Acidos Nucleicos

37,471 views
37,239 views

Published on

Published in: Travel, News & Politics
2 Comments
20 Likes
Statistics
Notes
  • porque no me abre en mi power point el mio es 2010, porque cuando lo descargo no quiere abrir y me sale error?? que puedo hacer?
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • okei bakano
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
No Downloads
Views
Total views
37,471
On SlideShare
0
From Embeds
0
Number of Embeds
26
Actions
Shares
0
Downloads
1,225
Comments
2
Likes
20
Embeds 0
No embeds

No notes for slide

Acidos Nucleicos

  1. 1. Ácidos Nucleídos<br />Alexandra Castaño<br />Sindy Zapata<br />Univesidad Santiago de Cali<br />
  2. 2. Descubrimiento<br /><ul><li>El descubrimiento de los ácidos nucleícos se debe a Friedrich Miescher, quien en el año 1869 aisló de los núcleos de las células una sustancia ácida a la que llamó nucleína, nombre que posteriormente se cambió a ácido nucleico.</li></li></ul><li>¿ Que son ?<br /><ul><li>Son macromoléculas constituidas por nucleótidos encadenados, que se encuentran en las células de todos los seres vivos y en los virus. Se unen mediante enlaces fosfodiéster, que se produce entre un grupo hidroxilo (–OH)en el carbono 3' y un grupo fosfatoH3PO4.</li></li></ul><li>Componentes: Los Nucleótidos<br />Son las unidades estructurales de los ácidos nucleicos. Están<br />compuestos por:<br /><ul><li>Una base nitrogenada BN
  3. 3. Un azúcar o pentosa A P A BN
  4. 4. Un acido fosfórico P</li></ul>Están formados por la unión de bioelementos tales como:<br />C ,H ,O, N, P<br />
  5. 5. Estructura de un NUCLEOTIDO<br />A<br />P<br />BN<br />Fosfoester<br />N-glicosidico<br />
  6. 6. Diferencia entre:<br />Es la molécula resultante de la unión entre la pentosa y una base nitrogenada.<br />Es un compuesto monomérico formado por una base nitrogenada, una pentosa y un grupo fosfato.<br />Nucleósido<br />Nucleótido<br />
  7. 7. Componentes de un NUCLEOTIDO<br />Pentosa puede ser:<br /><ul><li>Dexosirribosa
  8. 8. Ribosa</li></ul>Las bases nitrogenadas pueden ser:<br /><ul><li>Adenina A
  9. 9. CitosinaC
  10. 10. Guanina G
  11. 11. Timina T
  12. 12. UraciloU</li></li></ul><li>Azucares o Pentosas<br />El azúcar que interviene en los nucleótidos puede ser o la ribosa (R) o<br />la desoxirribosa (DR). <br />Conviene destacar que la única diferencia entre ambas está en que en<br />el carbono 2 de la desoxirribosa hay un hidrógeno (-H) en lugar del<br />grupo alcohol (-OH).<br />
  13. 13. Bases Nitrogenadas<br />Las bases nitrogenadas son parte fundamental de los nucleótidos. Biológicamente, existen sólo cinco bases nitrogenadas divididas en dos tipos, purinas y pirimidinas. <br />Citosina<br />Timina<br />Uracilo<br />Adenina<br />Guanina<br />Pirimidinas<br />Purinas<br />
  14. 14. ¿Cuales son?<br />Los Ácidos nucleídos están representados por: <br />ADN<br />ARN<br />Acido Ribonucleico: actúan<br />como transmisores de dicha<br />información (ARN mensajero),<br />como componentes de los<br />ribosomas (ARN ribosomal) o<br />como transferidores de<br />aminoácidos (ARN de<br />transferencia)<br />Acido desoxirribonucleicos : son<br />los almacenadores de la<br />información biológica<br />
  15. 15. AcidoDexosirribonucleico ADN<br />Todas las células vivas codifican el material genético en forma de<br />ADN, ácido nucleíco contenido en los cromosomas de las células y<br />portador de la información genética (gen). <br />La estructura de la doble hélice constituye la base para la<br />Transmisión inalterable de los genes a través de millones de<br />generaciones de células, ya que las cadenas de ADN tienen la<br />propiedad de autoduplicarse para formar moléculas hijas<br />idénticas (replicación). <br />
