40 45 50 Indice de Masa CorporalFigura 2. Correlación entre el Índice de Masa Corporal y el colesterol 35
  • 36. 50 Indice de Masa Corporal 45 40 35 30 Serie1 25 Lineal (Serie1) 20 15 10 5 0 0 50 100 150 200 250 300 Tensión Arterial SistólicaFigura 3. Correlación entre el Índice de Masa Corporal y la Tensión Arterial SistólicaCorrelaciones igualmente positivas se encontraron entre el IMC y las tensionesarteriales, especialmente la tensión sistólica con la cual dio una correlación de 0.40con unos limites de confianza para el 95% de 0.32<R<0.47 (figura 3). Para lasmujeres la correlación es muy alta, resultó un valor de 0.54 con unos límites deconfianza para el 95% de 0.46<R<0.61; mientras que para los hombres lacorrelación es de 0.38 con límites de confianza para el 95% de 0.24<R<0.48.La figura 3 nos advierte de un grave problema que se genera con el incremento delIMC, el aumento en la Tensión Arterial Sistólica y es especialmente preocupante enel género femenino, donde la correlación llega a valores de 0.54. Posteriormente semostrará como el IMC correlaciona positivamente con la edad; por lo tanto, elaumento en la edad y en el IMC potencian el problema del incremento en la TAS yTAD. Una campaña de educación que le proponga a la población mantener su pesocorporal mediante el ejercicio y una dieta sana, muy seguramente disminuirá lahipertensión arterial, grave factor de riesgo cardiovascular. 36
  • 37. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA 50 45 Indice de Masa Corporal 40 35 30 Serie1 25 Lineal (Serie1) 20 15 10 5 0 0 20 40 60 80 100 120 140 Tension Arterial DiastólicaFigura 4. Correlación entre el Índice de Masa Corporal y la Tensión ArterialdiastólicaCon respecto a la correlación del IMC con TAD dio un coeficiente de 0.38, conlímites para el 95% de 0.28<R<0.45, observe la figura 4. Igual que la correlaciónanterior es más preocupante para el género femenino. La correlación entre la TAD yla edad resulta positiva, por lo tanto es bueno recalcar que con el incremento enla edad para una población básicamente sedentaria, hacen su apariciónfactores de riesgo que no aparecían en la juventud como es la HipertensiónArterial y la obesidad.Como producto de la investigación se confirma que no es la edad per se el factor deriesgo, sino que con la aparición de estos nuevos factores el análisis de la edaddebe ser más cuidadoso, debemos averiguar cuántas personas de edad normotensasy delgadas fallecen por Enfermedad Aterosclerótica y así poder valorar la edadcomo factor de riesgo cardiovascular aislado. 37
  • 38. 1200 1000 Trigliceridos 800 Serie1 600 Lineal (Serie1) 400 200 0 0 5 10 15 20 25 30 35 40 45 50 Indice de Masa CorporalFigura 5. Correlación entre el I M C y los triacilglicéridosDe otra parte, se puede ver una correlación positiva entre el IMC y los TAG con uncoeficiente de 0.27 y unos límites de confianza para el 95% de 0.02<R<0.37, estacorrelación es más débil en el sexo femenino, donde se presenta una correlación de0.21, con unos límites de confianza para el 95% de 0. 12<R<0.37 (ver figura 5).Los triacilgligéridos se encuentran más elevados en el género masculino que en elgénero femenino, y en los hombres se hace más notable el cambio de éstos con elIMC y con la edad; las mujeres deben contar con algunas hormonas específicas quele colaboran en el metabolismo de los triacilglicéridos.Al comparar los valores del IMC con la concentración de colesterol en lalipoproteínas de alta densidad (HDL), el coeficiente dio un valor negativo de –0.16con unos límites de confianza de –0.21<R<0.31(ver figura 6). Curiosamente elcoeficiente de correlación es mucho más negativo en las mujeres que en loshombres (-0.19 y –0.08 respectivamente). De los dos factores que componen el IMC,la talla no tiene correlación alguna, es el peso el que determina dicha correlacióncon un valor de –0.17, como se puede observar en la figura 7, los límites deconfianza 95% fueron de –0.2<R2<0.31. 38
  • 39. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA 120 100 Colesterol HDL 80 Serie1 60 Lineal (Serie1) 40 20 0 0 5 10 15 20 25 30 35 40 45 50 Indice de Masa CorporalFigura 6. Correlación entre la concentración de colesterol-HDL y el IMCEl aumento en la edad produce efectos positivos en algunos de los factores de riesgoclásicos para la enfermedad cardiovascular, para determinar que tanto efecto tieneen nuestra población se realizaron algunas correlaciones y encontramos que elmayor coeficiente se presenta con la Tensión Arterial Sistólica, TAS, 0.46 con unoslímites de confianza 95% de 0.39<R<0.52; para las mujeres la correlación es mayorcon un coeficiente de 0.54 y unos límites de confianza 95% de 0.46<R<0.60,mientras que para los hombres el coeficiente es de 0.38 con unos límites deconfianza 95%. 39
  • 40. 120 100 Colesterol HDL 80 Serie1 60 Lineal (Serie1) 40 20 0 0 20 40 60 80 100 120 PESOFigura 7. Correlación entre colesterol-HDL y peso. Tensión Arterial Sistólica 300 250 200 Serie1 150 Lineal (Serie1) 100 50 0 0 20 40 60 80 100 120 EdadFigura 8. Correlación entre la Tensión Arterial Sistólica y la edad0.24<R<0.48 (figura 8). La Tensión Arterial Diastólica presenta un coeficiente unpoco menor de 0.35 con unos límites de confianza 95% de 0.24<R<0.42, en loshombres también resultó menor el coeficiente con un valor de 0.27 y unos límitesde 0.02<R2<0.16, para las mujeres el coeficiente fue de 0.40 y los límites de0.28<R<0.49.La figura 9 muestra la correlación entre la edad y el IMC. El coeficiente decorrelación es de 0.30 con límites de confianza 95% de 0.09<R<0.39; esta 40
  • 41. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAcorrelación es mayor para el sexo femenino con un coeficiente de 0.33 y unoslímites de confianza 95% de 0.14<R<0.44, los hombres presentan un coeficiente de0.27 y límites de confianza 95% de 0.32<R<0.42. Las correlaciones de la edad concolesterol total, colesterol LDL y triglicéridos fueron positivas con unos coeficientesde 0.29, 0.26 y 0.19 respectivamente, los respectivos límites de confianza 95%fueron de 0.14<R<0.39, 0.08<R<0.37 y –0.2<R<0.32.Las figuras 10, 11 y 12muestran estas correlaciones. Indice de Masa Corporal 50 45 40 35 30 Serie1 25 Lineal (Serie1) 20 15 10 5 0 0 20 40 60 80 100 120 EdadFigura 9. Correlación entre el IMC y la edadEl perfil lipídico se deteriora tanto con la edad que se convierte en factor de riesgocardiovascular; de una parte, el colesterol total, el colesterol transportado por lasLDL y los triacilglicéridos aumentan y en algunos casos por encima de ciertosvalores críticos, mientras que el colesterol transportado por las HDL disminuyen aniveles de riesgo. Hay que investigar con urgencia el efecto del ejercicio en laspersonas de edad y compararlo con los valores aquí encontrados. Algunosinvestigadores demuestran que en países centroafricanos donde la actividad físicaes necesaria para la supervivencia; la tensión arterial, el colesterol-HDL y el IM;C nose incrementan con la edad y por ende no aparecen como factores de riesgocardiovascular. 41
  • 42. 120 100 Colesterol HDL 80 Serie1 60 Lineal (Serie1) 40 20 0 0 20 40 60 80 100 120 EdadFigura 10. Correlación entre la edad y los niveles de colesterol 300 250 Colesterol LDL 200 Serie1 150 Lineal (Serie1) 100 50 0 0 20 40 60 80 100 120 EdadFigura 11. Correlación entre la edad y los niveles de colesterol-LDL 42
  • 43. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA 1200 1000 800 Triglicéridos Serie1 600 Lineal (Serie1) 400 200 0 0 20 40 60 80 100 120 EdadFigura 12. Correlación entre la edad y los niveles de triacilglicéridosDe otra parte, averiguamos como correlacionó el grado de escolaridad con algunosfactores de riesgo. Con respecto a los componentes del perfil lipídico resultaroncorrelaciones con valores negativos: el colesterol total (-0.10, -0.24<R2< 0.29), elcolesterol LDL (-0.23<R2<0.29), los triacilglicéridos (-0.02<R2<0.26); mientras que elcolesterol HDL resultó con valor positivo 0.04 y unos límites de confianza 95% de –0.07<R2<0.07. El IMC dio una correlación negativa con un valor de –0.14 y unoslímites de confianza 95% de –0.2<R2<0.29, igual correlación negativa resultó con latensión arterial sistólica con un valor de –0.07 y límites de confianza 95% de –0.24<R2< 0.26.A pesar de que el nivel de estudio y el estrato social tienen una correlación de 0.32con unos límites de confianza 95% de 0.02<R 2<0.18, no dio correlaciones negativasentre estrato social y colesterol total, colesterol -LDL y triacilglicéridos, por elcontrario dieron resultados positivos. 43
  • 44. TABLAS 2X2Para hacer un estudio del efecto que tiene el IMC, la edad con otros factores deriesgo, se definieron nuevas variables y se generaron dos grupos; uno presentavalores normales y el segundo presenta valores por encima de lo recomendado o porencima del promedio general. Las nuevas variables son:Obe=1 cuando IMC<27 y obe=2 cuando IMC>27 (grado de obesidad)Edada=1 cuando edad< 35 años y edada=2 cuando edad>35HTD=1 cuando la tensión arterial diastólica<90 y HTD=2 cuando TAD>90(hipertensión diastólica)HTS=1 cuando TAS<140 y HTS=2 cuando TAS>140 (hipertensión sistólica)Col=1 cuando colesterol<200 y col=2 cuando colesterol>200 (grado dehipercolesterolemia)LDLB=1 cuando LDL<160 y LDLB=2 cuando LDL>160HDLB=1 cuando HDL>35 y HDLB=2 cuando HDL<35 (bajos niveles de HDL comofactor de riesgo)TAGA=1 cuando triglicéridos<200 y TAGA=2 cuando triglicéridos>200Edad y tensión arterialTabla 14. COMPARACIÓN DE DOS GRUPOS DE EDAD (menores y mayores de35 años) CON LA TENSIÓN ARTERIAL DIASTÓLICA NORMAL (1) y ALTA (2). EDADA HTD 1 2 Total 1 560 339 899 2 52 98 150 Total 612 437 1049El OR para esta relación es de 3.11 con unos límites de confianza 95% de2.13<OR<4.56, el chi2 =39.24 con un p<10-8.Tabla 15. COMPARACIÓN DE DOS GRUPOS DE EDAD FRENTE A LA TENSIÓNSISTÓLICA EDADA HTS 1 2 Total 1 585 339 924 2 26 97 123 Total 611 436 1047El OR para esta relación es de 6.44 con unos límites de confianza 95% es de3.99<OR<10.45 con un chi2 = 79.45 y un p< 10-8 44
  • 45. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDALas anteriores tablas se realizaron por género y se obtuvieron los siguientesresultados: 1. Género masculino (edad vs HTD), OR=3.82, límites de confianza 95% 2.36<OR<6.26; el chi2 = 30.48 y un valor de p=3x10-8. 2. Género masculino (edad vs HTS) OR=4.34, límites de confianza 95% de 2.4<OR<8.06; chi2 =24.59 y un valor de p=7.1 x 10-7. 3. Género femenino (edad vs HTD), el OR=2.59 con límites de confianza 95% de 1.50<OR<4.55, chi2=12.08 y un valor de p=0.00051088. 4. Género femenino (edad vs HTS), el OR = 9.25, con unos límites de confianza 95% de 4.72<OR<19.44, un chi2=50.74 y un valor de p<10-8.También analizamos como afectan la edad y el género algunos parámetrosbioquímicos.Tabla 16. COMPARACIÓN DE DOS GRUPOS DE EDAD FRENTE ALCOLESTEROL NORMAL Y ALTO, PARA EL GÉNERO MASCULINO COL Edada 1 2 Total 1 202 26 228 2 109 51 160 Total 311 77 388El valor de OR fue de 3.64, con unos límites de confianza 95% de 2.15<OR<6.20, unchi2=23.50 y valor de p=0.00000125.Tabla 17. COMPARACIÓN DE DOS GRUPOS DE EDAD FRENTE ALCOLESTEROL NORMAL Y ALTO EN EL GÉNERO FEMENINO COL EDADA 1 2 Total 1 198 22 220 2 126 64 190 Total 324 86 410El OR= 4.57 y los límites de confianza 95% fueron de 2.69<OR<7.87, chi2=33.09 conun valor de p<10-8.Tabla 18. COMPARACIÓN DE LOS DOS GRUPOS DE EDAD FRENTE A LOSNIVELES NORMALES Y ALTOS DE LDL PARA EL GÉNERO MASCULINO LDLA EDADA 1 2 Total 1 195 29 224 2 102 51 153 Total 297 80 317 45
