Insect Biochemistry and Molecular Biology 32 (2002) 247–253
Rapid communication
3×P3-EGFP mar...
248 J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
2. Materials and methods
2.1. B. mor...
249J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
Fig. 1. Expression in stemmata of a G...
250 J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
Table 2
Comparison of various propor...
251J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
Fig. 4. Expression throughout the bod...
252 J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
Table 3
Identification by iPCR of the...
253J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253
(Miya, 1958; Nardi, 1993; Nakao, 1999...
Upcoming SlideShare
Loading in...5

1 s2.0-s0965174801001503-main


Published on

  • Be the first to comment

  • Be the first to like this

No Downloads
Total Views
On Slideshare
From Embeds
Number of Embeds
Embeds 0
No embeds

No notes for slide

1 s2.0-s0965174801001503-main

  1. 1. Insect Biochemistry and Molecular Biology 32 (2002) 247–253 Rapid communication 3×P3-EGFP marker facilitates screening for transgenic silkworm Bombyx mori L. from the embryonic stage onwards J.-L. Thomas * , M. Da Rocha, A. Besse, B. Mauchamp, G. Chavancy Unite´ Nationale Se´ricicole, INRA, 25 quai J.J. Rousseau, 69350, La Mulatiere, France Received 15 August 2001; received in revised form 1 October 2001; accepted 5 October 2001 Abstract Transgenesis was recently achieved in Bombyx mori L., but it has proved difficult and time-consuming to screen the numerous progeny to identify the transgenic individuals. As the 3×P3-EGFP marker has been shown to be a suitable universal marker for transgenic insects (Nature 402 (1999) 370), we evaluated its use for embryonic-stage screening for B. mori L. germline transform- ation. Using the piggyBac-derived vector pBac{3×P3-EGFPaf}, we were able to isolate four transgenic individuals from about 120,000 embryos (560 broods). The screening was straightforward due to EGFP production in the G1 embryonic stemmata, which was visible through the translucent egg chorion. EGFP was produced in the stemmata and central and peripheral nervous systems from the fifth day of embryonic development. It persisted at high levels in the stemmata throughout the larval stage, and was also present in the compound eyes and nervous tissues of the pupae and the compound eyes of the moths.  2002 Elsevier Science Ltd. All rights reserved. Keywords: Bombyx mori; Transgenesis; piggyBac; Transposon; pBac{3×P3-EGFPaf}; Marker expression 1. Introduction Germline transgenesis was recently achieved in Bom- byx mori L. (Tamura et al., 2000) after many attempts over a number of years (Ninaki et al., 1985; Tamura et al., 1990; Coulon-Bublex et al., 1993; Nagaraju et al., 1996). It was made possible by the use of a combination of the EGFP marker gene cloned in the piggyBac trans- poson under control of the Bm-Actin3 promoter (Cary et al., 1989; Fraser et al., 1995). The resulting piggyBac- derived vector, pPIGA3GFP, was useful for the screen- ing of G1 individuals at the larval stage but necessitated the rearing of numerous silkworms. This time-consum- ing work is the main limitation of this promoter–marker combination. With the Bm-Actin3GFP marker, expression can be viewed in mosaic G0 larvae and in the transgenic larvae of subsequent generations. The expression of this marker is visible in the vitellophages of the G0 eggs, but not in G0 embryonic tissues or in the eggs of the later generations. It is therefore not poss- * Corresponding author. E-mail address: (J.-L. Thomas). 0965-1748/02/$ - see front matter  2002 Elsevier Science Ltd. All rights reserved. PII: S0965-1748(01)00150-3 ible, with this promoter, to screen transgenic individuals before the G1 larval stage. With a view to reducing the larval rearing effort required, we investigated the universal 3×P3-EGFP marker developed in Wimmer’s lab (Berghammer et al., 1999; Horn et al., 2000; Horn and Wimmer, 2000). The artificial 3×P3 promoter drives EGFP expression not only in the ocelli and omatidia of adult Tribolium cas- taneum and Drosophila melanogaster, but also in the stemmata of beetle larvae and in the Bolwig organs and nervous tissues of dipteran larvae, which start to fluor- escence before hatching, at embryonic stages (Horn et al., 2000; Hediger et al., 2001). These data suggested that the 3×P3-EGFP marker was very likely to be expressed in the stemmata of B. mori L. embryos. In B. mori L. embryos, the stemmata are in contact with the chorion, which is almost transparent. This enabled us to use the 3×P3-EGFP marker to select transgenic individuals as embryos, overcoming the necessity to rear thousands of G1 larvae. EGFP expression was detectable from the fifth day of embry- onic development until the imago stage. This made it possible to determine the precise expression pattern of the 3×P3-EGFP marker in B. mori.
