Your SlideShare is downloading. ×
0
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
hSMC2, novel transcriptional target of Wnt signaling pathway
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

hSMC2, novel transcriptional target of Wnt signaling pathway

295

Published on

Lucía Suárez' predoctoral presentation at the 6th VHIR Scientific Session. Watch the video of the presentation after the last slide.

Lucía Suárez' predoctoral presentation at the 6th VHIR Scientific Session. Watch the video of the presentation after the last slide.

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
295
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
6
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. hSMC2, novel transcriptionaltarget of Wnt signaling pathway Lucía Suárez-López Drug delivery and targeting unit CIBBIM-Nanomedicine VHIR meeting 2012
  • 2. Colon cancer progression model Adapted from Davies, R. J., et al. 2005.
  • 3. Colon cancer progression model Pathway members altered in 90% of CRC Adapted from Davies, R. J., et al. 2005.
  • 4. Wnt pathway along the colon crypt WNT OFF WNT ON Wnt ligands
  • 5. Wnt pathway along the colon crypt WNT OFF WNT ON Aberrant crypt foci Tumorogenesis initiation Wnt ligands
  • 6. Wnt pathwayOFF
  • 7. Wnt pathwayOFF ON C-MYC, Cyclin D
  • 8. SMC family: Structural Maintenance of Chromosomes ATPases highly conserved along evolution Arqueobacteria  Mammals Responsible for Higher-order chromosome organization and dynamics SMC2 & SMC4 = Condensin Complex SMC2 SMC4 SMC core members Non-SMC regulatory subunits • Condensin I • Condensin II Tatsuya Hirano, 2010
  • 9. SMC family: Structural Maintenance of Chromosomes ATPases highly conserved along evolution Arqueobacteria  Mammals Responsible for Higher-order chromosome organization and dynamics SMC2 & SMC4 = Condensin Complex SMC2 SMC4 SMC core members Non-SMC regulatory subunits • Condensin I • Condensin II Introduces positive supercoilings into DNA DNA Tatsuya Hirano, 2010
  • 10. Condensin complex is upregulated in CRC • QPCR on CRC samples SMC2 CAP-G CAP-G2 CAP-H *** *** *** ***
  • 11. Condensin complex is upregulated in CRC • QPCR on CRC samples SMC2 CAP-G CAP-G2 CAP-H *** *** *** ***
  • 12. SMC2 is upregulated in CRC• Western Blot on CRC paired samples Case 31 35 36 38 85 86 N T N T N T N T N T N T SMC2 150 kDa ACTIN 37 kDa
  • 13. SMC2 is upregulated in CRC• Western Blot on CRC paired samples Case 31 35 36 38 85 86 N T N T N T N T N T N T SMC2 150 kDa ACTIN 37 kDa SMC2 is up-regulated in 20 out 29 tumor samples: 69%
  • 14. SMC2 is upregulated in CRC• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts.
  • 15. SMC2 is upregulated in CRC• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts. Colon adenocarcinoma
  • 16. SMC2 is upregulated in CRC• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts. Normal mucosa Wnt-target genes expression pattern Colon adenocarcinoma
  • 17. SMC2 expression is linked to β-catenin Wnt signaling activation Nuclear accumulation of β-catenin β-catenin SMC2Membrane β-catenin Nuclearβ-catenin
  • 18. SMC2 expression is linked to β-catenin Wnt signaling activation Nuclear accumulation of β-catenin β-catenin SMC2Membrane β-catenin Nuclearβ-catenin Fisher exact test p=0,04, N=43 SMC2 is up-regulated in tumors where β-catenin is nuclear
  • 19. Is SMC2 a target of Wnt/β-catenin pathway?
  • 20. SMC2 is down-regulated upon Wnt inhibition Ls174T/dnTCF4 Ls174T/pTER-bCAT Dominant negative form of TCF4 siRNA against β-cateninTime 24h 48h 72h 96h Time 24h 48h 72h 96hDox - + - + - + - + Dox - + - + - + - +TCF-4 β-cateninC-MYC C-MYCSMC2 SMC2ACTIN ACTIN
