• Like
Acidos Nucleicos
Upcoming SlideShare
Loading in...5
×

Acidos Nucleicos

  • 32,171 views
Uploaded on

 

More in: Travel , News & Politics
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
  • porque no me abre en mi power point el mio es 2010, porque cuando lo descargo no quiere abrir y me sale error?? que puedo hacer?
    Are you sure you want to
    Your message goes here
  • okei bakano
    Are you sure you want to
    Your message goes here
No Downloads

Views

Total Views
32,171
On Slideshare
0
From Embeds
0
Number of Embeds
18

Actions

Shares
Downloads
981
Comments
2
Likes
17

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Ácidos Nucleídos
    Alexandra Castaño
    Sindy Zapata
    Univesidad Santiago de Cali
  • 2. Descubrimiento
    • El descubrimiento de los ácidos nucleícos se debe a Friedrich Miescher, quien en el año 1869 aisló de los núcleos de las células una sustancia ácida a la que llamó nucleína, nombre que posteriormente se cambió a ácido nucleico.
  • ¿ Que son ?
    • Son macromoléculas constituidas por nucleótidos encadenados, que se encuentran en las células de todos los seres vivos y en los virus. Se unen mediante enlaces fosfodiéster, que se produce entre un grupo hidroxilo (–OH)en el carbono 3' y un grupo fosfatoH3PO4.
  • Componentes: Los Nucleótidos
    Son las unidades estructurales de los ácidos nucleicos. Están
    compuestos por:
    • Una base nitrogenada BN
    • 3. Un azúcar o pentosa A P A BN
    • 4. Un acido fosfórico P
    Están formados por la unión de bioelementos tales como:
    C ,H ,O, N, P
  • 5. Estructura de un NUCLEOTIDO
    A
    P
    BN
    Fosfoester
    N-glicosidico
  • 6. Diferencia entre:
    Es la molécula resultante de la unión entre la pentosa y una base nitrogenada.
    Es un compuesto monomérico formado por una base nitrogenada, una pentosa y un grupo fosfato.
    Nucleósido
    Nucleótido
  • 7. Componentes de un NUCLEOTIDO
    Pentosa puede ser:
    • Dexosirribosa
    • 8. Ribosa
    Las bases nitrogenadas pueden ser:
  • Azucares o Pentosas
    El azúcar que interviene en los nucleótidos puede ser o la ribosa (R) o
    la desoxirribosa (DR).
    Conviene destacar que la única diferencia entre ambas está en que en
    el carbono 2 de la desoxirribosa hay un hidrógeno (-H) en lugar del
    grupo alcohol (-OH).
  • 13. Bases Nitrogenadas
    Las bases nitrogenadas son parte fundamental de los nucleótidos. Biológicamente, existen sólo cinco bases nitrogenadas divididas en dos tipos, purinas y pirimidinas.
    Citosina
    Timina
    Uracilo
    Adenina
    Guanina
    Pirimidinas
    Purinas
  • 14. ¿Cuales son?
    Los Ácidos nucleídos están representados por:
    ADN
    ARN
    Acido Ribonucleico: actúan
    como transmisores de dicha
    información (ARN mensajero),
    como componentes de los
    ribosomas (ARN ribosomal) o
    como transferidores de
    aminoácidos (ARN de
    transferencia)
    Acido desoxirribonucleicos : son
    los almacenadores de la
    información biológica
  • 15. AcidoDexosirribonucleico ADN
    Todas las células vivas codifican el material genético en forma de
    ADN, ácido nucleíco contenido en los cromosomas de las células y
    portador de la información genética (gen).
    La estructura de la doble hélice constituye la base para la
    Transmisión inalterable de los genes a través de millones de
    generaciones de células, ya que las cadenas de ADN tienen la
    propiedad de autoduplicarse para formar moléculas hijas
    idénticas (replicación).
  • 16. ADN
    La secuencia de bases el ADN (código genético) contiene la
    Información genética para la síntesis de proteínas. A partir del
    ADN se sintetizan moléculas complementarias de ARNm (ácido
    ribonucleico mensajero) en el proceso denominado
    transcripción.
    Cada uno de estos nucleótido se halla unido covalentemente,
    Por medio de su grupo fosfato, a la ribosa del nucleótido
    Contiguo (puente fosfodiéster entre el grupo hidróxilo 5' de un
    nucleótido y el 3‘Del siguiente).
  • 17. ADN
    Se pueden distinguir 3 niveles estructurales:
    • Estructura primaria: La secuencia de los nucleótidos.
    • 18. Estructura secundaria: La doble hélice.
    • 19. Estructura terciaria: Collar de perlas, estructura cristalina, ADN superenrollado.
  • Estructura PRIMARIA DEL ADN:
    • Es la secuencia de nucleótidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucleótidos en la hebra o cadena de la molécula.
    • 20. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotídica.
    Así, por ejemplo:
    5'ACGTTTAACGACAAGGACAAGTATTAA3'
  • 21. Estructura secundaria del adn:
    La concentración de Adenina es igual a la de Timina, y la de Citosina a la de Guanina.
    Los grupos fosfato estarían hacia el exterior y de este modo sus cargas negativas interaccionarían con los cationes presentes en el nucleoplasma dando más estabilidad a la molécula.
    Las dos primeras establecen dos puentes de hidrógeno entre ellas, y las últimas tres puentes.
    La cantidad de purinas es igual a la cantidad de pirimidinas.
    Ambas cadenas serían antiparalelas, una iría en sentido 3‘-5' y la otra en sentido inverso, 5' - 3'.
  • 22. EstructuraSecundaria
  • 23. Estructura Terciaria