  2. 2. 248 J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253 2. Materials and methods 2.1. B. mori L. strain The Indian polyvoltin strain Nistari was obtained from a silkworm collection maintained at UNS/INRA (France). Silkworms were reared at 25°C and fed with mulberry leaves from spring to autumn and on an arti- ficial diet during winter. After hatching from microin- jected eggs, first instar larvae were fed an artificial diet and reared in groups under standard conditions. G0 adults were mated together and G1 eggs were screened for EGFP expression from the fifth day of incubation onwards. The positive G1 eggs were isolated, hatched and the larvae reared separately. Positive adult G1 were backcrossed. 2.2. Egg preparation for microinjection and screening For egg collection, male and female moths were allowed to mate overnight by artificial light. In the morn- ing, the females were placed on a plastic sheet and allowed to lay in the dark for one hour. The eggs were disinfected with 4% formaldehyde solution for 5 min, rinsed with distilled water and finally dried with absolute ethanol. The piece of the plastic sheet on which the eggs were laid was glued with cyanocrylate glue onto a 55 mm Petri dish. Glass needles were pulled from 20 µl precalibrated pipettes (Vitrex, ref 1264) and were sharpened to an angle of 30°, using a Narishige EG4 grinder. Eggs were microinjected as soon as possible, and in all cases were injected no later than four hours after oviposition. Unless otherwise specified, the injection was made into the dor- sal posterior third of the egg, avoiding the ventral side, where the germ band develops. We injected 5–10 nl of a 1:1 mixture of vector and helper plasmids (0.5 µg/µl total DNA concentration) in deionised water into the eggs. The injection hole was then sealed with a small drop of cyanocrylate glue. Throughout egg incubation, a saturated atmosphere was maintained by placing two wet pieces of GF/B glass filter paper (Whatman) on the coverslip of the Petri dish. The Petri dish was placed upside-down in a closed box kept at 25°C. To make it easier to see the marker in the embryos, we immersed the eggs in water or 90% ethanol. This changed the refractive index of the surface of the chor- ion, rendering it almost transparent, making it easier to see the fluorescence in the stemmata. 2.3. DNA constructs The transposon-encoding plasmid, pHA3pig (6.2 kb), is described elsewhere (Tamura et al., 2000). The pig- gyBac-derived vector pBac{3×P3-EGFPaf} (7.3 kb) was generously provided by E.A. Wimmer and is described in Horn and Wimmer (2000). Both DNA constructs were amplified using the Hybaid Maxi Flow DNA preparation kit. Their final concentration was adjusted to 1 µg/µl in water and they were aliquoted and stored at Ϫ20°C. The DNA vector and helper mixture, or the vector alone, were injected at a concentration of 0.5 µg/µl. 2.4. Inverse PCR (iPCR) and junction sequences Genomic DNA was extracted from G1 moths, G1 embryonic larvae or from the G2 silk gland. DNA was purified by standard SDS lysis-phenol extraction treat- ment after incubation with proteinase K. The DNA was further treated with RNAse and purified as described by Hediger et al. (2001). DNA was digested with Hae III and circularised by ligation for 3 h at 18°C. PCR was performed on the circularised fragments, using primer sequences, in opposite orientations, corresponding to sequences between the restriction site and the end sequence of the piggyBac vector. For the 3Ј junction, the forward primer (PRF) 5Ј-CCTCGATATACAGACCGA TAAAACACATGC-3Ј and reverse primer (PRR) 5Ј- AGTCAGTCAGAAACAACTTTGGCACATATC-3Ј were used. For the 5Ј junction, the forward primer (PLF) 5Ј-CTTGCACTTGCCACAGAGGACTATTAGAGG-3Ј and reverse primer (PLR) 5Ј-CAGTGACACTTACCGC ATTGACAAGCACGC-3Ј were used. PCR fragments were separated by electrophoresis in a 0.8% agarose gel and plugs of single bands were reamplified and purified (PCR purification kit, Qiagen, D). The purified frag- ments were directly sequenced (GENOME Express; Meylan, France) with the PLR primer for the left (5Ј) boundary and PRF for the right (3Ј) boundary of the vec- tor. 3. Results 3.1. Pattern of 3×P3-EGFP marker expression in B. mori G0 embryos We checked that the 3×P3-EGFP marker was func- tional in B. mori embryos by co-injecting