Your SlideShare is downloading. ×
0
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Virology Journal Club
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Virology Journal Club

954

Published on

Journal club …

Journal club
HIV and stem cell transplant

Published in: Health & Medicine
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
954
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
0
Comments
0
Likes
1
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1.  
  • 2.  
  • 3. Virology Journal Club 18 February 2009 Preneshni R Naicker
  • 4.  
  • 5. Introduction <ul><li>HIV-1 enters host cells by binding to a CD4 receptor and then interacting with either CCR5 or CXCR4. </li></ul>
  • 6. <ul><li>Homozygosity for a 32-bp deletion (delta32/delta32) in the CCR5 allele  inactive CCR5 gene product  high resistance against HIV-1 acquisition </li></ul>
  • 7. <ul><li>Allogeneic stem-cell transplantation from an HLA-matched donor is a feasible option for pts with hematologic neoplasms. </li></ul><ul><li>It is not established as a therapeutic option for pts also infected with HIV. </li></ul><ul><li>The outcome of allogeneic stem-cell transplantation in a pt with HIV infection and AML </li></ul><ul><li>Using a transplant from an HLA-matched, unrelated donor who was screened for homozygosity for CCR5 delta32 deletion. </li></ul>
  • 8. Case report <ul><li>40 year old </li></ul><ul><li>Caucasian man </li></ul><ul><li>Presented with newly diagnosed AML (FAB M4 sub-type, with normal cytogenetic features) </li></ul><ul><li>Diagnosed with HIV 10 years ago </li></ul><ul><li>Treated with HAART </li></ul><ul><li>Efavirenz 600mg daily </li></ul><ul><li>Emtricitabine 200mg daily </li></ul><ul><li>Tenofovir 300mg daily </li></ul>
  • 9. Case report cont.. <ul><li>On HAART for 4 years </li></ul><ul><li>No AIDS-associated illness observed. </li></ul><ul><li>When AML diagnosed </li></ul><ul><li>CD4 = 415 </li></ul><ul><li>VL = undetectable </li></ul><ul><li>Treatment of AML </li></ul><ul><li>2 x induction chemotherapy </li></ul><ul><li>1 x consolidation chemotherapy </li></ul>
  • 10. Case report cont… <ul><li>During the 1 st induction course, severe hepatic toxicity developed and renal failure occurred. </li></ul><ul><li>HAART discontinued </li></ul><ul><li>Viral rebound VL = 6.9x10 6 copies/ml </li></ul><ul><li>HAART resumed </li></ul><ul><li>3 months later VL = undetectable </li></ul><ul><li>7 months after presentation AML relapse </li></ul>
  • 11. Case report cont.. <ul><li>Allogeneic stem-cell transplantation </li></ul><ul><li>CD43+ peripheral-blood stem cells from an HLA-identical donor who had been screened for homozygosity for CCR5 delta32 allele. </li></ul><ul><li>Informed consent </li></ul><ul><li>Approved by institutional review board </li></ul>
  • 12. Case report cont… <ul><li>HLA genotyped identical at the following loci: </li></ul><ul><li>A*0201;B*0702,3501;Cw0401,0702;DRB1*0101.1501 and DQB1*0501,0602 </li></ul><ul><li>Patient received a graft containing 2.3x10 6 CD34+ cells/kg </li></ul>
  • 13. Case report cont… <ul><li>Other medication </li></ul><ul><li>Rabbit antithymocyte globulin </li></ul><ul><li>Cyclosporine </li></ul><ul><li>Mycophenolate mofetil </li></ul><ul><li>HAART administered until the day before </li></ul><ul><li>Engraftment achieved 13 days later </li></ul><ul><li>Grade I graft-versus-host disease of skin – cyclosporine adjusted </li></ul>
  • 14. Case report cont… <ul><li>AML relapse 332 days post-transplantation </li></ul><ul><li>Chimerism decreased to 15% </li></ul><ul><li>Reinduction with cytarabine and gemtuzumab </li></ul><ul><li>Single dose of whole body irradiation (200cGy) </li></ul><ul><li>DAY 391  2 nd transplant of 2.1x10 6 CD34+ cells/kg from the same donor </li></ul><ul><li>Complete remission of AML at 20 months </li></ul>
  • 15.  
