On restrictions of balanced 2-interval graphs

Loading...

Flash Player 9 (or above) is needed to view presentations.
We have detected that you do not have it on your computer. To install it, go here.

0 comments

Post a comment

    Post a comment
    Embed Video
    Edit your comment Cancel

    Notes on slide 1

    Favorites, Groups & Events

    On restrictions of balanced 2-interval graphs - Presentation Transcript

    1. WG'07 - Dornburg On restrictions of balanced 2-interval graphs Philippe Gambette and Stéphane Vialette
    2. Outline • Introduction on 2-interval graphs • Motivations for the study of this class • Balanced 2-interval graphs • Unit 2-interval graphs • Investigating unit 2-interval graph recognition
    3. 2-interval graphs 2-interval graphs are intersection graphs of pairs of intervals a vertex a pair of intervals 8 1 2 5 I 3 4 6 9 7 the pairs of intervals an edge have a non-empty between two vertices intersection 5 8 1 9 G 4 2 3 6 7 I is a realization of 2-interval graph G.
    4. Why consider 2-interval graphs? A 2-interval can represent : - a task split in two parts in scheduling When two tasks are scheduled in the same time, corresponding nodes are adjacent.
    5. Why consider 2-interval graphs? A 2-interval can represent : - a task split in two parts in scheduling - similar portions of DNA in DNA comparison The aim is to find a large set of non overlapping similar portions, that is a large independent set in the 2-interval graph.
    6. Why consider 2-interval graphs? A 2-interval can represent: - a task split in two parts in scheduling - similar portions of DNA in DNA comparison - complementary portions of RNA in RNA secondary structure prediction Primary structure: AGGUAGCCCUAGCUUAGUACUUGUCUCACUCCGCACCU Secondary structure: CU C A CG GC 2 A G GAU U U U C C AGUA U C A U 1 C U G G C C C AC U UC 3
    7. RNA secondary structure prediction U A Helices: sets of contiguous base U A pairs, appearing successive, or C C A nested, in the primary structure. U A U C I2 I3 I1 G U C I2 C I2 G A successive nested U C U G UUCGU Find the maximum set of disjoint C G successive or nested 2-intervals: G AAGCA dynamic programming. U C UC CG C I1 A A G I 3 A helices C GU G U G G U A
    8. RNA secondary structure prediction Pseudo-knot: crossing I1 base pairs. I1 I2 crossed I2 5' extremity or the RNA component of human telomerase From D.W. Staple, S.E. Butcher, Pseudoknots: RNA structures with Diverse Functions (PloS Biology 2005 3:6 p.957)
    9. Why consider 2-interval graphs? A 2-interval can represent: - a task split in two parts in scheduling - similar portions of DNA in DNA comparison - complementary portions of RNA in RNA secondary structure prediction AGGUAGCCCUAGCUUAGUACUUGUCUCACUCCGCACCU 8 1 2 5 3 4 6 9 CU 7 C A CG GC 2 5 A 8 1 G GAU U U U C 9 C AGUA U C A 4 U 1 C 2 U G G C C C AC 3 U UC 3 6 7
    10. Why consider 2-interval graphs? A 2-interval can represent: Both intervals have same size! - a task split in two parts in scheduling - similar portions of DNA in DNA comparison - complementary portions of RNA in RNA secondary structure prediction AGGUAGCCCUAGCUUAGUACUUGUCUCACUCCGCACCU 8 1 2 5 3 4 6 9 CU 7 C A CG GC 2 5 A 8 1 G GAU U U U C 9 C AGUA U C A 4 U 1 C 2 U G G C C C AC 3 U UC 3 6 7
    11. Restrictions of 2-interval graphs We introduce restrictions on 2-intervals: - both intervals of a 2-interval have same size: balanced 2-interval graphs - all intervals have the same length: unit 2-interval graphs - all intervals are open, have integer coordinates, and length x: (x,x)-interval graphs
    12. Inclusion of graph classes perfect 2-inter AT-free K1,4-free circle co-compar compar Ko sto ch ka claw-free ,W es chordal t, 1 99 9 trapezoid circ-arc outerplanar odd-anti cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval Following ISGCI