the piggyBac vector and the helper plasmid pHA3pig into eggs at a 1:1 (w/w) ratio (1.17:1 H/V; molar ratio). We injected DNA into the eggs at the anterior pole to favour its location in the cephalic area, where the stemmata differ- entiate. This may have a detrimental effect on hatching, but this was not considered important in this preliminary evaluation of the usefulness of the marker. Once the stemmata had differentiated, we observed expression of the marker through the egg shell (Fig. 1). On subsequent days, and until the larval pre-hatched stage, the number of embryos producing EGFP steadily increased (Table 2). The 3×P3-EGFP marker was expressed not only in the stemmata, but also in other tissues, some of which
  3. 3. 249J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253 Fig. 1. Expression in stemmata of a G0 embryo (arrow). The brown- ish dot corresponds to the vitellogenic clot. The second egg did not express the marker although the vector was injected. were identified as nervous system tissues. Expression was observed in the thorax and abdomen as well as in the head (data not shown). It was clear that the marker was expressed in nervous system tissues in all these body parts. In many cases it was necessary to dissect embryos to view or to confirm EGFP expression because the melanin of the vitellogenic clot covering the injection hole was opaque. Expression of the 3×P3-EGFP marker was clearly seen in G0 hatched larvae (Fig. 2) and would clearly have been detected in G1 eggs with a trans- parent chorion. 3.2. Conditional pBAC{3×P3-EGFPAF} expression in G0 embryos Unlike the pPIGA3GFP vector carrying the Bm- Actin3 promoter, the pBac{3×P3-EGFPaf} vector mediated fluorescence in the embryos, which was visible through the egg chorion and rarely in vitellophages of the Nistari strain. This made it possible to test injection parameters to facilitate the detection of expression from the fourth day of embryonic development onwards. However, in most cases, expression became detectable between 6 and 10 days of development (Table 2). Although the Bm-Actin3 promoter gave strong, early expression in the vitellophages of the eggs (48 h after injection), it concealed any potential expression in the embryonic tissues. Expression in eggs driven by this pro- moter is poorly sensitive to injection location (anterior or posterior) and to the presence or absence of the helper plasmid. We used the pBac{3×P3-EGFPaf} vector to test the effect of injection location on the frequency of expression in the target tissue. Injections into the anterior part of the egg gave a frequency of expression 3.5 times Fig. 2. Expression in the five stemmata on the left side of a hatched G0 larva. Expression was visible on both sides of the head; h: head, t: thorax. The outline of the larva is shown by the dashed line. higher than that obtained when the DNA solution was injected into the posterior part of the egg. Moreover, expression in stemmata was observed only for injections into the anterior part of the egg. If DNA was injected into the posterior part of the egg, only thoracic and abdominal nervous tissues expressed the 3×P3-EGFP marker. This difference demonstrates clearly the position effect of the injections. However, injections into the pos- terior part gave a hatching frequency 5.6 times higher than that for injections into the anterior part of the egg (Table 1). We avoided ventral injection because it resulted in too low a frequency of embryonic develop- ment (data not shown). We also tested the effect of the helper plasmid on the frequency of expression from the pBac{3×P3-EGFPaf} vector. We compared the co-injection of the helper plas- mid and vector (in two helper/vector weight ratios: 1:1 and 1:10) with injection of the vector alone (Table 2). Surprisingly, expression was observed in the absence of the helper plasmid, even late in embryonic development, probably due to the persistence of episomal plasmid cop- ies. Such an expression was never observed in our hands with common plasmid vectors. Among diverse plasmid vectors used, only one carrying a recombinant densoviral vector (Jourdan et al., 1990; Giraud et al., 1992) was able to give expression in embryonic somatic tissues at 2, 4 and 10 days of development (J.