• Save
281112 andrea v2
Upcoming SlideShare
Loading in...5
×
 

Like this? Share it with your network

Share

281112 andrea v2

on

  • 612 views

 

Statistics

Views

Total Views
612
Views on SlideShare
612
Embed Views
0

Actions

Likes
0
Downloads
0
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

281112 andrea v2 Presentation Transcript

  • 1. Introdução a Tecnologia dorDNA e Produção de Plantas TransgênicasCaracterização do Transgene e Estrutura do locus Andréa A. Carneiro
  • 2. PRODUÇÃO DE PLANTAS TRANSGÊNICASAgrobacterium Biobalística
  • 3. PRODUÇÃO DE PLANTAS TRANSGÊNICASAgrobacteriaBiobalística
  • 4. PRODUÇÃO DE PLANTAS TRANSGÊNICASAgrobacteriaBiobalística
  • 5. PRODUÇÃO DE PLANTAS TRANSGÊNICASAgrobacteriaBiobalística
  • 6. PRODUÇÃO DE PLANTAS TRANSGÊNICASAgrobacteriaBiobalística
  • 7. Agrobacterium tumefaciens TRANSFORMAÇÃO DE PLANTASplasmídeo “Ti”(tumor inducer) célula transformada TRANSGÊNICA ! célula da planta “GALHA DA COROA” crescimento acelerado e desordenado do tecido TUMORIZAÇÃO
  • 8. Transformação Genética de Plantas Agrobacterium tumefaciens Agrobacterium 4.Transferência do T-DNA para a célula vegetal Plasmídeo Ti 2.Ativação dos genes vir EE ED Ti Genes vir 3.Cópia e T-DNA excisãoGenes Vir do T-DNA att, chvA, B, E, pscA CROMOSSOMA BACTERIANO
  • 9. Transformação por Agrobacterium spp. Casa de vegetaçãoco-cultivo caloplaqueamento (eliminação Agrobacterium) indução e regeneração seleção
  • 10. Transformação Genética de Plantas Transferência Direta de DNA• Microinjeção• Transformação de protoplastos via polietileno glicol• Eletroporação• Fibrilas de carboneto de silício• Bombardeamento de PartículasPonto comum: Fatores físicos ou químicosfacilitam a entrada do DNA na célula vegetal
  • 11. Transformação Genética de Plantas Transferência Direta de DNA Bombardeamento de PartículasMicrocarreador Material Genético Célula
  • 12. BIOBALÍSTICA (“gene gun”) Tubo de aceleração de gás Disco de ruptura Aparato para Macrocarreador disparo dos microcarreadores Tela de Microcarreadores anteparo cobertos com DNATecido alvo
  • 13. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA• Genes – Uma região de DNA que codifica para a produção de uma proteína ou característica• Rede interativa - DNA, RNA e proteínas
  • 14. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA• Transgenes – genes manipulados através das técnicas de DNA recombinante (rDNA) – Obtidos de organismos doadores (vírus, bactérias, fungos, vegetais e animais) – Sintetizados “in vitro” – Genes provenientes do mesmo organismo (cisgênico) ou de organismos diferentes (transgênico) – Transgênico pode ser produzido pela adição, deleção, iRNA.
  • 15. Evento CaracterísticasT25 Tolerância ao herbicida glufosinato de amônioMON 810 Resistência a insetos da ordem LepidópteraBT11 Resistência a insetos da ordem Lepidóptera e tolerância ao herbicida glufosinato de amônioNK 603 Tolerância ao herbicida glifosatoGA21 Tolerância ao herbicida glufosinato de amônioHERCULEX Resistência a insetos da ordem Lepidóptera e tolerância ao herbicida glufosinato de amônioMIR162 Resistência a insetos da ordem LepidópteraMON 810 x Resistência a insetos da ordem Lepidóptera e tolerância aoNK603 herbicida glifosatoBT11 x Resistência a insetos da ordem Lepidóptera, tolerância aosGA21 herbicidas glifosato e glufosinato de amônioMON89034 Resistência a insetos da ordem LepidópteraTC1507 x Resistência a insetos da ordem Lepidóptera, tolerância aosNK603 herbicidas glifosato e glufosinato de amônio