    13. Some properties of 2-interval graphs Recognition: NP-hard (West and Shmoys, 1984) Coloring: NP-hard from line graphs Maximum Independent Set: NP-hard (Bafna et al, 1996; Vialette, 2001) Maximum Clique: open, NP-complete on 3-interval graphs (Butman et al, 2007)
    14. Inclusion of graph classes perfect 2-inter AT-free balanced 2-inter K1,4-free circle co-compar compar claw-free chordal trapezoid circ-arc outerplanar odd-anti cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    15. Balanced 2-interval graphs 2-interval graphs do not all have a balanced realization. Proof: Idea: a cycle of three 2-intervals which induce a contradiction. I1 I2 I3 B3 B4 B1 B2 B5 B6 l (I 2) < l (I 1) l (I 3) < l (I 2) l (I 3) < l (I 1) l (I 1) < l (I 3) Build a graph where something of length>0 (a hole between two intervals) is present inside each box Bi.
    16. Balanced 2-interval graphs 2-interval graphs do not all have a balanced realization. Proof: Gadget: K5,3, every 2-interval realization of K5,3 is a contiguous set of intervals (West and Shmoys, 1984) has only « chained » realizations:
    17. Balanced 2-interval graphs 2-interval graphs do not all have a balanced realization. Proof: Gadget: K5,3, every 2-interval realization of K5,3 is a contiguous set of intervals (West and Shmoys, 1984) has only « chained » realizations:
    18. Balanced 2-interval graphs 2-interval graphs do not all have a balanced realization. Proof: Example of 2-interval graph with no balanced realization: has only unbalanced realizations: I1 I2 I3
    19. Recognition of balanced 2-interval graphs Recognizing balanced 2-interval graphs is NP-complete. Idea of the proof: Adapt the proof by West and Shmoys using balanced gadgets. A balanced realization of K5,3: length: 79
    20. Recognition of balanced 2-interval graphs Recognizing balanced 2-interval graphs is NP-complete. Idea of the proof: Reduction of Hamiltonian Cycle on triangle-free 3-regular graphs, which is NP-complete (West, Shmoys, 1984).
    21. Recognition of balanced 2-interval graphs For any 3-regular triangle-free graph G, build in polynomial time a graph G' which has a 2-interval realization (which is balanced) iff G has a Hamiltonian cycle. Idea: if G has a Hamiltonian cycle, add gadgets on G to get G' and force that any 2-interval realization of G' can be split into intervals for the Hamiltonian cycle and intervals for a perfect matching. = U G depth 2
    22. Recognition of balanced 2-interval graphs Recognizing balanced 2-interval graphs is NP-complete. G' v0 v1 z M(v1) M(v0) H1 H2 H3
    23. Inclusion of graph classes perfect 2-inter AT-free balanced 2-inter K1,4-free circle co-compar compar claw-free chordal trapezoid circ-arc outerplanar odd-anti cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    24. Inclusion of graph classes perfect 2-inter AT-free balanced 2-inter K1,4-free circle co-compar compar claw-free chordal trapezoid circ-arc outerplanar odd-anti cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    25. Circular-arc and balanced 2-interval graphs Circular-arc graphs are balanced 2-interval graphs Proof:
    26. Circular-arc and balanced 2-interval graphs Circular-arc graphs are balanced 2-interval graphs Proof:
    27. Circular-arc and balanced 2-interval graphs Circular-arc graphs are balanced 2-interval graphs Proof:
    28. Circular-arc and balanced 2-interval graphs Circular-arc graphs are balanced 2-interval graphs Proof:
    29. Inclusion of graph classes perfect 2-inter AT-free balanced 2-inter K1,4-free circle co-compar compar claw-free chordal trapezoid circ-arc outerplanar odd-anti cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    30. Inclusion of graph classes perfect 2-inter AT-free balanced 2-inter K1,4-free circle co-compar compar claw-free unit-2-inter chordal trapezoid circ-arc (2,2)-inter outerplanar odd-anti cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    31. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of inclusion: How to transform a (x,x)-realization into a (x+1,x+1)-realization? Consider each interval separately.