-L. Thomas unpub- lished results). We found that the helper plasmid increased the frequency of the marker expression. Indeed, the frequency of expression with the 1:1 weight ratio (1.17:1, H/V molar ratio) was 5–13 times higher than that in the absence of the helper plasmid (Table 3). In this case, we estimate that about 80% (6.69– 1.36/6.69) to 93% (7.99–0.59/7.99) of expression is accounted for by somatic integrated vector. We also tested a 1:10 ratio of helper plasmid to vector. In this case, the frequency of vector-mediated fluor- escence was lower, by a factor of 1.2–1.6, than that for the 1:1 weight ratio of helper plasmid to vector. 3.3. The 3×P3-EGFP marker facilitates efficient screening for piggyBac germline transgenesis Based on our preliminary experiments, we chose a 1:1 (w/w, 0.5 µg/µl) mixture of vector helper plasmid into Table 1 Comparison of the frequency of EGFP expression following co-injec- tion of the pB3×P3-EGFPaf vector and the pHA3 helper (w/w ratio of 1:1) into the anterior and posterior poles of the eggs Injection No. injected No. GEP+ No. hatched location Anterior 320 11 (3.4%) 8 (2.5%) Posterior 420 4 (0.95%) 59 (14%)
  4. 4. 250 J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253 Table 2 Comparison of various proportions of helper plasmid to vector on the frequency of vector expression in the embryonic stemmata. Numbers of positive embryos for each recorded day correspond to the total number of positive embryos on that day; ND: not determined Exp. Conditions No. of eggs No. of GFP-positive embryos at n days of development (%) Ratio injected 4 6 7 8 11 1 H/V (1:1) 131 ND ND ND ND 2 (1.53) 1:1/1:10 H/V (1:10) 218 ND ND ND ND 2 (0.92) 1.65 H/V (1:1) 338 1 3 17 27 (7.99) ND ND 2 H/V (1:10) 167 0 0 3 11 (6.59) ND 1:1/1:10 1.21 V 170 0 0 1 1 (0.59) ND 1:1/0:1 13.54 3 H/V (1:1) 524 ND ND ND 35 (6.69) ND 1:1/0:1 V 808 ND ND ND 11 (1.36) ND 4.92 the posterior third of the egg. The DNA solution was injected into the dorsal side, towards the ventral side of the egg, where the germ band develops. We injected 6335 eggs, from which 2190 larvae hatched (34.6%). Of the 1210 mated G0 moths, 1100 were mated in single pair matings and the remaining 110 G0, all of the same sex, were backcrossed with uninjected moths of the other sex. We obtained 560 broods, including one single pair mating brood with four positive individuals. Thus the percentage of G0 moths with transgenic progeny was 0.08% (1/1210), as it is likely that only one of the two parents was responsible for the transformation events. Despite this very low frequency, the transgenic individ- uals were easy to identify among the 120,000 eggs screened (one brood corresponds to about 200–250 eggs) when they were immersed under water or ethanol (Figs. 3(b) and 6(b)). 3.4. Pattern of expression during successive developmental stages in the transgenic silkworm The four G1 moths, two males and two females, were backcrossed with their wild-type counterpart and G2 progeny eggs were screened for GFP. From the fifth day of embryonic development onwards, we detected GFP not only in the differentiating stemmata, but also in the nervous system comprising the cerebrum and the ventral Fig. 3. Expression in a four-day old G2 egg. (a) Bright field, (b) GFP fluorescence system. ganglionic chain (Figs. 3(b), 4(b) and 5(b)). On dissec- tion, we observed that some peripheral nervous tissues expressed the 3×P3-EGFP marker (Figs. 4(b) and 5(b)). Later in development, 3×P3-EGFP marker expression was observed in the differentiated stemmata of seven- day old embryo (Fig. 6) and in the differentiating com- pound eyes of the pupae (Fig. 7) and moths (Fig. 8). From the four back-crosses we obtained four G2 batches with different Mendelian proportions of GFP positive embryos. Brood TJL1 had 75% positive embryos, TJL2 and TJL3 had 50% and TJL4 had 65% positive embryos. This is consistent with broods TJL2 and TJL3 carrying a single integration and brood TJL1 carrying two inser- tions on two different chromosomes. The situation for brood TJL4 must be more complex, because the pro- portion (65%) was intermediate between 50 and 75% (see below). 