  • 46. El OR es de 3.36 con unos límites de confianza 95% de 2.01<OR<5.65, un chi 2=21.4y un valor de p=0.00000217.Con respecto a la variación de la edad con el colesterol- HDL realizamos lassiguientes comparaciones:Tabla 19. COMPARACIÓN DE LOS DOS GRUPOS DE EDAD FRENTE A LOSNIVELES NORMAL Y BAJO DE HDL EN EL GÉNERO MASCULINO HDLB EDADA 1 2 Total 1 109 119 228 2 71 89 160 Total 180 208 388Es bueno recordar que al grupo 1 de Colesterol-HDL pertenecen aquellas personascon HDL>35 mg/dl., mientras que al grupo 2 pertenece aquellas con HDL< 35mg/dl. El OR resultó de 1.15, con unos límites de confianza 95% de 0.76<OR<1.73,chi2=0.52 y un valor de p=0.57281857.Para el género femenino, la relación de edad vs Colesterol-HDL en la tabla 2x2 dioun valor de OR 0.85, con unos límites de confianza 95% de 0.51<OR<1.39,chi2=0.28 y una valor de p= 0.59626719.Tabla 20. COMPARACIÓN DE DOS GRUPOS EDAD CON TRIGLICÉRIDOSNORMALES Y ALTOS PARA EL GÉNERO FEMENINO TAGA EDADA 1 2 Total 1 201 19 220 2 141 49 190 Total 342 68 410El valor de OR es de 3.68 con unos límites de confianza de 2.09<OR6.62,chi2=20.46 y un valor de p=00000609.Para el género masculino los resultados de esta misma comparación tuvieron un ORde 2.09, con unos límites de confianza 95% de 1.27<OR<3.46, chi2=7.03 y un valorde p= 0.00515136.Por otra parte se quiso responder a la pregunta de cómo varía el índice de masacorporal con la edad y el género, para tal fin se construyó la tabla 2x2 de edada vsobe.Tabla 21. COMPARACIÓN DE DOS GRUPOS DE EDAD (menor y mayor de 35años) CON RELACIÓN A LA OBESIDAD (1. Ausencia, 2 presencia). 46
  • 47. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA OBE EADA 1 2 Total 1 501 84 585 2 268 156 416 Total 761 240 1001El OR resultó de 3.58 con unos límites de confianza 95% de 2.64<OR<4.86, unchi2=70.16 y un valor de p<10-8. Para el género femenino el OR fue de 3.52 conunos límites de confianza de 2.35<OR<5.29, un chi 2=37.87 y un valor de p<10-8.Para el género masculino OR fue de 3.58 con unos límites de confianza 95% de2.25<OR<5.74, chi2=29.61 y un valor de p= 5x10-8. El valor de chi2 para lacomparación de los géneros resultó de apenas 0.01 y este resultado sugiere que nohay diferencia por sexo para la obesidad y la edad.Tabla 22. COMPARACIÓN DE HDLB CON OBE OBE HDLB 1 2 Total 1 268 138 406 2 297 73 370 Total 565 211 776El OR resultó de 0.48 con unos límites de confianza 95% de 0.34<OR<0.67, elchi2=19.17 y un valor de p=0.00001195. Para el género femenino el OR fue de 0.46con unos límites de confianza 95% de 0.30<OR<0.71, el chi2=11.94y el valor dep=0.000524852. Para el género masculino el valor de OR fue de 0.41, con unoslímites de confianza 95% de 0.24<OR<0.70, chi 2=10.29 y un valor dep=0.00133835. El chi2 para la evaluación de interacción hdlb/obe/sexo resultó de0.1 con un valor de p=0.75396326, el test sugiere que OR no difiere por género,pues sus valores son muy aproximados y que los géneros tienen un comportamientosimilar.Otra comparación se realizó entre obe y LDLA, recordemos que obe toma el valor de1 cuando el Índice de Masa Corporal es menor de 27 y toma el valor de 2 cuando elIMC es mayor de 27; mientras que LDLA es 1 cuando su valor está por debajo de130 mg/100ml, y el valor de 2 cuando es mayor. Los resultados se muestran en latabla siguienteTabla 23. COMPARACIÓN DE OBE CON LOS NIVELES DE COLESTEROL-LDL LDLA OBE 1 2 Total 1 435 117 552 2 140 65 205 Total 575 182 757El OR es de 1.73, los límites de confianza 95% son 1.20<OR<2.47, chi 2=8.48 y unvalor de p=0.00359423. El OR de la misma relación para el género femenino resultó 47
  • 48. de 1.68 con unos límites de confianza 95% de 1.03<OR<2.7, un chi 2=4.02 y unvalor de p=0.04484668. Para el género masculino los resultados fueron similaresOR=1.75, límites de confianza 95% de 1.00<OR<3.00, chi2=3.51 y un valor dep=0.06107347. El test para la comparación OBE/LDLA/SEXO dio un chi 2=0.01 ylógicamente sugiere que no hay diferencia por género para las variables obesidad yaltos niveles de colesterol – LDL.El otro parámetro del perfil lipídico es el nivel de triglicéridos y nos preguntamos siexiste alguna relación entre obesidad y el nivel de estos en la población estudiada,la siguiente tabla muestra esta comparación:Tabla 24. COMPARACIÓN DE OBE Y LOS NIVELES DE TRIACILGLICÉRIDOS(normales =1 y altos=2) TAGA OBE 1 2 Total 1 490 75 565 2 142 69 211 Total 632 144 776El OR es de 3.17, los límites de confianza 95% de 2.17<OR<4.62, chi 2=37.09 y unvalor de p< 10-8. Para el género femenino el OR fue de 2.72, con unos límites deconfianza 95% de 1.57<OR<4.67; para el género masculino el valor de OR fue de4.01 unos límites de confianza 95% de 2.33<OR<4.67. Al hacer una comparaciónentre los géneros el chi2 fue de 1.00 y un valor de p=0.13632407, lo que sugiere queno hay diferencia en los resultados debidos al género. Finalmente comparamos laobesidad con la tensión arterial tanto diastólica como la sistólica. Se obtuvieron lossiguientes resultadosTabla 25. COMPARACIÓN DEL GRUPO DE PERSONAS CON HIPERTENSIÓNDIASTÓLICA (2) Y EL GRUPO DE OBESIDAD (2) OBE HTD 1 2 Total 1 715 46 761 2 178 62 240 Total 893 108 1001El valor de OR para esta comparación es de 5.41, con unos límites de confianza95% de 3.57<OR<8.22, chi2=72.19 y un valor de p< 10-8. Para el género femenino elOR es de 4.79 con unos límites de confianza 95% de 2.58<OR<8.97, el valor de chi 2es de 26.95. Para el género masculino el OR es de 6.82, con unos límites deconfianza 95% de 3.82<OR<12.13, el chi2=47.22 y el valor de p<10-8; a pesar de ladiferencia en los valores de OR el test no sugiere la diferencia entre los géneros paraestas variables, pues el valor de chi 2 resulto de 0.67 y un valor de p=0.41199660Tabla 26. COMPARACIÓN ENTRE HTS Y OBE 48
  • 49. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA OBE HTS 1 2 Total 1 709 176 885 2 52 64 116 Total 761 240 1001El valor de OR es de 4.96, los límites de confianza 95% son de 3.31<OR<7.42, unchi2=68.13 y una valor de p<10-8. Para el género femenino el valor de OR resultó de5.13, los límites de confianza 95% fueron de 2.93<OR<9.03, chi 2=30.27 y el valor dep <10-8. Para el género masculino OR fue de 4.90, los límites de confianza 95%fueron de 2.7<OR<8.83, chi2=30.27 y un valor de p=4x10-8. El test resultó negativopara encontrar diferencias por sexo entre HTS y OBE. 49
  • 50. CAPÍTULO V ANÁLISIS Y DISCUSIÓNEl estudio de la relación dieta - aterosclerosis y en especial el papel quedesempeñan en la génesis y desarrollo de la placa ateromatosa alimentos como lagrasa saturada y el colesterol, cumplió treinta años. En este tiempo se han realizadocientos de estudios, algunos de ellos en países aislados, la mayoría de los datosconsiderados corresponde a Estados Unidos de América.Existen estudios internacionales que cruzan variables tan disímiles como dieta/cultura /migración y enfermedad; estudios de morbimortalidad que se apoyan enel buen registro de los diferentes Institutos de Salud; estudios clínicos de dobleciego, etc. Después de esos miles de millones de dólares gastados eninvestigaciones no se ha llegado a conclusiones definitivas sobre el papel de la dietaen la aparición y desarrollo de la enfermedad. El problema no se ha solucionado ypor el contrario aumenta año tras año, especialmente en países del tercer mundocomo Colombia.Es importante resaltar, después de tantos estudios, que la prevención es el objetivoa alcanzar para disminuir la incidencia de la enfermedad en el presente siglo (S-XXI). Harán falta muchas campañas publicitarias conducentes a disminuir elconsumo de grasa saturada, colesterol y sal, se debe resaltar la necesidad deutilizar grasa insaturada y fibra en la preparación de los alimentos, al igual queaumentar la variedad de los nutrientes que se consumen, lo que posibilita unamejor nutrición.El punto central en la estrategia clínica es identificar y tratar a las personas con unalto riesgo de sufrir a corto plazo un evento coronario. En contraste, la estrategiapoblacional es influir en los hábitos del pueblo con el fin de disminuir los nivelesmedios de lípidos séricos, en especial de aquellos que se relacionan con el procesoaterogénico.La estrategia clínica se inicia en el consultorio, con el diálogo médico–paciente yobtiene resultados que son de fácil comprobación; mientras que la estrategiapoblacional involucra varios elementos: a. Medios masivos de comunicación- radio, prensa y televisión- que alerten sobre el consumo de ciertos alimentos y promuevan el uso de otros. b. Intervenir en el comportamiento de la población a largo plazo con el fin de mantener los buenos hábitos de vida. c. Intervenir en los programas educativos para introducir contenidos de nutrición y deporte que permitan formar ciudadanos sanos destinados a la construcción de una mejor sociedad. 50
  • 51. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA d. Intervenir en las políticas agrícolas del Estado para que subsidie la producción de buenos alimentos y se restrinja la producción y comercialización de la comida insana (chatarra), cargada de grasa saturada y azúcares simples.EL COLESTEROL TOTAL EN SANGRE COMO INDICADOR DE RIESGOUna de las recomendaciones en todas las guías clínicas, escritas para médicos, es:“debe determinarse el colesterol total en plasma en todos los adultos (personasmayores de 18 años) con una frecuencia no menor a una vez cada cinco años, enuna búsqueda selectiva o circunstancial”. Incluso la ILIB (International LipidInformation Bureau) recomienda comenzar el tamizaje con la determinación delcolesterol total y continuar con la determinación de colesterol-HDL ytriacilglicéridos, es importante asegurarse de que las determinaciones sean exactas.De otra parte, en los diferentes textos de Medicina Interna se afirma que elcolesterol-LDL es el factor de riesgo más importante para la enfermedadcardiovascular, incluso relacionan altos niveles de colesterol total con los niveles decolesterol-LDL.Si analizamos los resultados de nuestra población solo un 5.5% presenta altosniveles de colesterol plasmático, con niveles superiores a 6.2 mmoles/Litro (240mg/dL), como se observa en la tabla 9. De igual forma un 7.3% presenta niveles decolesterol-LDL por encima de 4.1 mmol/litro (160 mg/dL). Con estos resultados,tomados aisladamente como indicadores de dislipidemias, podríamos asegurar queel problema no es preocupante para nuestra población. Otra cosa reporta elInstituto Municipal de Salud que en su último informe coloca en la tabla deproblemas priorizados a la Hipertensión arterial, el Infarto y accidentecerebrovascular en el primer lugar, por encima incluso de problemas tan comunescomo la Enfermedad Diarreica Aguda y la Violencia. No se correlacionan losresultados de colesterol total y LDL con la alta incidencia de la enfermedad en laciudad de Pereira.En la literatura extranjera, especialmente la proveniente de Estados Unidos yEuropa, se señala la determinación de colesterol total en plasma como unimportantísimo factor de riesgo cardiovascular y como marcador ideal para iniciartamizajes metabólicos, antes de recomendar cualquier otra prueba. Para lapoblación Risaraldense estudiada por nosotros no es recomendable iniciar eltamizaje con la sola prueba de colesterol total, por el contrario se debe criticar estapráctica médica, muy utilizada en nuestro medio para iniciar la búsqueda de unaposible Dislipidemia.EL COLESTEROL – HDL COMO PREDICTOR DE RIESGO CARDIOVASCULAR.Función de las HDLLas lipoproteínas de alta densidad (HDL) juegan un papel crítico en el metabolismodel colesterol. Su concentración en plasma está inversamente relacionada con elriesgo para desarrollar la enfermedad aterosclerótica 53. El mecanismo por medio del 51