  16. 16. ADN<br />La secuencia de bases el ADN (código genético) contiene la<br />Información genética para la síntesis de proteínas. A partir del <br />ADN se sintetizan moléculas complementarias de ARNm (ácido <br />ribonucleico mensajero) en el proceso denominado<br />transcripción. <br />Cada uno de estos nucleótido se halla unido covalentemente,<br />Por medio de su grupo fosfato, a la ribosa del nucleótido<br />Contiguo (puente fosfodiéster entre el grupo hidróxilo 5' de un <br />nucleótido y el 3‘Del siguiente).<br />
  17. 17. ADN<br />Se pueden distinguir 3 niveles estructurales:<br /><ul><li>Estructura primaria: La secuencia de los nucleótidos.
  18. 18. Estructura secundaria: La doble hélice.
  19. 19. Estructura terciaria: Collar de perlas, estructura cristalina, ADN superenrollado.</li></li></ul><li>Estructura PRIMARIA DEL ADN:<br /><ul><li>Es la secuencia de nucleótidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucleótidos en la hebra o cadena de la molécula.
  20. 20. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotídica.</li></ul>Así, por ejemplo:<br /> 5'ACGTTTAACGACAAGGACAAGTATTAA3'<br />
  21. 21. Estructura secundaria del adn:<br />La concentración de Adenina es igual a la de Timina, y la de Citosina a la de Guanina. <br />Los grupos fosfato estarían hacia el exterior y de este modo sus cargas negativas interaccionarían con los cationes presentes en el nucleoplasma dando más estabilidad a la molécula.<br />Las dos primeras establecen dos puentes de hidrógeno entre ellas, y las últimas tres puentes. <br />La cantidad de purinas es igual a la cantidad de pirimidinas.<br />Ambas cadenas serían antiparalelas, una iría en sentido 3‘-5' y la otra en sentido inverso, 5' - 3'.<br />
  22. 22. EstructuraSecundaria<br />
  23. 23. Estructura Terciaria<br />Se encuentra súper empaquetada , ocupando así menos espacio en el núcleo celular , y además como mecanismo para facilitar su transcripción; En las células eucariotas el ADN se encuentra en el núcleo asociado a ciertas proteínas: formando la cromatina (Constituye el Cromosoma).<br />
  24. 24. Replicación del ADN<br />Proceso mediante el cual el ADN se copia para poder ser transmitido a nuevos individuos. Y <br />es fundamental para la descendencia genética.<br />Síntesis por la DNA-polimerasa de la hebra conductora (izquierda) y de la hebra seguidora en fragmentos de la derecha.<br />Unión de todos los fragmentos por la DNA-ligasa<br />Formación de una horquilla de replicación<br />
  25. 25. Acido Ribonucleico ARN <br />El ARN es un filamento de una sola cadena, no forma doble hélice. En el ARN hay cuatro bases nitrogenadas: adenina, guanina - citosina, y uracilo. Los ácidos ribonucleicos se encuentran en el núcleo celular, en el citoplasma y en los ribosomas de todos los seres vivos. <br />Ciertos tipos de ARN tienen una función diferente y toman parte en la síntesis de las proteínas que una célula produce.<br />
  26. 26. Clases de ARN<br /><ul><li>ARNm: (Mensajero) Codifica la secuencia de aminoácido de un polipéptido. (5%)
  27. 27. ARNt(Transcripción) Lleva los aminoácidos a los ribosomas durante la traducción. (80%)
  28. 28. ARNr(Ribosomatico) Con proteínas ribosomales y los ribosomas actúan con el ARNm. Forman los ribosomas (15%)
  29. 29. ARNnp(nuclear pequeño): Con proteínas, forma complejos que son usados en el proceso de ARN en las células eucarióticas (no se encuentra en las células procarióticas).</li></li></ul><li>ARN Mensajero<br /><ul><li>Su función es transportar la información de un gen a la maquinaria (Ribosoma) que sintetiza proteínas donde actúan como molde para formar una secuencia especifica de aminoácidos y así, formar una molécula de proteína especifica, producto ultimo de un gen. </li></ul>ARN Transcripción<br /><ul><li>Transportaaminoácidos a los ribosomas para incorporarlos a las proteínas y realizar así la síntesis</li></li></ul><li>Sintesis de Proteina<br />Es el proceso mediante el cual anabólicamente se forman las proteínas a partir de los nucleótidos.<br />Las proteínas sirven para enviar información , formar estructuras, y almacenar sustacias., y sirven para favorecer reacciones metabólicas.<br />