    32. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of inclusion: How to transform a (x,x)-realization into a (x+1,x+1)-realization? Consider each interval separately. Take the left-most and the one it intersects.
    33. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of inclusion: How to transform a (x,x)-realization into a (x+1,x+1)-realization? Consider each interval separately. Increment their length to the right and translate the ones on the right.
    34. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of inclusion: How to transform a (x,x)-realization into a (x+1,x+1)-realization? Consider each interval separately. Take the left-most and the one it intersects.
    35. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of inclusion: How to transform a (x,x)-realization into a (x+1,x+1)-realization? Consider each interval separately. Increment their length to the right and translate the ones on the right.
    36. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of inclusion: How to transform a (x,x)-realization into a (x+1,x+1)-realization? Consider each interval separately.
    37. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of inclusion: How to transform a (x,x)-realization into a (x+1,x+1)-realization? Consider each interval separately.
    38. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of inclusion: How to transform a (x,x)-realization into a (x+1,x+1)-realization? Consider each interval separately.
    39. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of inclusion: How to transform a (x,x)-realization into a (x+1,x+1)-realization? Consider each interval separately.
    40. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of inclusion: How to transform a (x,x)-realization into a (x+1,x+1)-realization? Consider each interval separately.
    41. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of inclusion: How to transform a (x,x)-realization into a (x+1,x+1)-realization? Consider each interval separately.
    42. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. Proof of strictness: Gadget: K4,4-e, every 2-interval realization of K4,4-e is a contiguous set of intervals. I5 I1 I8 I5 I6 I7 I6 I2 I7 I3 I1 I2 3 4 II I4 I8 K4,4-e has a (2,2)-interval realization!
    43. (x,x)-interval graphs The class of (x,x)-interval graphs is strictly included in the class of (x+1,x+1)-interval graphs for x>1. G4 a v1 v'1 Idea of the proof of strictness: X1 X2 For x=4: any 2-interval vl1 vr2 realization of G4 has two 1 2 v2 v'2 v v r l vl4 vr4 3 vr3 v “stairways” which requires l v3 v'3 X4 X3 “steps” of length at least 5. v4 v'4 b v1 v'1 v2 v'2 v3 v'3 v4 vl1 vr4 X4 v'4 X1 vl3 vr1 vr3 vl4 X3 vl2 vr2 X2 a b
    44. (x,x)-interval graphs {unit 2-interval graphs} = U {(x,x)-interval graphs} x>0 Proof of the inclusion: There is a linear algorithm to compute a realization of a unit interval graph where interval endpoints are rational, with denominator 2n (Corneil et al, 1995). Corollary: If recognizing (x,x)-interval graphs is polynomial for all x then recognizing unit 2-interval graphs is polynomial.
    45. Inclusion of graph classes perfect 2-inter AT-free balanced 2-inter K1,4-free circle co-compar compar claw-free unit-2-inter chordal trapezoid circ-arc (2,2)-inter outerplanar odd-anti cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    46. Inclusion of graph classes perfect 2-inter AT-free balanced 2-inter K1,4-free circle co-compar compar claw-free unit-2-inter chordal trapezoid circ-arc (2,2)-inter outerplanar odd-anti cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    47. Proper circular-arc and unit 2-interval graphs Proper circular-arc graphs are unit 2-interval graphs Proof:
    48. Proper circular-arc and unit 2-interval graphs Proper circular-arc graphs are unit 2-interval graphs Proof:
    49. Proper circular-arc and unit 2-interval graphs Proper circular-arc graphs are unit 2-interval graphs Proof:
    50. Proper circular-arc and unit 2-interval graphs Proper circular-arc graphs are unit 2-interval graphs Proof: proper = unit
    51. Proper circular-arc and unit 2-interval graphs Proper circular-arc graphs are unit 2-interval graphs Proof: + disjoint intervals
    52. Inclusion of graph classes perfect 2-inter AT-free balanced 2-inter K1,4-free circle co-compar compar claw-free unit-2-inter chordal trapezoid circ-arc (2,2)-inter outerplanar odd-anti cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    53. Inclusion of graph classes Quasi-line graphs: every vertex is AT-free perfect 2-inter bisimplicial (its neighborhood can be partitioned into 2 cliques). balanced 2-inter K1,4-free circle co-compar compar unit-2-inter claw-free chordal trapezoid circ-arc (2,2)-inter outerplanar odd-anti quasi-line cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    54. Inclusion of graph classes Quasi-line graphs: every vertex is AT-free perfect 2-inter bisimplicial (its neighborhood can be partitioned into 2 cliques). balanced 2-inter K1,4-free circle co-compar compar unit-2-inter claw-free chordal trapezoid circ-arc (2,2)-inter outerplanar odd-anti quasi-line cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    55. Inclusion of graph classes K1,5-free perfect 2-inter AT-free balanced 2-inter K1,4-free circle all-4-simp co-compar compar unit-2-inter claw-free chordal trapezoid circ-arc (2,2)-inter outerplanar odd-anti quasi-line cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    56. Recognition of all-k-simplicial graphs A graph is all-k-simplicial if the neighborhood of a vertex can be partitioned in at most k cliques. Recognizing all-k-simplicial graphs is NP-complete for k>2. Proof: Reduction from k-colorability. G k-colorable iff G' all-k-simplicial, where G' is the complement graph of G + 1 universal vertex G G'
    57. Inclusion of graph classes K1,5-free perfect 2-inter AT-free balanced 2-inter K1,4-free circle all-4-simp co-compar compar unit-2-inter claw-free chordal trapezoid circ-arc (2,2)-inter outerplanar odd-anti quasi-line cycle-free bipartite proper circ-arc = circ. interval line unit interval circ-arc co-comp int. unit = proper trees permutation middle dim 2 height 1 interval
    58. Unit 2-interval graph recognition Complexity still open. Algorithm and characterization for bipartite graphs: A bipartite graph is a unit 2-interval graph (and a (2,2)-interval graph) iff it has maximum degree 4 and is not 4-regular. Linear algorithm based on finding paths in the graph and orienting and joining them.
    59. Perspectives Recognition of unit 2-interval graphs and (x,x)-interval graphs remains open. The maximum clique problem is still open on 2-interval graphs and restrictions.
    60. Perspectives Recognition of unit 2-interval graphs and (x,x)-interval graphs remains open. The maximum clique problem is still open on 2-interval graphs and restrictions. Guten Appetit!
    SlideShare Zeitgeist 2009

    + Philippe GambettePhilippe Gambette Nominate

    custom

    562 views, 0 favs, 1 embeds more stats

    A presentation on some subclasses of 2-interval gra more

    More info about this document

    © All Rights Reserved

    Go to text version

    • Total Views 562
      • 557 on SlideShare
      • 5 from embeds
    • Comments 0
    • Favorites 0
    • Downloads 4
    Most viewed embeds
    • 5 views on http://www.lirmm.fr

    more

    All embeds
    • 5 views on http://www.lirmm.fr

    less

    Flagged as inappropriate Flag as inappropriate
    Flag as inappropriate

    Select your reason for flagging this presentation as inappropriate. If needed, use the feedback form to let us know more details.

    Cancel
    File a copyright complaint
    Having problems? Go to our helpdesk?

    Categories

    Tags

    -->
    What's New

    © 2009 SlideShare Inc. All rights reserved.