  • 52. cual las HDL protegen al individuo contra la enfermedad, no se conoce conseguridad.Experimentos in vitro sugieren que las HDL pueden remover el colesterol noesterificado desde las células periféricas 54. El colesterol libre en plasma esconvertido a éster de colesterol por la acción de la enzima Lecitin colesterol aciltransferasa55 (LCAT). En especies que expresan en plasma la proteína transferentede ésteres de colesterol una fracción significativa de ésteres de colesterol de las HDLes transferido a otras lipoproteínas en el metabolismo56. En ratones y posiblementeen humanos se presenta una ruta adicional para el transporte de los lípidoscontenidos en las HDL en la cual estas llevan el éster de colesterol directamente alos tejidos esteroidogénicos para la síntesis de hormonas 57 y al hígado para lasíntesis y secreción de ácidos biliares58.Evidencias tanto in vitro como in vivo han demostrado que la vía por medio de lacual las HDL llevan el colesterol directamente a los tejidos difiere de la vía delreceptor para las LDL porque este último está asociado a la endocitosis ydegradación de la partícula entera59. Estas observaciones sugieren un nuevomecanismo celular, mediado por receptor, para captar el colesterol de las HDLllamado captación selectiva de lípidos. Varios laboratorios han realizado ensayosde unión directa al receptor y de desplazamiento por agonista y han reportadounión de las HDL en diferentes tejidos y especies 60, algunos de los cuales estáinvolucrado en la captación selectiva de lípidos. En varios casos esta unión es pocoespecífica y el sitio de unión a las HDL interactúa con VLDL, LDL e IDL, así comocon apoproteínas aisladas tales como: apo AI, apo AII, apo AIII y apo E 61. Estainvestigaciones resultan interesantes no solo porque sugieren que representanligandos para diferentes lipoproteínas, sino que hay múltiples especies de HDL quecontienen una combinación variada de apoproteínas 62.Los principales componentes proteicos de las HDL son: apo AI y apo AII, en menosproporción están apo AIII, apo C, apo D y apo E. Estas apoproteínas pueden tenermayores funciones estructurales o sirven como reguladores del metabolismo de lasHDL.Es posible que las proteínas de las HDL sirvan como señal de reconocimiento paralos receptores que se ubican en la superficie celular. Recientes investigacionesrealizadas con ratones transgénicos y ratones “knockout” sugieren que apo AI y apoAII pueden jugar papeles fundamentalmente diferentes 63 en el metabolismo de loslípidos y de las HDL64. En ratones “knockout” para apo A-I se encontró unareducción significativa en la acumulación de éster de colesterol en tejidosesteroidogénicos, pero no en ratones “knockout” para apo A-II, lo que sugiere unaespecial función para apo A-I en la entrega del colesterol HDL a estos tejidos 65.Recientemente se ha establecido que la clase B del receptor “scavenger”, SR-B, esun receptor para las HDL que media la captación selectiva de éster de colesteroldesde las HDL en células en cultivo66. Análisis inmunoquímico de la expresión delmSR-B1 ha establecido que en roedores se expresa en mayor proporción en tejidosesteroidogénicos y en hígado, sitios donde la captación de colesterol desde las HDLes elevado67. Además, estudios de regulación hormonal para la expresión de SR-B1ha demostrado ser positiva para estrógeno, gonadotrofina coriónica humana y 52
  • 53. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAACTH, se ha demostrado también una acción coordinada entre la expresión del genpara SR-B1 y la captación selectiva de colesterol desde las HDL y esteroidogénesis 68.Estos estudios demuestran que el receptor SR-B1 es fisiológicamente importantepara la captación selectiva del colesterol transportado por las HDL, de igual formaexplica el mecanismo por medio del cual las HDL transportan el colesterol enreverso y amplían la visión en el metabolismo de las HDL.Otros estudios revelan que SR-B1 puede unir tanto HDL como LDL y que cargasaniónicas, pero no “zwitteriones” ni catiónicas, pueden unirse a él con una altaafinidad69. Estas cargas aniónicas pueden ser fosfolípidos de los liposomas, ya queHDL y LDL no poseen proteínas comunes, salvo muy pequeñas excepciones en lacual apoB se encuentra en HDL, estas observaciones sugieren, con mucha fuerza,que la cubierta de fosfolípidos es la responsable de la unión a estos receptores. Sereconstituyeron lipoproteínas con apo A-I, apo A-II y apo C, estas lipoproteínaspodían competir por el receptor SR-B1con las HDL nativas y adicionalmente lassolas apoproteínas también se unían.El mecanismo molecular preciso de la unión al receptor no se conoce. Segrest ycolaboradores en una amplia revisión sobre este receptor, sugieren que lacaracterística común para todas las apoproteínas mencionadas es la presencia dealfa hélices anfipáticas que se unen a los lípidos 70. Tal vez una de estas hélicesproporciona un epítope estructural común, el cual es complementario a unasuperficie de unión sobre el SR-B1. Méndez y colaboradores reportaron quepéptidos diméricos anfipáticos compiten con una alta afinidad por los sitios paraHDL, en cultivo de fibroblastos71.Posteriores estudios clarificarán los dominios de unión tanto del receptor como delligando. Otros investigadores han demostrado que en la captación selectiva deésteres de colesterol por parte de las células participan varias lipoproteínas: HDL,LDL e IDL72. Hacen falta más investigaciones para detallar el mecanismo de acciónde los receptores multiligandos y explicar el fenómeno completo de la captaciónselectiva de colesterol.En la ultracentrifugación se reconocían como HDL aquellas lipoproteínas quemigraran entre 1.063 y 1.21 g/mL y no aquellas partículas que quedaban en lazona del borde inferior. El advenimiento de técnicas de cromatografía de afinidadselectiva, que permiten recoger del plasma de forma cuantitativa todas laspartículas que contengan apo AI y caracterizar otras HDLs, la nueva partículapresenta una migración electroforética pre-beta, diferente a la gran mayoría de lasHDL que presentan migración alfa73.La principal especie molecular de esta fracción pre-beta (HDL, pre- beta 1) es unapartícula que tiene una masa aproximada de 67 Kd, contiene dos copias de apo A-Iy no tiene otra especie proteica. La fracción lipídica representa un 10% de lamasa total, comprendida por colesterol libre y fosfolípidos; HDL prebeta–1 se haencontrado en otras especies como ratones y monos74. Se conoce bien que estasHDL pre-beta1 incorporan colesterol de las células en la periferia, como primerpaso en el transporte centrípeto de colesterol que va al hígado a través del plasma 75. 53
  • 54. El siguiente paso es la esterificación del colesterol por la acción de la LCAT, y laHDL se convierte rápidamente en otras fracciones de alto peso molecular conocidascomo pre-beta 2 y pre-beta 3. Otra fracción del colesterol es transferido a LDL quecontienen apo B-100 o apo B-48, como aceptores; este paso es realizado por laproteína transferente de ésteres de colesterol. De esta forma un nuevo ciclometabólico, el ciclo de la HDL pre-beta1, se identifica como parte integral delmetabolismo del colesterol, sobretodo de la ruta que va de la periferia al hígado.Animales transgénicos que expresan los genes humanos de apo A-I y LCATpresentan niveles de colesterol cuatro veces superior a su normal y dos veces elcolesterol transportado por las HDL 76. Los ratones transgénicos presentan HDL demayor diámetro por su aumento en el contenido de éster de colesterol, de otraparte, el contenido de HDL pre-beta 1 está significativamente disminuido.La alta producción del gen mSR-B1 en ratones transgénicos produce una dramáticareducción de los niveles de HDL y un gran incremento del colesterol en la bilissugiere que este receptor puede conducir el colesterol de las HDL hacía laproducción de bilis en hígado77.Otro elemento en la regulación de los niveles de HDL pre-beta 1 es la proteínatransferente de fosfolípidos (PLTP), pues un incremento en su expresión conduce aun aumento en HDL pre-beta 1, parece que esta proteína no solo facilita latransferencia de fosfolípidos, sino también del colesterol libre 78.La cuantificación de HDL pre-beta 1 en plasma permite establecer la eficiencia delproceso que cataliza la esterificación del colesterol y su transferencia a laslipoproteínas aceptoras.En resumen podemos decir que cambios relativos en la actividad de LCAT, CETP,PLTP, lipoproteína lipasa y lipasa hepática podrían individualmente modificar losniveles de HDL pre-beta 1 en plasma. De otra parte, efectos sobre los moduladoresde estas proteínas, como es el caso de apo A-II sobre LCAT, pueden tener unimpacto sobre la concentración de HDL pre–beta 1 en plasma y por tanto sobre eltransporte en reverso del colesterol 79. La determinación de esta fracción de HDLpre-beta1 puede emerger como un indicador de riesgo cardiovascular enpacientes con bajos niveles de HDL y altos triacilglicéridos.Numerosos estudios epidemiológicos establecen que el nivel de colesteroltransportado por las HDL es un factor predictivo independiente para la enfermedadcardiovascular. El estudio cardiológico de Framingham, el estudio cardiovascularprospectivo de Munster (Prospective cardiovascular Munster, PROCAM), el estudiode seguimiento de los servicios de investigación de lípidos sobre prevalencia demortalidad, el LRC-CPT y el ensayo de intervención sobre múltiples factores deriesgo (Múltiple Risk Factor Intervention Trial, MRFIT) han sugerido que tras elajuste por otros factores de riesgo, el riesgo de enfermedad cardiovasculardisminuye en un 2 – 3% por cada mg/dL (0.03 mmol / L) de aumento delcolesterol – HDL.A menudo el descenso de las HDL va acompañado por un incremento en los nivelesde triacilglicéridos y obesidad que aumentan dramáticamente el riesgo, máxime 54
  • 55. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAcuando se presentan otros factores como sedentarismo y tabaquismo. En nuestrapoblación es común encontrar niveles de colesterol HDL bastante bajos. En loshombres, un 53.6% presentan niveles por debajo de 35 mg|dL, mientras que en lasmujeres el 77.8% presenta niveles de colesterol HDL por debajo de 45 mg|dL, (elmínimo recomendado en la literatura euroamericana).Colesterol – HDL Y SU RELACIÓN CON OTROS FACTORESYa hemos visto la importancia de las HDL como factor de riesgo cardiovascular eigualmente conocemos de los bajos niveles que maneja nuestra población. Por talmotivo queremos comparar sus niveles con otros factores de riesgo y así poderrealizar algunas recomendaciones, tanto en el campo de la investigación como en elcampo de la prevención.En la tabla siguiente dividimos la población en tres grupos, el primero se caracterizapor tener bajos niveles de colesterol – HDL (col-HDL< 30 mg/dL), el segundo tendríalos niveles normales, según los estándares internacionales de diferentes organismos(35<col– HDL<45 mg/dL) y el tercero, HDL relativamente altos para nuestrapoblación con niveles que superan los 45 mg/dL, estos grupos se comparan conrespecto a los otros parámetros del perfil lipídico.Tabla 27. COMPARACIÓN DE TRES SUBGRUPOS DE PERSONAS CONDIFERENTES NIVELES DE COLESTEROL- HDL FRENTE A OTROSPARÁMETROS SANGUÍNEOS Variable HDL<30(n=213) 30<HDL<45(n=423) HDL>45(n=120) Col. total 166.6 ± 45.9 169.0 ± 37.2 175.8 ± 32.4 Col.LDL* 104.7 ± 34.6 107.9 ± 33.0 89.8 ± 42.1 TAG 191.4 ± 152.5 130.9 ± 84.7 89.78 ±42.1 Glucosa 88.6 ± 27.6 87.5 ± 27.9 83.7 ± 11.9 *La determinación de Col-LDL se realizó utilizando la fórmula de Friedwald y para el grupo con col-HDL<30 el n =203, quiere decir esto que 10 de 11 personas con hipertriacilgliceridemia (TAG>400mg/dL) se encuentran en este grupo.Las diferencias entre el grupo con niveles de colesterol HDL<30 y el grupo conniveles de colesterol-HDL >45 son bastante notables, no es más que observar losniveles de triacilglicéridos: para el grupo con HDL bajo es 191.4 mg/dL y para elgrupo con niveles de colesterol-HDL por encima de 45 es 88.8 mg/dL; la diferenciaes altamente significativa con un p<10-5. Para realizar una comparación másdetallada, separamos los grupos de bajo niveles de HDL y de altos niveles de HDL yanalizamos todos los parámetros que de alguna manera influyen o se constituyencomo factores de riesgo cardiovascular. 55