3.5. Evidence for germinal transgenesis by a piggyBac-specific transposition process Inverse PCR experiments were performed on G2 pro- geny of TJL1, TJL3 and TJL4 G1 parents (Table 3). None of the TJL2 G2 eggs hatched. We identified six different genomic junction sequences flanking the 5Ј and 3Ј piggyBac ITR (inverted terminal repeat) sequences in broods TJL1, TJL3 and TJL4. We observed two vector insertions in the progeny of TJL1, one in the progeny of TJL3 and four in the progeny of TJL4. ITRs were bordered by the characteristic TTAA sequence, the known target site of piggyBac (Wang and Fraser, 1993). Except for TJL4.6, in which the 3Ј junction sequence was the original baculovirus DNA sequence cloned into the p3E1.2 vector all other junction sequences represent novel sequences that are most probably derived from the B. mori genome. PCR analysis showed that TJL1.1 and TJL1.4 carried the same insertion (A), which differed
  5. 5. 251J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253 Fig. 4. Expression throughout the body of a five-day old G2 embryo (photomontage). The arrows show stemmata. The orange arrowheads show positive peripheral nervous system. (a) Bright field, (b) GFP fluorescence system. Fig. 5. Expression in the head and thorax of a five-day old embryo. The arrow shows the stemmata. The orange arrowheads show positive peripheral nervous system. (a) Bright field, (b) GFP fluorescence system. The brown dot in (a) is an artefact and not the pigmented stemmata. Fig. 6. Expression in the stemmata of a seven-day old G2 embryo. At the bottom, a neighbouring, negative embryo is shown. (a) Bright field, (b) GFP fluorescence system. Fig. 7. Expression in differentiating compound eyes in seven-day old nymphae. (a) Bright field, (b) GFP fluorescence system. from that carried by TJL1.3 (B) (Table 2). This confirms that the TJL1 transgenic parent carried two insertions. TJL3.2 carried a single insertion identical to that of TJL4.1 whereas TJL4.2, TJL4.3 and TJL4.6 carried dif- Fig. 8. Expression in the compound eyes of one of the four G1 moths obtained. (a) Bright field, (b) GFP fluorescence system. ferent insertions. Finally, four different insertions were carried by the TJL4 G1 parent. We found six insertions in the eight G2 individuals analysed. This means that the two G0 parents carried at least six piggyBac integrations and that it is very likely that only one of the two parents carried these six integrations. 4. Discussion In this paper, we demonstrate the potential value of the 3×P3-EGFP marker both for the screening of trans- genic B. mori L. individuals and for evaluating improve- ments in the frequency of transgenesis. In the first published experiments describing the suc- cessful use of a piggyBac transposon for B. mori L. germline transgenesis, the Bm-Actin3EGFP marker was
  6. 6. 252 J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253 Table 3 Identification by iPCR of the genomic insertion sites of the pBac{3×P3-EGFPaf} vector. Six different integration events were identified in eight individuals from 3 G2 transgenic broods. Two insertions were carried by the TJL1 G1 parent. The TJL3 parent carried one insertion identical to one of the four discovered in the G2 progeny of the TJL4 parent; ND: not determined Insertion G2 individuals 5Ј Genomic sequences 3Ј Genomic sequences identification TJL 1.1 and TJL 1.4 A …TTAACGACATTACTACGTGGCTTTTAApiggyBac piggyBacTTAAGGGTGTTTCCATTTATT… TJL 1.3 B ND piggyBacTTAATAAAACTACATTCAATA… TJL 3.2 and TJL 4.1 C …CCGGG (Hae III site) TTAApiggyBac piggyBacTTAAGGANCGNCTNCATTTNT… TJL 4.2 D …CCANACGCTCNACGCAGCCAAATTAApiggyBac piggyBacTTAACGATCATCAAACCGCG… TJL 4.3 E ND piggyBacTTAATGAACGCTAATTTTCAC… TJL 4.6 F …CCGG (Hae III site) TTAApiggyBac piggyBacTTAAATAATAGTTTCTAATTT… found to be useful for the screening of G1 transgenic individuals, but such screening was possible only at the larval stage (Tamura et al., 2000). However, the fre- quency of transgenesis (0.7–3.9%) made it necessary to examine a large number of G1 larvae several times from the first to the third instar. This screening was difficult because it was necessary to check moving larvae fed on an artificial diet. When the diet was cut to present a level plane, the larvae rapidly made excavations like craters, resulting in a large number of different focus levels. Moreover, the rearing of thousands of G1 larvae is very tedious and time-consuming. Thus, it is clear that if a marker such as 3×P3-EGFP could be expressed in embryonic