  • 16. Methods <ul><li> CCR5 genotyping </li></ul><ul><li>DNA extraction: QIAamp Blood Midi Kit (Qiagen) from peripheral-blood monocytes </li></ul><ul><li>Screening donor for CCR5 delta32 allele with PCR. </li></ul><ul><li>Fwd: 5’CTCCCAGGAATCATCTTTACC3’ </li></ul><ul><li>Rev:5’TCATTTCGACACCGAAGCAGC3’ </li></ul><ul><li>200bp CCR5 allele 168bp delta32 deletion </li></ul>
  • 17. Methods cont.. <ul><li>Results confirmed by allele-specific PCR and direct sequencing </li></ul><ul><li>(BigDye Terminator v1.1 Cycle Sequencing) </li></ul><ul><li>Sequences analyzed with Vector NTI ContigExpress software (Invitrogen) </li></ul><ul><li>Viral Envelope Genotyping </li></ul><ul><li>Coreceptor use by HIV-1 assessed through V3 aa sequences of env region </li></ul>
  • 18. Methods cont.. <ul><li>Direct sequencing of bulk PCR products </li></ul><ul><li>RNA- env region sequenced </li></ul><ul><li>An ultradeep PCR analysis with parallel sequencing was performed </li></ul>
  • 19. Methods cont… <ul><li> Chemokine receptors & surface antigens </li></ul><ul><li>Mucosal cells isolated from 10 rectal biopsy specimens </li></ul><ul><li>CCR5 expression simulated by phytohemagglutinin (Sigma) </li></ul><ul><li>Cells analysed by flow cytometry </li></ul>
  • 20. Methods cont.. <ul><li> Chimerism </li></ul><ul><li>Based on discrimination bet donor & recipient alleles on short tandem repeats. </li></ul><ul><li>Used PCR and fluorescence-labeled primers </li></ul>
  • 21. Methods cont… <ul><li> Cellular & humoral immune response </li></ul><ul><li>Secretion of INF- γ by Ag-specific cells was induced. </li></ul><ul><li>T cell mediated immune response was measured for HIV-1 and CMV. </li></ul><ul><li>Antibodies against HIV-1 determined with an enzyme-linked immunoassay and immunoblot assay </li></ul>
  • 22. Methods cont… <ul><li> Amplification of HIV-1 DNA & RNA </li></ul><ul><li>HIV-1 RNA amplified using Cobas AmpliPrep-TaqMan HIV assay (Roche) </li></ul><ul><li>Total DNA isolated from peripheral blood monocytes and rectal biopsy specimens </li></ul><ul><li>env and LTR regions were amplified </li></ul>
  • 23. Results <ul><li> Distribution of CCR5 alleles </li></ul><ul><li>Genomic DNA from 62 of 80 potential HLA-identical stem-cell donors was sequenced in the CCR5 region </li></ul><ul><li>Only 1 donor homozygous for CCR5 delta32 deletion </li></ul>
  • 24. Results cont… <ul><li> HIV-1 coreceptor phenotype </li></ul><ul><li>Sequence analysis revealed glycine at 11 and glutamic acid at 25 of V3 region </li></ul><ul><li>Net charge of aa was +3 </li></ul><ul><li>=> CCR5 coreceptor use by the infecting strain </li></ul><ul><li>This was confirmed by sequencing RNA in env region </li></ul><ul><li>Ultradeep R: 2.9% X4 and dual-tropic variants </li></ul>
  • 25. Results cont.. <ul><li> Recipient chimerism </li></ul>
  • 26. Results cont… <ul><li>Cellular and humoral immune response </li></ul>
  • 27. Results cont…
  • 28. Results cont… <ul><li> Quantification of viraemia </li></ul><ul><li>HIV-1 RNA remained undetectable </li></ul><ul><li>No proviral DNA </li></ul><ul><li>(except D20 – env , LTR/ D61 – env ) </li></ul><ul><li> Rectal-biopsy specimens </li></ul><ul><li>D159 = macrophages showed expression of CCR5 – not present in mucosal CD4+ T lymphocytes </li></ul>
  • 29. Discussion <ul><li>Successful transplantation of allogeneic stem cells homologous for CCR5 delta32 allele to a pt with HIV </li></ul><ul><li>Pt had X4 variants before the SCT </li></ul><ul><li>Discontinued HAART >20 months but HIV-1 could not be detected </li></ul><ul><li>The persistence of HIV-1 populations can be observed without viraemia </li></ul><ul><li>CCR5 macrophages still present </li></ul>
  • 30. Discussion cont… <ul><li>X4 variants may be source for re-emerging viruses </li></ul><ul><li>Ab against env due to long-lived plasma cells resistant to immunosupp therapy </li></ul><ul><li>Does not require HAART if VL undetectable </li></ul><ul><li>Highlights the role of CCR5 receptor </li></ul><ul><li>Further investigations encouraged </li></ul>
  • 31. Thank you

×