  • 56. Tabla 28. COMPARACIÓN DE LOS DIFERENTES PARÁMETROS ESTUDIADOS ENTRE LOS GRUPO DE ALTO Y BAJO NIVEL DE HDL- COLESTEROL Parámetro HDL < 30 HDL > 45 Colesterol 166.58 ±45.9 175.84±32.4 Col HDL 25.46±3.6 55.56±6.7 Col-LDL 104.6±34.5 107.1±30.5 TAG 191.4± 152.5 88.8±42.1 Glucosa 88.6±27.6 83.7±11.9 Edad 38.8±15.9 35.6±15.0 IMC 25.5±4.35 23.45±4.21 TAS 121.1±19.4 116.0±18.2 TAD 77.8±11.5 74.8±12.0 Sexo =F (%) 42.7 65.8 Fuma=Si(%) 22.1 8.3 Al comparar estos dos grupos de personas podemos notar que:1. La diferencia más notable en el parámetro sanguíneo corresponde a los niveles de triacilglicéridos: en el grupo con bajos niveles de colesterol-HDL es más del doble que el correspondiente al grupo de colesterol – HDL alto.2. Los promedios de la tensión arterial diastólica y sistólica son mayores en el grupo con bajos niveles de colesterol-HDL, la sistólica está 5 mmHg por encima y la diastólica, 3 mmHg.3. Hay un alto porcentaje de mujeres con bajo nivel de colesterol-HDL: 91 personas (42.7% de 213 que presentan colesterol HDL bajo). El número de hombres es más alto (57.3%: los restantes 122), sin embargo se esperaba que fuese mucho mayor, pues el promedio de los niveles de colesterol HDL en mujeres de Europa y Estados Unidos supera fácilmente el valor de 40 mg/dL .4. Hay que notar la gran diferencia al considerar el hábito de fumar, con preocupación vemos que en el grupo de fumadores el número de personas con colesterol HDL bajo casi triplica al de personas con colesterol HDL alto. (22.1 vs 8.3). Se conoce que el hábito de fumar produce una disminución en la concentración sérica de colesterol transportado por las HDL y de esta forma contribuye sensiblemente como factor de riesgo cardiovascular.Es importante concluir que estas dos poblaciones son diferentes con respecto a losfactores de riesgo cardiovascular analizados en la presente investigación. No haydiferencias significativas con respecto a la edad o al estrato social. Es preocupanteencontrar que ambos grupos afirman realizar actividad física en el mismoporcentaje (±44%). Esta inconsistencia se debe a fallas con la encuesta: laspersonas afirman hacer actividad física cuando en realidad no lo hacen periódica 56
  • 57. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAsino esporádicamente. Ya en la investigación, con instructores de aeróbicos de laciudad de Pereira, realizada por estudiantes del programa de recreación y deportede la facultad de medicina, se encontró que el ejercicio continuo aumentasignificativamente los niveles de colesterol HDL en suero.Para continuar el análisis de las HDL bajas como factor de riesgo cardiovascular,recordemos algunas de las correlaciones más sobresalientes:3. En la figura 6 se muestra una correlación negativa con respecto al Índice de Masa Corporal, pero es el componente del peso el más importante como se muestra en la figura 7.4. Correlaciona negativamente con la edad como se observa en la figura 10. En la tabla 19 se confirma que las personas con más de 35 años presentan niveles de colesterol HDL más bajos que las personas con edad inferior a los 35 años, el OR para esta comparación resultó de 1.15.5. Correlaciona negativamente con la tensión arterial tanto diastólica como sistólica.Podemos concluir que:En el perfil lipídico realizado a la muestra poblacional del Departamento deRisaralda, el factor de riesgo más importante encontrado es el bajo nivel decolesterol transportado por las HDL.LA OBESIDAD COMO FACTOR DE RIESGO CARDIOVASCULAR EN RISARALDA.Desde el punto de vista antropométrico, consideramos que una persona es obesacuando su peso es superior al 120% del peso teórico o ideal, de acuerdo con lastablas de peso normal para una población determinada, según la edad, el sexo y laaltura del individuo.Si utilizamos el Índice de Masa Corporal como medida del grado de obesidad,podemos afirmar que una persona padece sobrepeso cuando su índice de MasaCorporal supera el valor de 25 Kg/m 2 , estos criterios son los recomendados por laOrganización Mundial de la Salud desde 1993.Algunas asociaciones de salud, especialmente norteamericanas, consideran a laspersonas con IMC entre 25 y 30 como sobrepeso, y a las personas con IMC > 30como obesas. En la sociedad colombiana no hay un estudio amplio que permitaconsiderar las variables de sobrepeso y obesidad, tampoco hay estudiospoblacionales de adiposidad, por lo tanto analizamos los datos encontrados y apartir de ellos determinaremos los valores de sobrepeso y obesidad para lapoblación risaraldense.El peso promedio para la muestra total fue de 61.43 ±12.55 Kg, con un promediopara las mujeres de 57.8 ± 11.83 Kg, mientras que para los hombres el promedioresultó de 65.35 ± 12.13 Kg . El Índice de Masa Corporal (relación de peso/talla2 )resultó de 24.18 ± 4.37 para toda la población; para los hombres este índice resultóde 23.9 ± 4.13 y para las mujeres, de 24.4 ± 4.56. Es curioso observar como, a 57
  • 58. pesar de tener menor peso, la mujer presenta un mayor índice de masa corporal, loque indica que la mujer paisa tiende a ser de baja estatura y gordita.Para efectos de comparación tomamos dos grupos de hombres (género masculino):el primero, de peso normal con un IMC<25 y el segundo, considerado comopoblación obesa, con IMC>28.7 y un peso superior al 120% de la media encontradapara la población masculina.Tabla 29. COMPARACIÓN DE ALGUNOS PARÁMETROS BIOQUÍMICOS YFÍSICOS ENTRE DOS POBLACIONES DEL GÉNERO MASCULINO: OBESOS YNORMALESParámetro IMC<25 IMC>28.7Colesterol 160.0±41 184.6±31.3Col-HDL 35.19±7.65 32.77±11.61Col-LDL 100.0±32.3 112.89±26.81TAG 120.5±78.8 215.8±122.94TAS 116.06±14.92 133.1 ±19.45TAD 74.7±10.4 85.91±10.35Peso 59.5±7.7 84.1 ± 11.89Edad 32.83±15.6 41.2 ± 13.59Al comparar estos resultados podemos valorar claramente las dos poblacionesfrente a factores de riesgo clásicos como los niveles de colesterol total: 24 mg/dLsuperior en la población obesa; el HDL está 3.5 mg por debajo de la poblaciónnormal y el LDL 13 mg por encima; los TAG están 95 mg por encima en lapoblación obesa y la tensión arterial es mayor tanto para la sistólica como para ladiastólica, en casi todos estos casos la diferencia es altamente significativa conp<0.005 (excepto la concentración de colesterol HDL donde la diferencia resultó solosignificativa, p<0.01)La obesidad se convierte en un factor grave de riesgo cardiovascular. Como vemosen la tabla anterior correlaciona positivamente con hipertensión arterial, conhipertrigliceridemia, con hipercolesterolemia y con bajo nivel de colesterol – HDL.No sobra decir que en la población obesa hay una mayor proporción de diabetesmellitus que torna aún más complejo el problema cardiovascular.Hoy día sabemos que la obesidad se produce cuando coinciden en una persona lapredisposición genética y los factores ambientales “facilitadores” o desencadenantes.Los hallazgos recientes de Friedman en Estados Unidos de un gen defectuoso enratones ob y de su homólogo en la especie humana confirman plenamente lapredisposición genética, al menos en determinados obesos. Los factores genéticos ymedioambientales se influyen por igual en la obesidad: podemos decir que lagenética establece la capacidad para ser obesos y el ambiente determina elmomento de aparición de la enfermedad y de su magnitud. Al parecer la genéticadetermina principalmente la distribución de esa adiposidad. 58
  • 59. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAObesidad por inactividad física La extensión progresiva del sedentarismo en lapoblación en general relacionado con la utilización, cada día mayor, de aparatos queahorran esfuerzo (autos, ascensores, escaleras eléctricas, lavadoras, mandos adistancia etc.); estilo que caracteriza en buena medida la vida moderna, es en parte,la causa del incremento en la prevalencia de la obesidad en el mundo civilizado uoccidental. Los estudios epidemiológicos demuestran que la mayor prevalencia sepresenta en individuos con profesión sedentaria. La dieta juega un papel crucial enel tipo y grado de obesidad, no solo por la composición de la dieta, sino por lafrecuencia con que se ingieren los alimentos.Hoy en día está plenamente aceptado el papel de la herencia en la génesis de laobesidad. La distribución del tejido adiposo, la ingesta calórica total, el gastometabólico basal, la actividad de la lipoproteinlipasa, las preferencias alimentarias yla tasa lipolítica basal dependen en un 35 a 40% de la carga genética de nuestrosantepasados80.Los trabajos clínicos realizados por Stunkard y colaboradores 81 con gemeloshomocigotos criados en ambientes distintos permiten considerar la predisposicióngenética a la obesidad, sin dejar de lado la importancia de factores sociales,educativos o nutricionales.En los últimos años, el descubrimiento de algunos defectos moleculares hasuscitado enormes expectativas (sobre todo el de los genes ob, db y UCP-2) que hanpropiciado un mayor avance en la comprensión fisiopatológica de la obesidad y hanabierto campo a posibles aplicaciones terapéuticas.El ratón obeso ob/ob se caracteriza por ser hiperfágico, dislipémico,hiperinsulinémico y diabético; factores que transmite de forma recesiva a sudescendencia, en algunos ratones se presenta también una disminución de laleptina. En el ser humano el equivalente del gen ob se ha localizado en elcromosoma 7q31, provoca una disfunción de la leptina, pero solo se ha encontradoun caso de disminución, lo más común son niveles altos de esta proteína 82. Lapatogenia del gen ob en la obesidad humana dista de conocerse, recientemente seha encontrado una región polimórfica cerca del gen ob que está relacionada con laobesidad mórbida83.La leptina es un péptido de 167 aminoácidos (hay una variante de 166 con carenciade glutamato en la posición 49 pero con funcionalidad equivalente) que se sintetizaen el tejido adiposo blanco, en los adipositos maduros principalmente subcutáneos,y se libera a la circulación. Su síntesis depende del porcentaje de grasa corporal,del sexo (las mujeres son más hiperleptinémicas), de la edad y de varios factoreshormonales. El frío, mediante estimulo de receptores beta-adrenérgicos; el AMPcíclico y la somatostatina inhiben la síntesis de leptina; la insulina, el cortisol, elfactor de necrosis tumoral alfa (TNF_α) y la Interleuquina I aumentan su síntesis 84.Sin embargo, de todos los factores mencionados la insulina tiene un papelpreponderante. En adipositos en cultivo, la insulina no solo aumenta laconcentración de ob ARNm, sino que es vital para la secreción de leptina por partede la célula85. 59