stemmata, the screening process would be simplified. Stemmata differentiate from the fifth day of development and are immediately in contact with the translucent chorion. Furthermore, eggs are laid in a plane, at a single level, which should also facilitate screening. In our first experiment, we investigated whether all these considerations were useful. Expression of the 3×P3-GFP marker was visible through the chorion in G0 embryos, although a larger proportion of positive embryos were detected after dechorionation. We also observed EGFP production in other tissues. The artificial 3×P3 promoter, containing three optimal binding sites for Pax 6 homodimers, drives the tissue- specific expression of the GFP gene in the stemmata of embryos. Expression was also observed in nervous sys- tem tissues including the brain, ventral ganglionic chain and peripheral nervous tissues. These results are consist- ent with those obtained in D. melanogaster by Horn et al. (2000) and Musca domestica by Hediger et al. (2001). Weak fluorescence was only rarely observed in the vitel- lophages of the Nistari strain, which is an advantage in screening for embryonic somatic expression. We also thought that, unlike the Bm-Actin3GFP marker, the 3×P3-EGFP marker, which was expressed at discrete sites in G0 embryos and was specific for embryonic tissues, might be useful for evaluation of the conditions required to target poorly represented tissues such as stemmata or nerve precursor cells. This could be extrapolated to other piggyBac vectors carrying pro- moter of such a restricted tissue specificity and driving expression of vital marker gene like GFP gene. It is dif- ficult, if not impossible, with Bm-Actin3GFP, due to its loose specificity to evaluate the effect of the presence or absence of the helper plasmid on the frequency of somatic embryonic expression or the position effect of the site of injection as well. In both cases, expression spreads in many vitellophages to all parts of the egg. Such evaluation is possible at the larval stage, but only after the death of numerous embryos and the loss of as many potential interesting results helping the statistic view. We assessed the potential value of the 3×P3-EGFP marker for evaluation from early stages of embryonic development, by comparing pBac{3×P3-EGFPaf} vector injection with and without injection of the helper plas- mid. Expression was detected from the fourth day of embryonic development in some cases, but mostly after seven or eight days of embryonic development (12 days of incubation are required for the hatching of micro- injected eggs; 10 days are normally required for the hatching of wild-type control eggs), and its frequency was favoured by the presence of the helper plasmid. Injection of the helper plasmid with the vector, in an equal weight ratio (1.17 molar ratio in favour of the helper) gave a frequency of expression 5–13 times higher than that in the absence of the helper plasmid. The helper plasmid seems to be efficient in mediating somatic transgenesis, probably stabilising the vector by means of integration. It has to be clear that this con- clusion may be drawn only because 3×P3-EGFP marker is specifically expressed in embryonic tissues. Methods improving the efficiency of helper plasmid function should be straightforward to assess with the pBac{3×P3- EGFPaf} vector. Our results suggest that to obtain germ- line transgenesis, with the method in our own hands, it would probably be more relevant to inject the vector into the posterior part of the egg or into the ventral part where the germ cells will differentiate. We injected the vector into the posterior third of the egg, on the dorsal side, opposite to the site of germ band differentiation, and pushed the needle inside the vitellus toward the ventral side, where the germ cells will appear in the germ band