  • 16. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA PROMOTOR REGIÃO CODIFICADORA TERMINADORLocalização: Célula, tecido, órgãoEstágio de Desenvolvimento Final do ProcessoQuantidade produzida 35S; Ubiquitina; Actina NOS; polyA 35S Proteína cry; vip; epsps
  • 17. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA - Promotor Promotor uidA (GUS) NOS
  • 18. NcoI BamH 1.893 kb I cry1C (codon optimized)HindIII BglII EcoRI d35S AMV NOS-Ter promoter
  • 19. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA
  • 20. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA
  • 21. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA
  • 22. Transformação Genética de Plantas CONSTRUÇÃO GÊNICA
  • 23. Transformação Genética de Plantas Biossegurança – Análises Moleculares
  • 24. Biossegurança – Análise Moleculares Transgene e vetores Qual o método de transformação foi utilizado? – Foi considerado os riscos de cada método? – Foi utilizado todo o vetor ou apenas partes? Quais são os principais transgenes presentes no evento?  Resistência a insetos / Genes cry  Tolerância a herbicidas / Genes epsps
  • 25. Biossegurança – Análise Moleculares Transgene e vetores Quais os organismos foram os doadores de genes?  Organismo diferente?  Mesmo organismo?  Removido do seu contexto fisiológico, o gene se torna um rDNA com todos os riscos associados de qualquer rDNA.
  • 26. Biossegurança – Análise Moleculares Transgene e vetores Os genes foram manipulados criando fusões entre diferentes genes ou tiveram alguma parte sintetizadas in vitro?  Transgene pode ter sido modificado para ser expresso de maneira mais eficiente (codon usage)  Recodificados ao nível dos nucleotídeos para ter um codon preferido pelo organismo recipiente.  Ex: genes cry de Bacillus foram recodificados resultando em um aumento de 100X de expressão (Trends Biotechnol. 2004. 22, 346-353) Milho AGG – Arginina (14,8%) Milho CGA - Arginina (4,3%)
  • 27. Biossegurança – Análise Moleculares Transgene e vetores Quais os genes foram utilizados para a seleção das células modificadas?  Resistência a antibióticos – nptII –kan; bla - amp  Tolerância a Herbicida epsps –glifosato; pat e bar - glifosinato O gene de seleção foi retirado? Como?  Seleção de progênie  Recombinase Como foi confirmado a remoção?  Southern blot, PCR
  • 28. Biossegurança – Análise Moleculares Transgene e vetores A sequência do transgene e o mapa de restrição são equivalentes? Dados de sequenciamento mostrando:  O sítio de inserção do transgene no cromossomo  A sequência que foi inserida  As sequências flanqueando o transgene Foi verificado a ausência de outras integrações, completa ou parcial?
  • 29. Biossegurança – Análise Moleculares Transgene e vetores Foi verificado rearranjamentos nos cromossomos? Qual o número de cópias do transgene presente no evento gerado? Houve integração de sequências estruturais do vetor?
  • 30. Transformação Genética de Plantas Biossegurança – Análises Moleculares EcoRI AluI EcoRI GAATTCCGTAATCGCCATGGTAGCTGGCGAATTCGGGAATG
  • 31. Transformação Genética de Plantas Biossegurança – Análises Moleculares Southern blot PCR Sequenciamento
  • 32. Mapa de Restrição
  • 33. BiossegurançaGenomaTranscriptoma, Proteoma e MetabolomaSaúde humana e animalMeio ambiente Biosafety Assessment Tool https://bat.genok.or/bat/
  • 34. OBRIGADA! Andréa A. Carneiroandreac@cnpms.embrapa.br