  • 60. En los humanos hay una relación positiva entre leptina e insulina, pero solo encasos de hiperinsulinemia sostenida, ya que inyecciones de insulina no provocan suaumento. Se ha encontrado que la insulina per se no es suficiente para aumentarlos niveles de leptina. Las personas diabéticas tipo 2 parecen tener igualesconcentraciones de leptina que las no diabéticas con el mismo Índice de MasaCorporal86. Finalmente cabe señalar que la secreción de leptina sigue un ritmocircadiano, influenciada por los cambios en la melatonina 87 excretada por la víarenal.Las ratas fa/fa y los ratones db/db son dos modelos de obesidad, tambiénrecesivos, muy similares a los ratones ob/ob. Se diferencian por unahipercolesterolemia e hipertriacilgliceridemia mayores y precocidad en la aparición ydesarrollo de la diabetes 88; el gen del ratón db se encuentra en el cromosoma 4 y suequivalente en el humano está en cromosoma Ip31. Al igual que en el ser humano elratón es hiperleptinémico y su obesidad es resistente a la inyección de leptinaintraperitoneal.La búsqueda para esa leptina-resistencia permitió descubrir el receptor para laleptina (obR). Se conoce que hay una menor captación de leptina radiactiva enanimales obesos comparados con ratones normales. El mecanismo exacto no seconoce pero existen varias posibilidades: la primera sería la disminución en el pasoa través de la barrera hematoencefálica, otra podría ser la presencia de un númeromenor de receptores para leptina obR, también podría contar la presencia dereceptores anómalos para la leptina o la presencia de un defecto postreceptor.Existen por lo menos cinco receptores para la leptina, el más importante es elconocido como receptor largo obRb que tiene 304 aminoácidos intracelulares, tieneuna función de tirosinquinasa y presenta segundos mensajeros 89.Existe también la posibilidad que la resistencia a la leptina no se deba a lapresencia de un receptor defectuoso, sino a un defecto posterior en el mecanismocelular. Es bueno recordar que el efecto anorexiante de la leptina no se da demanera directa sobre el centro de la saciedad, sino que actúa a través de unsegundo mensajero que afecta la función hipotalámica: el neuropéptido Y (NPY). Seconoce la relación del NPY con la patogenia de la obesidad, ya que se concentra enel núcleo arqueado, en áreas implicadas en la conducta alimentaria, del gastoenergético y del sistema nervioso autónomo90.Al inyectar a un ratón por vía intraperitoneal el neuropéptido Y, él desarrolla unaobesidad reversible, marcadamente hiperinsulinémica e hiperfágica; de otra parteal inyectar leptina intraventricular se observa una disminución del NPY enhipotálamo. Todo lo anterior hace pensar en una tríada de NPY, leptina e insulinapara manejar el balance energético91.La leptina sintetizada por el tejido adiposo blanco -cuando hay buenas reservasenergéticas- actúa sobre hipotálamo, específicamente sobre el receptor obR induceuna disminución en la síntesis y liberación de NPY y genera sensación de saciedad.Luego, ante una situación de hambre, el aumento del NPY induce un incremento enla insulina, posteriormente se produce un incremento en los niveles de leptina quehace disminuir los valores de NPY. En las personas obesas puede darse una 60
  • 61. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAalteración de los receptores obR, la leptina no disminuye el NPY por lo que persistela sensación de hambre y compulsión.Este esquema, aparentemente sencillo, se hace más complejo al observar que laleptina tiene dos funciones: una central sobre hipotálamo que induce una sensaciónde saciedad y así bloquea la entrada de nutrientes, y otra periférica que reduce losniveles de insulina, disminuyendo su liberación 92. De igual manera se haencontrado que la leptina actúa sobre el tejido adiposo y produce un aumento enla degradación de la insulina93.En síntesis, en situaciones lipogénicas (alta disponibilidad energética ehiperinsulinemia) la leptina disminuye el apetito por aumento del gasto calóricomediante la termogénesis y genera reducción de la secreción de insulina eincremento de su degradación; en otras palabras contrarrestaría los mecanismosque generan obesidad y resistencia a la insulina.Otra proteína involucrada en la obesidad, es la UCP-2 (proteína desacopladora –UnCoupling Protein), sintetizada específicamente en el tejido adiposo marrón opardo, se comporta como una proteína translocadora de protones en la membranaexterna de la cara interna de la mitocondria (hace perder su gradiente electrónico).De esta forma bloquea la fosforilación oxidativa y la energía resultante de laoxidación de los enlaces se pierde en forma de calor. Animales transgénicos quesobreexpresan la UCP2 tienen un marcado aumento en la lipólisis y disminuyenpeso. Cuando existe una mayor cantidad de UCP2 hay un aumento considerable determogénesis y pérdida de peso. En los seres humanos, el gen para la UCP seencuentra en el cromosoma 4q31. Su expresión depende del frío, de lascatecolaminas, de la triyodotironina y del ácido retinoico94.La población Risaraldense que presenta obesidad se caracteriza por tener altosniveles de glucosa 92.44 ± 35.48 mg/dL comparada con la población general quepresenta niveles de 87.0 ± 25.5 mg/dL. Se localiza con preferencia en el áreaurbana (73.3%) y pertenece a los dos primeros estratos (84.6%). La poblaciónobesa en el departamento de Risaralda presenta incrementados los diferentesfactores de riesgo cardiovascular, tanto los parámetros sanguíneos como los físicos(TAD,TAS, RCC).Es importante anotar que no conocemos estudio alguno en Colombia sobre laobesidad como factor de riesgo cardiovascular y por lo tanto, debemos atendernuestros resultados. Consideramos que el sedentarismo juega un papel crucial enel desarrollo de la obesidad, ya que el promedio de edad de la población obesa (42.7± 14.3) es mayor que el promedio de la población total (35.2 ± 15.4). El 80% de lapoblación obesa presenta una edad mayor de treinta años, sin lugar a dudas laobesidad que prevalece es de la edad adulta y se presenta con mayor frecuencia enla mujer (57.8%), muy posiblemente después del embarazo.Consideramos importante profundizar en el estudio de la obesidad como factor deriesgo cardiovascular y analizar algunos marcadores moleculares, al igual queestudiar a profundidad la dieta, con el fin de determinar sus causas para proponersalidas posibles y políticas a implementar para mejorar el estado de salud denuestra población. 61
  • 62. APOPROTEÍNA E EN LA POBLACIÓN DE RisaraldaLa apoproteína E es una glicoproteína de 34.2 KDa que se encuentra en lasdiferentes lipoproteínas (Quilomicrones, VLDL, IDL, HDL). Juega un papelimportante en el aclaramiento de los remanentes de lipoproteínas que tienen unalto contenido de colesterol, en especial los remanentes de quilomicrones y losremanentes de IDL. El gene para esta apoproteína contiene cuatro exones y tresintrones; y se encuentra en el cromosoma 19q13. El péptido señal es de 18aminoácidos, la proteína madura contiene 299 aminoácidos. El sitio de síntesis porexcelencia es el hígado, aunque muchos tejidos tienen la capacidad para sintetizarlay lo hacen en pequeña cantidad. Es bueno mencionar que los macrófagos cercanosa arterias lesionadas por ateromas sintetizan apoE que permite la síntesis de unalipoproteína HDL especial.Tres tipos de receptores reconocen apo E: el receptor que reconoce apo B-100 de lasLDL, especialmente los localizados a nivel hepático; la proteína relacionada con elreceptor para LDL (LRP), la cual también actúa como receptor para la α-2-macroglobulina y el proteoglicano heparán sulfato (HSPG) recientemente postuladocomo receptor para lipoproteínas95.Apo E es la principal apolipoproteína encontrada a nivel de cerebro y líquidocefalorraquídeo, se piensa que participa en la distribución de lípidos durante eldesarrollo del sistema nervioso central y en la regeneración de nervios después deuna lesión96.La distribución de las isoformas cambia de región a región como se presenta en latabla siguiente:Tabla 30. DISTRIBUCIÓN PORCENTUAL DE LOS GENOTIPOS PARA LAAPOPROTEÍNA E EN SEIS POBLACIONES DIFERENTES EEUU Alemania Finlandia Japón Turquía Risaralda Genotipo E4/4 3.0 2.8 5.9 1.3 1.1 0.91 E3/4 14.0 22.9 35.5 11.3 12.9 13.91 E3/3 58.0 59.8 46.8 72.1 74.2 72.47 E2/3 22.0 12.0 9.9 13.8 10.6 8.71 E2/2 1.1 1.0 0.5 0.6 0.4 1.83 E2/4 2.0 1.5 1.5 0.9 0.8 2.14 Alelo e4 15.0 24.4 24.4 7.4 7.98 8.93 e3 76.0 77.3 69.5 84.0 86.0 83.78 e2 13.0 7.7 6.2 8.0 6.1 7.25 62
  • 63. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAComo se observa en la anterior tabla la distribución de las isoformas para laapoproteína E es bien diferente y se pueden definir dos grupos característicos: unoes el grupo anglosajón (Finlandia, Alemania y Estados Unidos) y otro el asiático(Turquía y Japón), a este último se parece la población del Risaralda.En África la distribución de los genotipos es diferente de estos dos grupos, porejemplo en Sudán la distribución es: E4/4 = 8.7%; E 3/4 = 35.9%; E3/3= 39.8%;E2/3=9.7%; E2/2=1.0%; E2/4=4.9%. La distribución alélica es e4=29.1%;e3=61.9% y e2=8.1%; los genotipos E3/3 y E3/4 son casi iguales en la poblaciónafricana, mientras que en los otros dos grupos prevalece la E3/3 (con más explicitaprevalencia en la población asiática).La semejanza nuestra con las poblaciones asiáticas en la distribución de laapoE va más allá, pues en ambas regiones los bajos niveles de colesteroltransportado por las lipoproteínas de alta densidad se convierten en unpreocupante factor de riesgo para la enfermedad aterosclerótica. Las tresisoformas difieren en su capacidad para unirse a los receptores, mientras que apo 3y 4 se unen normalmente, la apo E2 se une con una afinidad del 1% de lo normal.Esta baja afinidad se asocia con una Dislipidemia conocida comohiperlipoproteinemia tipo III (cursa con altos niveles de colesterol y triacilglicéridos)que produce una mayor propensión a padecer la enfermedad cardiovascular 97.La síntesis de apo E a nivel hepático es un importante factor que modula la síntesisde VLDL, tanto que la sobre-expresión de esta apoproteína conlleva a nivelesincrementados de triacilglicéridos. Es importante saber que ahora se está midiendola concentración de esta apoproteína y que aumentos en un 20 a 40% de ella enplasma, independiente del genotipo, conducen a un incremento en los niveles deVLDL y por ende a una hipertriacilgliceridemia. De esta forma podemos afirmar queapo E es un factor determinante en el metabolismo de las VLDL que actúamodulando su velocidad de síntesis y secreción, su procesamiento 98lipolítico y elaclaramiento plasmático de esta partícula. Apo E afecta síntesis, liberación,actividad de lipasas y unión a receptores. Hoy se conoce que la sobre-expresión deapoE-2 estimula la expresión de VLDL99.La hiperlipoproteinemia tipo III no es simplemente causada por la presencia de apoE 2, que induce a una acumulación de remanentes de quilomicrones y VLDL. Esnecesaria su presencia pero no suficiente, pues se han encontrado individuos conesta característica genética que incluso generan una hipolipoproteinemia y lamayoría son normolipémicos; el desarrollo de la hiperlipoproteinemia tipo IIIrequiere una susceptibilidad genética o la presencia de algunos factoresambientales que inducen a la hiperlipoproteinemia tipo III.En el estudio del Corazón de los turcos se observa que su perfil lipídico es muyparecido al encontrado en la población risaraldense, veamos la siguiente tablacomparativa. 63
  • 64. Tabla 31. COMPARACIÓN DE LA DISTRIBUCIÓN PORCENTUAL DE LAFRECUENCIA DE LOS PARÁMETROS DEL PERFIL LIPÍDICO DE LAS POBLACIONESTURCA Y RISARALDENSE TURQUIA RISARALDA Mujeres Hombres Mujeres Hombres COLESTEROL <200 mg/dL 78 68 79.0 80.2 200 – 240 16 22 15.1 14.7 >240 mg/dL 6 10 5.9 5.2 N 2932 6085 410 388 C-LDL <130mg/dL 72 63 74.4 77.6 130 – 159 19 22 17.3 16.0 >160 mg/dL 9 15 8.3 6.4 N 2908 5943 410 388 C-HDL <35 mg/dL 26 53 39.3 53.6 35 – 44 mg/dL 40 35 38.5 34.8 >45 mg/dL 34 12 22.2 11.6 N 2972 6085 410 388 Triglicéridos <200mg/dL 94 85 83.4 55.7 200- 399mg/dL 3 13 14.4 41.5 >400 mg/dL 1 2 2.2 2.8 N 2932 6085 410 388Como se puede observar en la tabla anterior los parámetros correspondientes alperfil lipídico entre las dos poblaciones presentan una alta similitud. En amboscasos un alto porcentaje de la población, tanto hombres como mujeres, presentabajos niveles de colesterol - HDL, más preocupante para el género femenino delRisaralda, pues es mayor el porcentaje de mujeres que presenta niveles por debajode 35 mg/dL (39.3 vs 26.0). Este problema puede ser debido a factores ambientalescomo dieta, sedentarismo, estilo de vida más occidental, etc.Con respecto a los niveles de colesterol total hay una mayor diferencia por géneroen la población turca que en la población risaraldense, pero en ambas poblacionesse observa una frecuencia alta de normalidad y solo un 6% de la población presentaniveles por encima de 240 mg/dL, que no es comparable con las poblacionesnorteamericanas en donde más de un 15% superan esta cifra.En el congreso de la Asociación Colombiana de Ciencias Biológicas realizado en laciudad de Cali en 1999, el Dr. Rodríguez C.A. presentó sus resultados sobre elcromosoma-Y y sus implicaciones en la migración de las poblaciones; él concluyeque nuestros ancestros son más del medio oriente que de Europa y que los asiáticosmigraron por el estrecho de Bering y de esta forma poblaron el continenteamericano. Efectivamente los arqueólogos afirman que el inicio del poblamientoamericano se realizó por Siberia. Esta migración es relativamente reciente y data dela última era glacial y la penetración en el territorio suramericano variaba, desdeluego, dependiendo de los estados climáticos. 64