  7. 7. 253J.-L. Thomas et al. / Insect Biochemistry and Molecular Biology 32 (2002) 247–253 (Miya, 1958; Nardi, 1993; Nakao, 1999). We did not inject into the anterior part, targeting the pronuclei or the zygote, nor into the ventral part, targeting the germ cells, because injections with our system, in these areas of the egg were deleterious for normal embryonic devel- opment and hatching, as expected from Myohara’s work (1994). We found that all the known qualities of the 3×P3- EGFP marker in species such as D. melanogaster, T. castaneum (Berghammer et al., 1999; Horn et al., 2000) and M. domestica (Hediger et al., 2001) were also valu- able in B. mori L. transgenesis as demonstrated in the Indian polyvoltin Nistari strain and recently in the white eye mutant W1-pnd (results not shown). The most important feature of this marker is that it makes it poss- ible to screen large numbers of G1 broods, with ease, at an early embryonic stage. This somatic tissue-specific marker should also be of value for evaluating methods to increase the frequency of germline transgenesis. Acknowledgements We would like to thank B. Decle´rieux, B. Perret and L. Fontaine for rearing silkworms; C. Royer and A.-M. Grenier for helpful discussion. We would also like to thank E.A. Wimmer for critical reading of the manu- script, for his kindness and for sharing his data and reagents. In addition, we thank his collaborators: A. Ber- ghammer and C. Horn. References Berghammer, A.J., Klinger, M., Wimmer, E.A., 1999. A universal marker for transgenic insects. Nature 402, 370–371. Cary, L., Goebel, M., Corsaro, H.H., Wang, H.H., Rosen, E., Fraser, M.J., 1989. Transposon mutagenesis of baculoviruses: analysis of Trichoplusia ni transposon IFP2 insertions within the FP-locus of nuclear polyhedrosis viruses. Virology 161, 8–17. Coulon-Bublex, M., Mounier, N., Couble, P., Prudhomme, J.C., 1993. Cytoplasmic actin A3 gene promoter injected as supercoiled plas- mid is transiently active in Bombyx mori embryonic vitellophages. Roux’s Arch. Dev. Biol. 202, 123–127. Fraser, M.J., Cary, L., Boonvisudhi, K., Wang, H.H., 1995. Assay for movement of lepidopteran transposon IFP2 in insect cells using a baculovirus genome as a target DNA. Virology 211, 397–407. Giraud, C., Devauchelle, G., Bergoin, M., 1992. The densovirus of Junonia ceonia (Jc DNV) as an insect cell expression vector. Virology 186, 207–218. Hediger, M., Niessen, M., Wimmer, E.A., Du¨bendorfer, A., Bopp, D., 2001. Genetic transformation of the housefly Musca domestica with the lepidopteran-derived transposon piggyBac. Insect Mol. Biol. 10, 113–119. Horn, C., Jaunich, B., Wimmer, E.A., 2000. Highly sensitive, fluor- escent transformation marker for Drosophila transgenesis. Dev. Genes Evol. 210, 623–629. Horn, C., Wimmer, E.A., 2000. A versatile vector set for animal trans- genesis. Dev. Genes Evol. 210, 630–637. Jourdan, M., Jousset, F.X., Gervais, M., Skory, S., Bergoin, M., Dumas, B., 1990. Cloning of the genome of a densovirus and res- cue of infectious virus from recombinant plasmid in the insect host Spodoptera littoralis. Virology 179, 403–409. Miya, K., 1958. Studies on the embryonic development of the gonad in the silkworm, Bombyx mori L. J. Faculty Agric. Iwate University 3, 436–467. Myohara, M., 1994. Fate mapping of the silkworm, Bombyx mori, using localized UV irradiation of the egg at fertilization. Develop- ment 120 (10), 2869–2877. Nagaraju, J., Kanda, T., Yukuhiro, K., Chavancy, G., Tamura, T., Cou- ble, P., 1996. Attempt at transgenesis of the silkworm (Bombyx mori L.) by egg-injection of foreign DNA. Appl. Entomol. Zool. 31, 587–596. Nakao, H., 1999. Isolation and characterization of a Bombyx Vasa-like gene. Dev. Genes Evol. 209, 312–316. Nardi, J.B., 1993. Modulated expression of a surface epitope on migrating germ cells of Manduca sexta embryos. Development 118, 967–975. Ninaki, O., Maekawa, H., Gamo, T., Koga, K., Sakaguchi, B., 1985. Hatchability of silkworm eggs injected with DNA at early embry- onic stages. J. Seric. Sci. Jpn. 54, 428–434. Tamura, T., Kanda, T., Takiya, S., Okano, K., Maekawa, H., 1990. Transient expression of chimeric CAT genes injected into early embryos of the domesticated silkworm Bombyx mori. Jpn. J. Genet. 65, 401–410. Tamura, T., Thibert, C., Royer, C., Kanda, T., Abraham, E., Kamba, M., Natuo, K., Thomas, J.-L., Mauchamp, B., Chavancy, G., Shirk, P., Fraser, M., Prudhomme, J.-P., Couble, P., 2000. Germline trans- formation of the silkworm Bombyx mori L. using a piggyBac trans- poson-derived vector. Nat. Biotechnol. 18, 81–84. Wang, H.H., Fraser, M., 1993. TTAA serves as the target site for the TFP3 lepidopteran transposon insertions in both nuclear polyhedrosis virus and Trichoplusia ni genomes. Insect Mol. Biol. 1, 109–116.