    Se encuentra súper empaquetada , ocupando así menos espacio en el núcleo celular , y además como mecanismo para facilitar su transcripción; En las células eucariotas el ADN se encuentra en el núcleo asociado a ciertas proteínas: formando la cromatina (Constituye el Cromosoma).
  • 24. Replicación del ADN
    Proceso mediante el cual el ADN se copia para poder ser transmitido a nuevos individuos. Y
    es fundamental para la descendencia genética.
    Síntesis por la DNA-polimerasa de la hebra conductora (izquierda) y de la hebra seguidora en fragmentos de la derecha.
    Unión de todos los fragmentos por la DNA-ligasa
    Formación de una horquilla de replicación
  • 25. Acido Ribonucleico ARN
    El ARN es un filamento de una sola cadena, no forma doble hélice. En el ARN hay cuatro bases nitrogenadas: adenina, guanina - citosina, y uracilo. Los ácidos ribonucleicos se encuentran en el núcleo celular, en el citoplasma y en los ribosomas de todos los seres vivos.
    Ciertos tipos de ARN tienen una función diferente y toman parte en la síntesis de las proteínas que una célula produce.
  • 26. Clases de ARN
    • ARNm: (Mensajero) Codifica la secuencia de aminoácido de un polipéptido. (5%)
    • 27. ARNt(Transcripción) Lleva los aminoácidos a los ribosomas durante la traducción. (80%)
    • 28. ARNr(Ribosomatico) Con proteínas ribosomales y los ribosomas actúan con el ARNm. Forman los ribosomas (15%)
    • 29. ARNnp(nuclear pequeño): Con proteínas, forma complejos que son usados en el proceso de ARN en las células eucarióticas (no se encuentra en las células procarióticas).
  • ARN Mensajero
    • Su función es transportar la información de un gen a la maquinaria (Ribosoma) que sintetiza proteínas donde actúan como molde para formar una secuencia especifica de aminoácidos y así, formar una molécula de proteína especifica, producto ultimo de un gen.
    ARN Transcripción
    • Transportaaminoácidos a los ribosomas para incorporarlos a las proteínas y realizar así la síntesis
  • Sintesis de Proteina
    Es el proceso mediante el cual anabólicamente se forman las proteínas a partir de los nucleótidos.
    Las proteínas sirven para enviar información , formar estructuras, y almacenar sustacias., y sirven para favorecer reacciones metabólicas.
  • 30. Cuadro comparativo entre el ADN y el ARN
  • 31. Cromosomas
    Son los portadores de la mayor parte del material genético y condicionan la organización de la vida y las características hereditarias de cada especie, formado por la cromatina que es un material microscópico que lleva la información genética de los organismos eucariotas y está constituida por ADN asociado a proteínas especiales llamadas histonas.
  • 32.
  • 33. Enfermedades
    Cromosoma 6:
    Ataxia espinocerebelosa
    Diabetes
    Hperplasia adrenal congénita por deficiencia de 21
    hidroxilasa
    Epilepsia
    Hemocromatosis
    Síndrome de Zellweger
    Cromosoma 17:
    Algunas enfermedades asociadas a mutaciones del cromosoma 17 son:
    Cáncer de mama,
    Enfermedad de Charcot-Marie-Tooth
    Cromosoma 1: Enfermedad de Alzheimer Enfermedad de GaucherCáncer de próstataGlaucomaPorfiria cutánea tardía
    Cromosoma X:
    Hemofilia
    Distrofia muscular de Duchenne
    Síndrome de Rett
    Síndrome de Lesh-Nyhan
    Síndrome de Alport
    Cromosoma 9:
    Ataxia de Friedrich
    Enfermedad de Tangier
    Melanoma maligno
    Esclerosis tuberosa
    Cromosoma Y:
    Azospermia,
    Disgenesia gonadal
  • 34. Hemofilia
    Consiste en la dificultad de la sangre para coagularse adecuadamente. Se caracteriza por la aparición de hemorragias internas y externas debido a la deficiencia parcial de una proteína coagulante denominada globulina antihemofílica (factor de coagulación).
    Sindrome de Rett
    Pueden observarse graves retrasos en la adquisición del lenguaje y en la adquisición de la coordinación motriz. A menudo, está asociado con retraso mental grave o leve. La pérdida de las capacidades es por lo general persistente y progresiva.
  • 35. Importancia Biologica
    Pueden sufrir cambios o mutaciones, lo cual permite la evolución continua de los seres vivos. Las especies que tienen estructuras y funciones similares quizás tengan un origen o antecesor común.
    Principalmente se encuentran en el
    núcleo celular, contienen los genes
    responsables de los rasgos biológicos
    y son capaces de transmitirlos de una
    generación a otra. También se
    encuentran libres en las células.
    Constituyen la base de los cromosomas y el fundamento de la forma de expresarse la información genética en la síntesis de las proteínas de cada individuo.
    La utilización de técnicas para comparar ácidos nucleicos permiten determinar el parentesco familiar y la investigación.
  • 36. Otros Nucleótidos importantes
    Coenzima A
    Derivado de un nucleótido de Adenina. Tiene
    3 grupos P y es de carácter funcional
    CoA-SH
    ATP
    Almacena y libera energía, gracias a
    Los enlaces fosfatos. Se le conoce
    Como Moneda de intercambio
    energético.
  • 37. Importante para Recordar…!!
    Los polinucleótidos son polímeros de nucleótidos que presentan extremos 5’ y 3’.
    La información genética de cada célula somática es prácticamente idéntica. La distinción entre una célula cerebral, muscular o hepática depende del patrón de genes expresados en estas células, las así llamada expresión especifica de tejido.
  • 38. Graciias!! ^^