  • 65. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAAdicionalmente se debe recordar que los españoles estuvieron invadidos por losárabes y turcos por más de ocho siglos, que los pueblos celtiberos se mezclaroncon otomanos y árabes, por lo tanto, de esta combinación se generó una gran cargagenética medio-oriental. Al llegar a nuestros territorios se combinaron con nuestrosancestros y reforzaron el aporte asiático, que finalmente llevó a un alto parecido alos genes del oriente medio.Pero ¿qué importancia tiene esta semejanza nuestra con los turcos y japoneses en elestudio de los lípidos?. Es fundamental, pues los estudios que se toman deejemplo en el mundo entero provienen de EUA y Europa, nuestros médicos sonpreparados en las escuelas de medicina básicamente con textos norteamericanos,los perfiles lipídicos que se estudian son de la población norteamericana, losejemplos de anormalidad y normalidad que se toman corresponden a los estudiospoblacionales realizados en Norteamérica. Pero ¿qué tanta distancia debemosguardar con esas poblaciones?, por una parte se diferencian genéticamente denosotros y por otra pertenecen a un potencia imperialista, donde las calorías diariasingeridas es muy superior a la nuestra, la distribución de su dieta es muydiferente, una muy alta concentración de grasa saturada- especialmenteproveniente de las comidas rápidas- .En definitiva debemos mirar con precaución los resultados de aquellos estudios yno tomarlos como parámetros de comparación para intervenir nuestros pacientes.Imaginemos solamente el tratar de llevar una mujer con niveles de colesterol de 30mg/dL a más de 45 mg/dl, además de ser una misión casi imposible, se convierteen una carga de estrés para la paciente, pues todos sus esfuerzos son insuficientespara conseguirlo.Otra gran semejanza que se observa entre nosotros y los turcos, es el no haberencontrado la mutación apo B3500, a pesar de estudiar todas la personas quepresentaron niveles de colesterol superiores a 250 mg/dL. En el estudio del Corazónde Turquía estudiaron 2450 personas, diez veces más que en Risaralda, ellosincluyeron a pacientes de hospital con enfermedad cardiovascular y tampocoencontraron la presencia de la mutación glutamina- arginina para la apo B-100. 65
  • 66. CONCLUSIONES Y RECOMENDACIONESLos altos niveles de colesterol (colesterol>240 mg/dL) se encontraron en personasque viven la ciudad (31 de 44 personas, que representan el 93.2%) mientras quesolo 3 de 44 viven en el área rural. De estas 44 personas con altos niveles decolesterol 24 son mujeres y 20 son hombres. Es sorpresivo este resultado puesesperábamos que el porcentaje mayor fuera aportado por el género masculino. Elmayor porcentaje de las personas hipercolesterolémicas es aportado porPereira/Dosquebradas (27 de 44) que representan el 61.36%, mientras que el aporteque hacen a la muestra poblacional es del 38%. Es interesante anotar que 44personas con colesterol mayor de 240 mg/dL solo representan el 5.5% de lamuestra a la cual se le determinó este parámetro.En otras palabras, quiere decir que la magnitud del problema, hipercolesterolemia,no es tan grave como se presenta en los países anglosajones – específicamente deEstados Unidos de América y Europa – algunos autores afirman que los altosniveles de colesterol son un problema de países industrializados; lo cual nocompartimos pues Japón, Corea y Singapur pueden ser considerados como tales ylos niveles altos de colesterol no son el problema principal de riesgo cardiovascular.Los niveles de colesterol – HDL, tanto en hombres como mujeres, son extrañamentebajos en toda la población. En hombres el promedio apenas si alcanza el valor de34.35 ± 8.75 mg/dL, el 53% de la población masculina presenta niveles de C-HDLpor debajo de 35 mg/dL; las mujeres presentan un promedio para C-HDL de 37.55± 9.5 mg/dL y el 80% de la población femenina presenta niveles de colesterol –HDLpor debajo de 45 mg/dL. En estados Unidos de América los promedios parahombres y mujeres son: 47 mg/dL y 56 mg/dL respectivamente 100, es de anotarque con estos niveles tan bajos de C-HDL es muy frecuente la presencia de ÍndiceArterial superior a 5.0, que se considera de riesgo en poblaciones Europa y EstadosUnidos.Se afirma que los bajos niveles de colesterol – HDL se deben a factores genéticos,pues turcos que viven en Alemania, e incluso hijos de Turcos, nacidos en Alemania;presentan también C-HDL bajos. Para la población risaraldense no podemos afirmarcategóricamente si los niveles de C-HDL cambian al emigrar a Europa o EstadosUnidos, sería fácil proponer este estudio con la alta tasa de migración que sepresenta en esta región e incluso en el país, pues en los últimos tres o cuatro añoshan salido cerca de un millón de colombianos en busca de empleo y seguridad, quelastimosamente no ofrece en estos momentos esta nación. Se puede inferir delestudio realizado con los turcos que a nosotros tampoco nos cambiarían los nivelesde HDL – colesterol, pero sería bueno corroborarlo.El nivel de ingreso salarial afecta positivamente los factores de riesgocardiovascular, los estratos altos 4 y 5 presentan mayores niveles de TAG, colesteroltotal e hipertensión arterial.En EUA el nivel salarial correlaciona negativamente con los niveles de colesterol, amayor salario menor concentración de colesterol y las personas de menor salariopresentan mayor nivel de colesterol total y C-LDL, mayor obesidad y mayor tensiónarterial. Es la gran diferencia entre un país imperialista y un país de la periferia, 66
  • 67. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDAaquí el alimentarse opíparamente es signo de buena salud y de buen gusto, tenerun auto, entre más fino mejor, y nunca bajarse de él es sinónimo de estatus;mientras que en el imperio estar bien significa que las personas van a losgimnasios, se alimentan con comida “ligth”, bastante costosa por cierto; mantienenconsultando sus dietistas, psicólogos etc.El hambre que ronda en nuestras ciudades hace que muchas personas conposibilidades de “buena” alimentación no se preocupen por lo que comen, no haycultura del buen comer, no tenemos más que una tradición de comidas ricas engrasa y carbohidratos, verbigracia el sancocho valluno o los frijoles paisasenriquecidos con chicharrón y grasa de cerdo.La dieta es uno de los factores que debe ser estudiado en nuestra población, conmiras a emprender una campaña de educación en este sentido. Pero hoy, bajo lascondiciones que vive el país es prácticamente una ilusión. El 80% de la poblaciónque labora gana un salario mínimo equivalente a 125 dólares y de ese dinero debenvivir más de dos personas: un promedio de 2 o 3 dólares por persona/día, que noalcanza para una buena ración de aminoácidos, ácidos grasos esenciales opoliinsaturados y ni qué pensar de frutas y zumos naturales; el 20% se encuentradesempleado y el 30% vive sumergido en la economía informal, donde incluso losingresos no alcanzan al dólar diario.En nuestro medio los “ejecutivos” están sometidos a grandes presiones económicas,las llamadas comidas rápidas (costosas por cierto) son la dieta diaria, debenlaborar 14 o 16 horas al día para cumplir las metas impuestas por el sistema -educación privada para sus hijos, el mantenimiento del auto, la cuota de la casa,los altos servicios e impuestos, la cuota del club etc.- incluso deben trabajar en másde un sitio y más de un turno con el objeto llevar el dinero necesario para mantenersu “buen” nivel de vida.Los bajos niveles de colesterol - HDL que se presentan en nuestra población, nopueden ser explicados solamente por la falta de ejercicio, la dieta y el fumar. Aligual que en la POBLACIÓN ORIENTAL hay personas con genotipo 3/3 con altos ybajos niveles de C-HDL, o personas con genotipo 2/3 que tienen altos y bajosniveles de colesterol-HDL, pero es curioso que en la población que tiene genotipo2/3 el 36.36% (20 de 55) presentan niveles de colesterol – HDL menores a 30mg/dL, mientras que el 26% (112 de 428) de aquellos con genotipo 3/3 presentanniveles de HDL menores a treinta mg/dL. A pesar de estas particularidades nopodemos afirmar que haya una clara correlación entre el genotipo para apo E y losniveles tan bajos de colesterol – HDL en nuestra población, igual ocurre en laspoblaciones del medio oriente. Deben existir otros factores que afectan la síntesis, ola degradación de las lipoproteínas de baja densidad en nuestra población. Sedebería estudiar más a fondo para determinar la causa o causas posibles de estosbajos niveles de C – HDL y cómo afectarlos positivamente.Recomendaciones de investigación. Se deben hacer investigaciones de este mismo tipo en otras regiones, con el fin de corroborar nuestros datos, o de compararlos entre sí para encontrar y explicar diferencias. 67
  • 68.  Investigar los factores de riesgo en personas que han sufrido una enfermedad cardiovascular y comparar los resultados con la población general de la región, para encontrar las diferencias si las hay o postular algunas otras investigaciones dependiendo de los resultados. Investigar los genotipos para apo E en diferentes poblaciones con riesgo específico para la enfermedad cardiovascular, por ejemplo en los diabéticos tipo 2, en la población obesa (IMC>27.8). Sospechamos que puede haber una correlación entre el genotipo 2/3 y la aparición de diabetes mellitus tipo 2 en nuestra población. Investigar factores de riesgo cardiovascular emergentes, como: Homocisteina, receptores para apoB/E, Proteína transferidora de lípidos, Chlamydia, actividad de la lipoprotein lipasa, CD36 en macrófagos, expresión del gen CCR2. Estudiar los factores de riesgo cardiovascular en las poblaciones indígenas que aún subsisten en nuestro país con el fin de implementar campañas de educación acordes con sus principales factores de riesgo o de recoger información sobre sus costumbres que puedan ser implementadas en nuestra población con el objeto de disminuir riesgos. Determinar la concentración de la apo E en sangre y no solo su genotipo. Buscar en lo posible otras expresiones de apo E para nuestra población. Estudiar a fondo la literatura sobre el comportamiento del metabolismo de los lípidos en los orientales, igualmente la frecuencia de trastornos genéticos y enfermedades del metabolismo que se presentan en dicha población y compararla con la nuestra.Recomendaciones generales Realizado el estudio sobre los factores de riesgo cardiovascular en la población risaraldense se debe comenzar una campaña de difusión de los resultados en toda la población, primero con los médicos y personal de salud, luego con el sector docente que se encarga de orientar la asignatura de comportamiento y salud, posteriormente llegar a la población que acumula más factores de riesgo a causa de su profesión: estrés y sedentarismo, como por ejemplo conductores de vehículos al servicio público. Conformar un equipo que se encargue en la región del programa “corazón sano” como parte importante de la campaña de educación sobre el colesterol y la prevención de la enfermedad cardiovascular. Ese equipo debe tener claridad pedagógica y experiencia en educación de adultos, especialmente motivado en servir y educar al pueblo con el fin de disminuir el número de casos anuales que se presentan de la enfermedad en la región. Impulsar campañas que estimulen al pueblo risaraldense a realizar ejercicio periódicamente, de igual manera que lo estimulen a adquirir hábitos sanos de vida: dieta, dejar de fumar, evitar el exceso en el consumo de alcohol, recreación, practicar un deporte, conducentes a incrementar los niveles de colesterol – HDL, disminuir el colesterol total y los triacilglicéridos, al igual que disminuir la frecuencia de la hipertensión arterial. Estimular a los ministerios de salud, educación y trabajo para que realicen una campaña nacional conducente a estudiar la enfermedad y educar a la población nacional sobre el tema, con el fin de disminuir la frecuencia de la enfermedad en la población colombiana. 68