  30. 30. Cuadro comparativo entre el ADN y el ARN<br />
  31. 31. Cromosomas<br />Son los portadores de la mayor parte del material genético y condicionan la organización de la vida y las características hereditarias de cada especie, formado por la cromatina que es un material microscópico que lleva la información genética de los organismos eucariotas y está constituida por ADN asociado a proteínas especiales llamadas histonas. <br />
  32. 32.
  33. 33. Enfermedades<br />Cromosoma 6: <br />Ataxia espinocerebelosa<br />Diabetes<br />Hperplasia adrenal congénita por deficiencia de 21<br />hidroxilasa<br />Epilepsia<br />Hemocromatosis <br />Síndrome de Zellweger<br />Cromosoma 17: <br />Algunas enfermedades asociadas a mutaciones del cromosoma 17 son: <br />Cáncer de mama, <br />Enfermedad de Charcot-Marie-Tooth<br />Cromosoma 1: Enfermedad de Alzheimer Enfermedad de GaucherCáncer de próstataGlaucomaPorfiria cutánea tardía<br />Cromosoma X:<br />Hemofilia<br />Distrofia muscular de Duchenne<br />Síndrome de Rett<br />Síndrome de Lesh-Nyhan<br />Síndrome de Alport<br />Cromosoma 9: <br />Ataxia de Friedrich<br />Enfermedad de Tangier<br />Melanoma maligno<br />Esclerosis tuberosa<br />Cromosoma Y: <br />Azospermia,<br />Disgenesia gonadal<br />
  34. 34. Hemofilia<br />Consiste en la dificultad de la sangre para coagularse adecuadamente. Se caracteriza por la aparición de hemorragias internas y externas debido a la deficiencia parcial de una proteína coagulante denominada globulina antihemofílica (factor de coagulación).<br />Sindrome de Rett<br />Pueden observarse graves retrasos en la adquisición del lenguaje y en la adquisición de la coordinación motriz. A menudo, está asociado con retraso mental grave o leve. La pérdida de las capacidades es por lo general persistente y progresiva.<br />
  35. 35. Importancia Biologica<br />Pueden sufrir cambios o mutaciones, lo cual permite la evolución continua de los seres vivos. Las especies que tienen estructuras y funciones similares quizás tengan un origen o antecesor común.<br />Principalmente se encuentran en el<br />núcleo celular, contienen los genes<br />responsables de los rasgos biológicos<br />y son capaces de transmitirlos de una<br />generación a otra. También se<br />encuentran libres en las células.<br />Constituyen la base de los cromosomas y el fundamento de la forma de expresarse la información genética en la síntesis de las proteínas de cada individuo.<br />La utilización de técnicas para comparar ácidos nucleicos permiten determinar el parentesco familiar y la investigación.<br />
  36. 36. Otros Nucleótidos importantes<br />Coenzima A<br />Derivado de un nucleótido de Adenina. Tiene <br />3 grupos P y es de carácter funcional<br />CoA-SH <br />ATP<br />Almacena y libera energía, gracias a<br />Los enlaces fosfatos. Se le conoce<br />Como Moneda de intercambio<br />energético.<br />
  37. 37. Importante para Recordar…!! <br />Los polinucleótidos son polímeros de nucleótidos que presentan extremos 5’ y 3’.<br />La información genética de cada célula somática es prácticamente idéntica. La distinción entre una célula cerebral, muscular o hepática depende del patrón de genes expresados en estas células, las así llamada expresión especifica de tejido.<br />
  38. 38. Graciias!! ^^<br />

×