  • 21. SMC2 is down-regulated upon Wnt inhibition Ls174T/dnTCF4 Ls174T/pTER-bCAT Dominant negative form of TCF4 siRNA against β-cateninTime 24h 48h 72h 96h Time 24h 48h 72h 96hDox - + - + - + - + Dox - + - + - + - +TCF-4 β-cateninC-MYC C-MYCSMC2 SMC2ACTIN ACTIN
  • 22. SMC2 is down-regulated upon Wnt inhibition Ls174T/dnTCF4 Ls174T/pTER-bCAT Dominant negative form of TCF4 siRNA against β-cateninTime 24h 48h 72h 96h Time 24h 48h 72h 96hDox - + - + - + - + Dox - + - + - + - +TCF-4 β-cateninC-MYC C-MYCSMC2 SMC2ACTIN ACTIN SMC2 is under β-catenin/TCF4 regulation, but is it direct or indirect?
  • 23. TCF4 is bound to SMC2 promoter in vivo TATA Sp1 Sp1 TATA TSS Sp1 -595 -561 -301 -12 +1 +219
  • 24. TCF4 is bound to SMC2 promoter in vivo TATA Sp1 Sp1 TATA TSS Sp1 -595 -561 -301 -12 +1 +219 TBE 2 TBE 3Hs 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Pt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||Mmt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGG---TGA 71 .|.|.||...|||||||||||||||||||||||||||||||||||| |||.|||||||||.|||.|||||Rn 1 CAGACGCGTCGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAG----AAACAGTTCCGGCACGGTTGTTG- 69 .|.|.||...||||.|||||||||||||||||||||||||||||||| ||.|||||||||.|||.|||||Mms 1 CAGACGCCTCGGAGTTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGG----AACAGTTCCGGCACGGTTGTTG- 69
  • 25. TCF4 is bound to SMC2 promoter in vivo TATA Sp1 Sp1 TATA TSS Sp1 -595 -561 -301 -12 +1 +219 TBE 2 TBE 3Hs 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Pt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||Mmt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGG---TGA 71 .|.|.||...|||||||||||||||||||||||||||||||||||| |||.|||||||||.|||.|||||Rn 1 CAGACGCGTCGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAG----AAACAGTTCCGGCACGGTTGTTG- 69 .|.|.||...||||.|||||||||||||||||||||||||||||||| ||.|||||||||.|||.|||||Mms 1 CAGACGCCTCGGAGTTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGG----AACAGTTCCGGCACGGTTGTTG- 69
  • 26. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ 3Mut 1 2 3 4 5 Luc+ 1/2/4/5 Mut 1 2 3 4 5 Luc+
  • 27. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ 3Mut 1 2 3 4 5 Luc+ 1/2/4/5 Mut 1 2 3 4 5 Luc+ DLD-1 cells HCT116 cells pgl3b WT 2Mut 3MUT 1/2/4/5Mut pgl3b WT 2Mut 3MUT 1/2/4/5Mut
  • 28. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ 3Mut 1 2 3 4 5 Luc+ 1/2/4/5 Mut 1 2 3 4 5 Luc+ DLD-1 cells HCT116 cells pgl3b WT 3MUT 1/2/4/5Mut pgl3b WT 3MUT 1/2/4/5Mut
  • 29. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ TBE3 is responsible for β-catenin/TCF4 3Mut 1 2 3 4 5 Luc+ transactivation of SMC2 promoter1/2/4/5 Mut 1 2 3 4 5 Luc+ DLD-1 cells HCT116 cells pgl3b WT 3MUT 1/2/4/5Mut pgl3b WT 3MUT 1/2/4/5Mut
  • 30. SMC2 role in tumorogenesis• siRNA mediated Knockdown of SMC2 Time (h): 24 48 72 siRNA: sc SMC2 sc SMC2 sc SMC2 SMC2 SMC4 NCAPH GAPDH
  • 31. SMC2 role in tumorogenesis• siRNA mediated Knockdown of SMC2 Time (h): 24 48 72 siRNA: sc SMC2 sc SMC2 sc SMC2 SMC2 SMC4 NCAPH GAPDH
  • 32. SMC2 role in tumorogenesis • Tumor Xenografts siRNA siRNA 1st 2nd scrambled SMC2 transfection transfectionDLD1 cells Mice injection 48h 24h
  • 33. SMC2 role in tumorogenesis • Tumor Xenografts siRNA siRNA 1st 2nd scrambled SMC2 transfection transfectionDLD1 cells Mice injection 48h 24h
  • 34. SMC2 role in tumorogenesis • Tumor Xenografts siRNA siRNA 1st 2nd scrambled SMC2 transfection transfectionDLD1 cells Mice injection 48h 24h SMC2 is a new potential therapeutic target
  • 35. Summary1. Condensin complex is up-regulated in colon cancer2. SMC2 is under direct regulation of β-catenin/TCF4 complex3. SMC2 is proposed as new potential therapeutic target for CRC treatment
  • 36. AcknowledgmentsDRUG DELIVERY AND TARGETING GROUP Verónica Dávalos Julio Castaño Anthea Messent Simó Schwartz Navarro FUNCTIONAL VALIDATION AND PRE- CLINICAL RESEARCH Yolanda Fernández Ibane Abásolo

×