  • 69. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA TABLASTABLA No. NOMBRE PÁG. INTRODUCCIÓN Y ANTECEDENTES 1 COMPONENTES DE RIESGO CARDIOVASCULAR, 6 ESTRATIFICACIÓN DPARAPACIENTES CON HIPERTENSIÓN 2 CLASIFICACIÓN DE LA PRESIÓN ARTERIAL 6 3 ÍNDICE DE MASA CORPORAL Y GÉNERO 7 RESULTADOS 1 NACIMIENTO POR DEPARTAMENTOEN LA MUESTRA 25 ESTUDIADA 2 RESIDENCIA POR MUNICIPIO EN LA MUESTRA ESTUDIADA 26 3 DISTRIBUCIÓN DE LA POBLACIÓN POR RANGOS DE EDAD Y 26 SEXO 4 DISTRIBUCIÓN AGRUPADA DE LAS FRECUENCIAS DE 27 TALLA POR SEXO 5 DISTRIBUCIÓN DE LOS PROMEDIOS DE PESO POR RANGOS 27 DE EDAD Y SEXO 6 FRECUENCIA PORCENTUAL DEL ÍNDICE DE MASA 28 CORPORAL POR GÉNERO 7 DISTRIBUCIÓN POR GÉNERO DE LA FRECUENCIA DE 29 TENSIÓN ARTERIAL 8 DISTRIBUCIÓN POR ÁREA (RURAL Y URBANA) Y SEXO DE 30 LA FRECUENCIA PORCENTUAL DE LAS PRESIONES ARTERIALES 9 DISTRIBUCIÓN DE LOS PROMEDIOS DE COLESTEROL 31 TOTAL, COLESTEROL-LDL, COLESTEROL-HDL DISTRIBUIDOS POR EDAD Y SEXO 10 DISTRIBUCIÓN DEL PERFIL LIPÍDICO POR GÉNERO Y ÁREA 32 11 DISTRIBUCIÓN POR ESTRATO DE LOS PROMEDIOS DE 34 PERFÍL LIPÍDCO, IMC, Y TENSIÓN ARTERIAL 12 DISTRIBUCIÓN DE FRECUENCIAS DE LOS GENOTIPOS Y 35 ALELOS DE Apo E EN LA MUESTRA POBLACIONAL DE Risaralda 13 PROMEDIO DE ALGUNOS PARÁMETROS BIOQUÍMICOS Y 35 FÍSICOS DISCRIMINADOS POR GENOTIPO 14 COMPARACIÓN DE DOS GRUPOS DE EDAD (menores y 46 mayores de 35 años ) CON LA TENSIÓN DIASTÓLICA NORMA (1) Y ALTA (2) 15 COMPARACIÓN DE DOS GRUPOS DE EDAD FRENTE A LA 46 TENSIÓN SIOSTÓLICA 69
  • 70. 16 COMPARACIÓN DE DOS GRUPOS DE EDAD FRENTE AL 47 COLESTEROL NORMAL Y ALTO, PARA EL GÉNERO MASCULINO17 COMPARACIÓN DE DOS GRUPOS DE EDAD FRENTE AL 47 COLESTEROL NORMAL Y ALTO, PARA EL GÉNERO FEMENINO18 COMPARACIÓN DE DOS GRUPOS DE EDAD FRENTE A LOS 47 NIVELES DE LDL NORMALES Y ALTOS, PARA EL GÉNERO MASCULINO19 COMPARACIÓN DE DOS GRUPOS DE EDAD FRENTE A LOS 48 NIVELES DE HDL NORMALES Y ALTOS, PARA EL GÉNERO MASCULINO20 COMPARACIÓN DE DOS GRUPOS DE EDAD CON 48 TRIGLICÉRIDOS NORMALES Y ALTOS PARA EL GÉNERO FEMENINO.21 COMPARACIÓN DE DOS GRUPOS DE EDAD (menores y 48 mayores de 35 años) CON RELACIÓN A LA OBESIDAD (1, ausencia; 2, presencia)22 COMPARACIÓN DE HDLB CON OBE 4923 COMPARACIÓN DE OBE CON LOS NIVELES DE 49 COLESTEROL LDL24 COMPARACIÓN DE OBE CON LOS NIVELES DE 50 TRIGLICÉRIDOS25 COMPARACIÓN DEL GRUPO DE PERSONAS CON 50 HIPERTENSIÓN DIASTÓLICA (2) Y EL GRUPO DE OBE (2)26 COMPARACIÓN ENTRE HATS Y OBE 5027 COMPARACIÓN DE TRES SUBGRUPOS DE PERSONAS CON 57 DIFERENTES NIVELES DE HDL FRENTE A OTROS PARÁMENTROS SANGUÍNEOS28 COMPARACIÓN DE LOS DIFERENTES PARÁMETROS 58 ESTUDIADOS ENTRE LOS GRUPOS DE ALTO Y BAJO NIVEL DE hdl-COLESTEROL29 COMPARACIÓN DE ALGUNOS PARÁMETROS BIOQUÍMICOS 60 Y FÍSICOS ENTRE DOS POBLACIONES DEL GÉNERO MASCULINO: OBESOS Y NORMALES30 DISTRIBUCIÓN PORCENTUAL DE LOS GENOTIPOS PARA LA 64 Apo E EN SEIS POBLACIONES DIFERENTES31 COMPARACIÓN DE LA DISTRIBUCIÓN PORCENTUAL DE LA 66 FRECUENCIA DE LOS PARÁMETROS DEL PERFIL LIPÍDICO DE LAS POBLACIONES TURCA Y RISARALDENSE 70
  • 71. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA FIGURASRESUTADOS Figura 1 Polimorfismo de apo E. Se muestran los sitios de corte para la enzima de restricción Hha 1, los fragmentos que se generan y su separación utilizando laelectroforesis en gel de agarosa al 3%. PÁG 35 Figura 2. Correlación entre el ÍNDICE de Masa Corporal y el colesterol PAG 38 Figura 3. Correlación entre el Índice de Masa Corporal y la Tensión Arterial Sistólica PAG 39Figura 4. Correlación entre el Índice de Masa Corporal y la Tensión Arterialdiastólica PAG 39Figura 5. Correlación entre el I M C y los triacilglicéridos PAG 40Figura 6. Correlación entre la concentración de colesterol-HDL y el IMC PAG 41Figura 7. Correlación entre colesterol-HDL y peso. PAG 42Figura 8. Correlación entre la Tensión Arterial Sistólica y la edad PAG 42Figura 9. Correlación entre el IMC y la edad PAG 43Figura 10. Correlación entre la edad y los niveles de colesterol PAG 44Figura 11. Correlación entre la edad y los niveles de colesterol-LDL PAG 44Figura 12. Correlación entre la edad y los niveles de triacilglicéridos PAG 45 71
  • 72. BIBLIOGRAFÍA1 Consenso Colombiano sobre diagnostico, evaluación y manejo de las dislipoproteinemias. Boletíninformativo de la Sociedad Latinoamericana de Aterosclerosis. Capitulo Colombiano 1992: 2: 6-7.2 Instituto Municipal de Salud, Pereira- Risaralda, Estadísticas de Mortalidad Pereira febrero 10 de19973 Procceding of the conference on the decline in coronary hear disease mortality U.S. Department ofHealth Education and Welfare Public Health Service DHEW pub.79: 1610.4 Selwyn A.P. Kinlays a et al: Atherogenesis and ischemic heart disease. Am J. Cardiol. 1997;80:3-13.5 Assman G.,Gotto A.M., and Paoletti R.: The hypertriglyceridemias: Risk and management. Am. J.Cariol. 1991;68:1-4.6 Cambien F., Jacqueson A. , Richard J., Warnett J.M., Ducimetiere F., Claude J. : Is the level of serumtriglyceride a significant predictor of coronary death in “normocholesterolemic” subjects?. The Parisprospective study. Am. J. Epidemiol. 1986; 124: 624-6327 Rossovw J.E., Lewis B. et al : The valve of lowering cholesterol after myocardial infarction. N.Engl. J. Med. 1990;323:1112-11198 Gould K.L. Theoretical and practical aspects of lipids lowering therapy. Am J. Med. 1998:104;252-5959 Keys A. Seven countries. A multivariate analysis of death and coronary heart disease. Cambridge,Massachusett: Harvard university press 1980.10 Nichamen M.Z. et al: Epidemiological studies of coronary heart disease and stroke in Japanasesmen living in Japan, Hawaii and California: distribution in biochemical risk factors. Am J. Epidemiol.1975; 102:424-43411 Shaper A.G. et al: Risk factors for ischaemic heart disease: the prospective phases of the BritishRegional Heart Study. J. Epidem Comm Health 1985;39:197-209.12 Law M.R. Wald N.J. Wu T. Hackshaw A. Balley A. Systematic understimation of associationbetween serum cholesterol concentration and ischaemic heart disease in observational studies: datafrom the BUPA study Br. Med. J. 1994;308:363-36613 Rosengren A. Welin L. Tsipogianni A. Wilhelmsen L. Impact of cardiovascular risk factors oncoronary heart disease and mortality among middle aged diabetic men: a general population study Br.Med. J. 1989; 299:1127-113114 Andersen K.M. Kastelli W.P. Levy D. Cholesterol and mortality: 30 years of follow up from theFramingham study. JAMA 1987; 257:2176-2180.15 Stemmerman G.N. Chyou P.N. Kagan A. Nomura A.M. Yano K. Serum cholesterol and mortalityamong Japanase –American males:the Honolulu heart program. Arch Intern Med. 1991; 15:969-972. 72
  • 73. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA16 Watkins L.O. Neaton J.D. Kuller L.G. Racial diferences in high density lipoprotein cholesterol andcoronary heart disease incidence in the usual care group of the MRFIT. Am J. Cardiol. 1986;57:538-54517 Pocock S.I. Shaper A.G. Phillips A.N. Concentration of high density lipoprotein cholesterol,tryglycerides and total cholesterol in ischaemic heart disease . Br Med J. 1989;298:998-100218 Assmann G. Schutle H. Relation of high density lipoprotein cholesterol and tryglycerides toincidence of atherosclerotic coronary artery disease (the PROCAM experience) Am J.Cariol.1992;70:733-73719 Watts et al. Effects on coronary artery disease of lipid lowering diet, or diet plus cholestyramine inthe St Thomas. Atherosclerosis regression study (STARS). Lancet 1992;339: 563-56920 Enger S.C. et al. High density lipoprotein cholesterol and myocardial infarction and sudden coronarydeath; a prospective case-control study in middle –aged men of thje Oslo study Artery 1979;5:170-18121 Mulddon M.F. Manuck S.B. et al Lowering cholesterol concentration and martality: a quantitativereview of primary prevention trials Br Med. J. 1990; 301:309-314.22 Wilson P.W. Abbort R.D. et al HDL and mortality: the Framingham heart study Arteriosclerosis1998;8:737-74123 Castelli W.P. Epidemiology of tryglycerides: a view from Framingham. Am J. Cardiol 1992;70:3-9H24 Assman G. Schutle H. Eckardstein A. Epidemiological and clinical relevance of tryglycerides andhigh density lipoprotein cholesterol Cardiovascular Risk Factors 1995; 5(1):4-1125 Fernández M.L. Lin E.C. Mcnamara J. Regulation of guinea pig plasma Low density lipoproteinkinetics by dietary fat saturation J. Lipid Res. 1992;33:97-10926 Woollett L.A. Spady D.K. DietschyJ.M. Regulatory effects of the saturated fatty acids 6:0 through18:0 on hepatic low density lipoprotein receptor activity in the hamster J.Clin Invest1992;89:1139-114127 Powell E.E. Kroon P.A. Low density lipoprotein receptor and 3-hydroxy –3-methylglutarylcoenzyme A reductase gen expression in human mononuclear leukocytes is regulated coordinately andparallels gene expression in human liver 1994; 93:2168-217428 Lovaty M.R. Mansoni C. Canavesi M.et al Soybean protein diet increases LDL receptor activity inmononuclear cells from hypercholesterolemic patients J. Clin Invest 1987;80:1498-150229 Suarez M.A. y López C. Factores de riesgo cardiovascular en dos poblaciones diferentes. Ministeriode Salud Colombia 1995.30 Kagan A.R. Crónica de la Organización Mundial de la Salud. 1977;31:187-18831 Rose R. The pathogenesis of atherosclerosis: a perspective for the 1990s Nature 1993;362:801-809 73
  • 74. 32 Pentikainen M.O., Lethomen M.P., Kovanen P.T. Aggregation and fusion modified low densitylipoprotein. J.Lipid Res. 1996; 37:2638-264533 Kume N., Cybulsky M.N. Gimbrone N.A:: Lysophosphatidylcholine, a component of atherogeniclipoprotein, induces mononuclear leukocyte adhesion molecules in cultured human and rabbit arterialendothelial cells J. Clinical Invest. 1992; 90:1138-1144.34 KriegerM, Acton S, Askenas J, Pearsons A, Penman M, Resnick D. Molecular flypaper, hostdefense, and atjherosclerosis. Structure, binding properties, and function of scavenger receptor . J.Mol. Chem. 1993; 268:4569-4572.35 Tomita T, Ezaki M, Miva M, Nakamura K, Inoue Y. Rapid and reversible inhibition by low densitylipoprotein of the endothelium- dependent relaxation to hemostatic substances in porcine coronaryarteries. Heat and acid labile factors in low density lipoproteins mediate the inhibition. Circ. Res.1990; 66:18-2736 Hagfman M, WilhelmsenL, PennertrK, Wedel H. Factors of importance for prognosis in men withangina pectoris derived from a random population sample of Multifactor Primary Prevention Trial,Gothemburg Sweden . Am. J. Cardiol 1988; 36:1023-102837 Silagy CA, Micneil J. Epidemiologic aspects of isolated systolic hypertension and implications forfuture research Am. J. Cardiol 1992;69:213-218.38 Ravussin E, Swinburn AB, Pathophysiology of obesity Lancet 1992; 340:401-40839 Hammond L, and Garfinkel D. Correlationship in the coronary heart disease and smoking in Oslopopulation study. Am. J. Cardiol. 1989; 64:30-34.40 Austin A, Orchard J, Miller TV. Dyslipoproteinemia and diabetes Endocrinol Metab Clin North Am1990; 19: 345-380.41 Clemens SR, Bell HS. Complications of diabetes. Prevalence detection, current treatment andprognosis. Am J Med. 1985;79:2-1242 Uusitapa M, Niskanen LK; Siitonen O, VoutilainemE, and Pyorala K. Ten year cardiovascularmortality in relation to risk factor and abnormalities in lipoprotein composition in type 2 diabetes andnon diabetic subjects. Diabetologia 1993;36:1175-1184.43 Jaramillo P, Escudero C, y López M. Factores de riesgo clásicos y emergentes para enfermedadescardiovasculares MEDUNAB 1998;1:171-183.44 Salmenpera S, Siimes MA, Perheethupa J, and Miettinen TA. Apoprotein E phenotypes determineserum colesterol in infants and cardiovascular disease in parents J lipid Res 1998:39: 75-79.45 Kallio M, Salmenpera S, Siimes MA, Perheethupa J, and Miettinen TA. Apoprotein E phenotypesdetermine serum cholesterol in infants during both high – cholesterol breast feeding and lowcholesterol formula feeding and cardiovascular disease in parents J lipid Res 1997:38: 750-764. 74
  • 75. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA46 Laasko M,Kesaniemi A, Kervinen K,Jauhiainen M, Pyorala K. Relation of coronary Herat diseaseand apolipoprotein E phenotype in patients with non insulin dependent dfiabetes. Diabetes1997;46:125-132.47 Fki I,V, Khun K, Lomazov R, Rothman VI, Tuzinski JP, Iozzo RV, Swenson TL, Fisher EA,Willaiams AJ. The synsecan family of proteoglycans. Novel receptors mediating internalization ofatherogenic lipoproteins in vitro. J. Clinic Invest. 1997; 100:1611-1622.48 Cushing SD, Berliner JA, Valente AJ, Territo MC, Navad M. Minimally modified low densitylipoprotein induced monocyte chemotactic protein I in human endothelial cells, and smooth musclecells. Proc. Natl Acad. Sci. USA. 1990;87:5134-513849 Mahley RW, Palaoglu EK, Atak Z, Daweson-Pepin J, Langlois AM, Cheung V, nat H, Fulks P,Malhey L, Vakar F, Ozbayraket S, Gokdemir O, and Winkler W. Turkish Heart Study: lipids,lipoproteins and apolipoproteins. J. Lipid Res. 1995;36:839-85950 Sijbrands EJ, Hoffer MJ, Meinders AE, Havekes LM, Frants RR, Smell AH, and De Knijff P. Sverehyperlipidemia in apolipoprotein E2 momozygotes due to a combined effect of hyperinsulinemia andan Sstl polymorphism. Arterioscler Thromb Vasc Biol 1999,19:2722-2729.51 Inerarity TL, et al. Familial defective apolipoprotein B-100: a mutation of apolipoprotein B thatcauses hipercolesterolemia J. Lipid Res. 1990;31:1337-1349.52 Hixson JE, and Vernier DT. Restriction isotyping of human apolipoprotein E by gene amplificationand cleavage with Hha 1. J. Lipid. Res 1990;31:545-548.53 . Gordon D.J. , and B.M.Rifkin. High density lipoprotein. The clinical implications of recent studies. N.Engl. J. Med. 1989: 231:131154 Jonson W.J., F.H. Mahlberg, G.H. Rothblat, and M.C. Phillips. Cholesterol transport between cellsand high density lipoproteins. Biochim. Biophys. Acta 1991. 1085: 273-298.55 Glomset J.A. The plasma lecithin: cholesterol acyl transferase. J. Lipid Res. 1968. 9: 155-167.56 Tall A.R. Plasma cholesteryl ester transfer protein. J. Lipid Res. 1993. 34: 1266-1274.57 Gwynne J.T. and j.f. Strauss . The role of lipoproteins in steroid genesis and cholesterolmetabolism in steroidogenic glands. Endocr. Rev. 1982. 3: 299-329.58 Fielding C.J. and P.E. Fielding . Molecular physiology of reverse cholesterol transport. J. Lipid. Res.1995. 36: 211-223.59 Gwynne J. T.and D.D .Mahafee. Rat adrenal uptake and metabolism of high density lipoproteinscholestryl ester. J. Biol. Chem. 1989: 264: 8141-8150.60 Brissette L., L.Falstrault, L. Lafond and L. Izem. The selective uptake of the cholesteryl esters oflow density lipoproteins parallels the activity of protein kinase C. Biochim. Biophys. Acta. 1996.1301: 133-140. 75
  • 76. 61 Barbaras R., X. Collet, H. Chap, and B. Perret. Specific binding of free apolipoproteins AI to a high– affinity binding site on HepG2 cells: characterization of two high density lipoproteins sites.Biochemistry 1994. 33: 2335-2340.62 Krieger M.,and J.Hertz. Structures and functions of multiligand lipoprotein receptor: macrophagescavenger receptors and LDL- receptor – related protein (LRP)Annu. Rev. Biochem. 1994. 63:601-657.63 Walsh A., Y. Ito and J.L. Breslow. High levels of human apolipoprotein A-I in transgenic miceresult in increased plasma levels of small high density lipoprotein particles comparable to humanHDL3. J. Biol. Chem. 1989. 264: 6488-6493.64 Rubin E.M., B.Y. Ishida , S.M. Clioft and R.M. Krauss. Expression of human apolipoprotein A-Iintransgenic mice results in reduced plasma levels of murine apolipoprotein A-I and the appearance oftwo new high density lipoprotein size subclasses. Proc. Natl. Acad. Sci. USA. 1991. 88: 434-438.65 Plump A.S., E.R. Erickson, W. Fong, J.S. Partin, J.L. Breslow and D.L. Williams. ApolipoproteinA-I is required for cholesryl ester accumulation in steroidogenic cells and for normal adrenal steroidproduction. J. Clin. Invest. 1996. 97: 2660-2671.66 Acton S., A. Rigotu, K. Landshulz , S. Xu, H.H. Hobbs, and M. Krieger. Identification of scavengerreceptor SR-B1 as a high density lipoprotein receptor. Science 1996. 271: 518-520.67 Wang N. ,W.Weng, J.L. Breslow. Scavenger receptor B1 (SR-B1) is up regulated in adrenal glandin apolipoprotein A-I and hepatic lipase knockout mice as a response to depletion of cholesterolstores. In vivo evidence that SR-B1 is a functional high density lipoprotein recptor under feedbackcontrol J. Biol Chem 1996.271:21001-21004.68 Rigotti, A., E.R. Edelman, P.Seiferl, R.B. DeMatos, R.E. Temel, M. Krieger and D. Williams.Regulation by adrenocorticotropic hormone of the in vivo expression of scavenger receptor class Btype I (SR-B1), a high density lipoprotein receptor of steroidogenic cells of the murine adrenal gland.J. Biol. Chem. 1996. 271:33545-33549.69 Acton S.L., P.E. Scherer, H.F. Lodish and M. Krieger. Expression cloning of SR-B1a CD36 relatedclass B scavenger receptor J.Biol.Chem. 1994. 269: 21003-21009.70 Segrest J.P., M.K. Jones, H. DeLoof, C.G. Brouillete and G.M. Anantharamaiah. The anphipatichelix in the exchangeable apolipoproteins: a review of secondary structure and function. 1992. J.Lipid Res. 33: 141-166.71 Mendez A.J., G.M. Anantharamaiah, J.P. Segrest and J.F. Oram. Synthetic amphipatic helicalpeptides that mimic apolipoprotein A I in clearing cellular cholesterol. J. Clinic. Invest. 1994. 94:1698-1705.72 Rimminger F., M. Brundert, S. Jackle, T. Kaiser, and H. Greten. Selective uptake of low densitylipoprotein associated cholesteryl ester by human fibroblasts, human HepG2 hepatoma cells and J774macrophages in culture. Biochim. Biophys. Acta. 1995. 1255: 141- 160. 76
  • 77. FACTORES DE RIESGO CARDIOVASCULAR EN LA POBLACIÓN DE RISARALDA73 Mcvicar J.F., S.T. Kunikate, R.L. Hamilton, and J.P. Kane. Characteristics of human lipoproteinisolated by selected affinity inmunosorption of apolipoprotein A-I. Proc. Natl. Acad. Sci. USA. 1984.81: 1356-1360.74 Melchior G., and C. Castle. Apolipoprotein A-I metabolism in cynomolgus monkey. Identificationand characterizationof beta – migrating pools. Arteriosclerosis 1989. 9: 470-478.75 Kawano M., T. Miida, C.J. Fielding, and P.E. Fielding. Quantitation of pre beta HDL dependent andnon specific components of the total efflux of cellular cholesterol and phospholipids. Biochemistry1993. 32: 5025-5028.76 Francone O.L., E.L. Gong, D.S.Ng, C.J. Fielding, and E.M. Rubin. Expression of human lecithincholesterol acyltransferase in transgenic mice. Effect of human apoliprotein A-I and human A-II onplasma lipoproteins cholesterol metabolism.. J. Clinic Invest. 1995. 96: 1440-1448.77 Kozarsky K.F., M.H. Donahee, A.Rigotti, S.N., Igbsal, E.R. Edelman, and M. Keiger.Overexpression of the HDL receptor SR-B1 alters plasma HDL and bile cholesterol levels. Nature.1997:387: 414-41778 Nishida H.L., and T. Nishida. Phospholipid transfer protein mediates transfer of not onlyphosphatildylcholine cholesterol vesicles to high density lipoproteins. J. Biol. Chem. 1997. 272:6959-6964.79 Niida T., Y. Nakamura, K.Inano, T. Matsuto, T. Yamaguichi, T. Tsuda, and M. Okada. Pre-beta 1high density lipoprotein increased in coronary artery disease Clin. Chem. 1996. 42: 1992-1995.80 Rosenbaun M, Leíbel RL. Pathophysiology of childbood obesity. Adv. Pediatr. 1988;35:73-137.81 Stunkard AJ,Sorensen AL, Hains C, et. al. An adoption study of human obesity. N.Engl. J. Med.1988;314:193-198.82 Considine RV, Sinha MK, Helman ML, et al. Serun inmuinoreactive leptin concentrations innormal weight and obese humans. N. Engl. J. Med. 1996;334:292-295.83 Clément K, Garner C, Guy-Grand B. Indication for linkage of the human ob gene region withextreme obesity. Diabetes 1996;45:687-690.84 Caro JF, Sinha MK, Kolaazynski JW. Leptin: the tale of an obesity gene.Diabetes 1996;45:I,455-I,462.85 Cusin I, Sainsbury A, Doyle P, et al. The ob gene and insulin: a relationship leading to the clues tothe understanding of obesity. Diabetes 1995;44: 467-470.86 Haffner SM, Stern MP, Miettinen H. Leptin concentrations in dibetic and no diabetic MexicansAmericans. Diabetes. 1996; 45:822-824.87 Cunin F, Baum HP, Levens N, et al. Kidney is the major site of plasma leptin clearance. ObesityRes. 1996; 4 (supl I) :38-44- 77
  • 78. 88 Chen H, Charlat O, Morgernstern JP. Evidence that the diabetes gene encodes the leptin receptor:identification of the mutation of receptor gene in db/db mice. Cell. 1996; 84: 491-495.89 Lee GH, Proenca R, Friedman J. Abnormal splicing of the leptin receptor in diabetic mice. Nature1996; 379: 632-63490 Stanley BG. Neuropeptide Y in múltiple hipotalamic sites control eating behaivor, endocrine, andautonomic sistems for energy balance. The biology of neuropeptide Y and related peptides: 457 509,Humana, Totowa NJ.91 Shwartz MW, Baskin DG, Weigle DS. Specificity of leptin action of elevated blood glucose levelesand hipotalamic neuropeptide Y gene expression in ob/ob mice. Diabetes 1996; 45:531-535.92 Kiefer TJ, Séller RS, Habener JF. Leptin receptor expressed of pancreatic beta-cells.Biochem.Biophys. Res. Commun 1996;269:545-549.93 Cuatrecasas G, Granada ML, Formiguera X, et al Increased leptin production in vivo and insulincleavage by the epiploic adipose tissue of morbid obese patients. Clin. Endocrinol. 1998; 48: 181-185.94 Riquier D, Mory G, Factors affecting brown Adipose Tissue in animals and men. Clin. Endocrinol.Metab. 1984;13:502-519.95 Mahley RW, and Ji ZS. Remanente lipoprotein metabolism: key pathway involving cell surfaceheparan sulfate proteoglycans and apolipoprotein E. J. Lipid Res. 1999; 40: 1-16.96 Pitas RW, Boyles JK, Lee SH, Hui DY, andd Weisgraber KH. Lipoproteins and their receptors inthe nervous central system. Characterization of the lipoproteins in cerebrospinal fluid of identificationof apolipoprotein B,E(LDL) receptors in the brain. J.Biol. Chem. 1987;262:14352-14360.97 Davignon J, Gregg, RE, and Sing GE. Apoliprotein E polymorphism and atherosclerosis.Arteriosclerosis 1988; 8: 1-12.98 Maagdenberg van den, Hodker MH, Krinpenford JA. et al. Transgenic mice carrying theapolippprotein E—I eiden gene exhibit hyperlipoproteinemia. J. Biol. Chem. 1993; 268: 10510-10515.99 Salab D, Bohner R, Gueguen R, Siest G, and Visvikis S. Combined effects of lipoprotein lipase andapoplipoprotein E polymorphisms on lipid and lipoproteins levels in the Stalinslab cohort. J. Lipid.Res. 1997;38: 901-912.100 Johnson CL, Rifkin BM, Sempos CT, Carrol MD, Bachorik PS, et al. Declining serum cholesterollevels among US adults The National Health and Nutrition Examination Surveys. J. Am. Med.Associ. 1993; 269: 3002-3008 78

×