Your SlideShare is downloading. ×
0
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia

2,990

Published on

PUBLIC SEMINAR At Agro-Biotechnology Institute, ABI Serdang …

PUBLIC SEMINAR At Agro-Biotechnology Institute, ABI Serdang
Prof J. S. “Pat” Heslop-Harrison,
University of Leicester
Academic Icon, University of Malaya
Chromosomes, Crops and Superdomestication
Crop improvement is reliant on the exploitation of new biodiversity and new combinations of diversity. I will discuss our work on genome structure and evolution, involving processes including polyploidy, introgression, recombination and repetitive DNA changes. Identification and measurement of diversity and relationships assists in use of new gene combinations or new crops, through synthesizing new hybrid species, by chromosome engineering or by transgenic strategies. We are studying crops including wheat, Brassica and banana, using genome sequencing, repetitive sequence comparison, and cytogenetics. Plants, pathogens and farmers have been involved in a three-way fight since the start of agriculture, and the concept of superdomestication involves systematic identification of needs from crops, only then followed by finding appropriate characters and bringing them together in new varieties. Crops will continue to deliver the products needed for food, fibre, fuel and fibre in an increasingly sustainable and safe manner.

Published in: Education, Technology
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
2,990
On Slideshare
0
From Embeds
0
Number of Embeds
11
Actions
Shares
0
Downloads
34
Comments
0
Likes
1
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Chromosomes, Crops and Superdomestication Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com and www.molcyt.org Twitter, YouTube and Slideshare: pathh1 17 December 2013 10-12
  • 2. Outputs –CROPS – Fixed energy Inputs –Light –Heat –Water –Gasses –Nutrients
  • 3. Outputs –CROPS – Fixed energy – Light – Heat – Water – Gasses – Nutrients 3 Inputs –Light –Heat –Water –Gasses –Nutrients
  • 4. Apollo 17 – The Blue Marble December 7, 1972 NASA The Blue Marble Apollo 17 7 Dec 1972
  • 5. We’ve done that before … Coming out of ice age at time of recognizably modern humans 50,000 yrs ago Coming up to the start of agriculture 10,000 yrs ago During agricultural clearances 2,000 and 1,000 yrs ago During better cultivation 150 yrs ago 20th Century: Drainage/fertilization/crop protection … and nearly every other ‘species’ tries to do it … goats, pines, viruses
  • 6. Burren West Ireland Mediaeval: Peat forest 1500 years of overgrazing Eroded to bedrock (now a preserved landscape!)
  • 7. st 21 C: Population increase higher living standards / health fossil fuel use climate change water …
  • 8. Life on the edge … Verge of stability for fire with 20% oxygen Water – quality and quantity Temperature – too hot or cold ABIOTIC FACTORS
  • 9. 11
  • 10. • Brazil slash and burn • Malaysian cut out ganoderma plants
  • 11. Ecosystems anchor slide Largely – Self-organizing – Self-maintained – Cycling – Defined scope – cf University – Household – Aircraft – 13
  • 12. Outputs –CROPS – Fixed energy – Light – Heat – Water – Gasses – Nutrients 14 Inputs –Light –Heat –Water –Gasses –Nutrients
  • 13. Outputs Ecosystem Services Water, gasses, nutrients ”nature’s services, like flood control, water filtration, waste assimilation”
  • 14. Ecosystem cycling threatened by stress and Abiotic instability Water Fire Wind Biotic Virus, bacteria, fungi Weeds, insects Nematodes etc. Alien invasions 16
  • 15. Rainfall Distribution mm/yr 17
  • 16. 18 Occasional ‘extreme inputs’: Limiting composition of ecosystems more than ‘mean input’ - Robustness
  • 17. Water hyacinth – Eichornia: an invasive alien plant from South America, fills water courses (a surface habitat not used by any native species) in Asia and Africa 20
  • 18. 21 Argenome mexicana: a goat-proof plant from Mexcio introduced and successful in Africa
  • 19. Anhalt, Barth, HH Euphytica 2009 Theor App Gen 200
  • 20. 23
  • 21. 24
  • 22. 50 years of plant breeding progress 4 Maize Rice Wheat Human Area 3.5 3 Agronomy 2.5 2 1.5 1 0.5 0 1961 1970 1980 1990 2000 2007
  • 23. 27
  • 24. • 50% of the world's protein needs are derived from atmospheric nitrogen fixed by the Haber-Bosch process and its successors. • Global consumption of fertilizer (chemically fixed nitrogen) 80 million tonnes • <<200 million tonnes fixed naturally
  • 25. Outputs –Crops (Chemical energy) – Food – Feed – Fuel – Fibre – Flowers – Pharmaceuticals – Fun 32
  • 26. 50 years of plant breeding progress 4 Maize Rice Wheat Human Area Genetics 3.5 3 2.5 2 1.5 1 0.5 0 1961 1970 1980 1990 2000 2007
  • 27. UK Wheat 1948-2007 52,909 data points, 308 varieties From Ian Mackay, NIAB, UK. 2009. Re-analyses of historical series of variety trials: lessons from the past and opportunities for the future. SCRI website.
  • 28. Conventional Breeding • Cross the best with the best and hope for something better Superdomestication • Decide what is wanted and then plan how to get it – – – – – Variety crosses Mutations Hybrids (sexual or cell-fusion) Genepool Transformation
  • 29. Economic growth • Separate into increases in inputs (resources, labour and capital) and technical progress • 90% of the growth in US output per worker is attributable to technical progress Robert Solow – Economist
  • 30. Inputs –Light –Heat –Water –Gasses –Nutrients –STRESSES 38
  • 31. BIODIVERSITY and genetic resources Red - AAA Palayam codan AAB (two bunch yellow, one green) Peyan ABB (green cooking banana), Njalipoovan AB (yellow) Robusta AAA (green ripe) Nendran AAB Poovan AAB (one yellow bunch) Red AAA Peyan Varkala, Kerala, India
  • 32. Genomes and genomics
  • 33. Genomics • Study of the structure, diversity, function and behaviour of all the DNA in an organism, organelle or virus ata clone MuG9, genomic, 73268bp gaaatccaatcaatccagatcaatattgatcgggttctg tgacgaagcagtcaaactgatcactaaaattcaatacat ggagtgctgatttcagaaacttaatcccttctgatagaa ccaacttacactaattagtcttaaaactcattaaggttg aataaatgtcatattacccttccaggtcataaacagctt aatgctgaagctattggcattacacttagtcttaacttc atttaacgatatgacaatcaataatgagataggcaaata aaaatgacatttttttgaactctgcagaattagctccta atcctttagtgaatgcagacaaggaatcagtaaccactg
  • 34. Triticale: wheat x rye hybrid
  • 35. Wheat evolution and hybrids Triticum uratu 2n=2x=14 AA Aegilops speltoides relative 2n=2x=14 Triticum tauschii BB (Aegilops squarrosa) Triticum dicoccoides 2n=4x=28 AABB Einkorn Triticum monococcum 2n=2x=14 Rye AA Secale cereale 2n=2x=14 RR Durum/Spaghetti Triticum turgidum ssp durum 2n=4x=28 AABB 2n=2x=14 DD Bread wheat Triticum aestivum 2n=6x=42 AABBDD Triticale xTriticosecale 2n=6x=42 AABBRR
  • 36. Crop standing Lodging in cereals Crop fallen
  • 37. Use of repetitive DNA sequences as chromosome markers
  • 38. Satellite DNA probe green
  • 39. Differences between genomes Major differences in the nature and amount of repetitive DNA • dpTa1 tandem repeat • 45S rDNA
  • 40. Inheritance of Chromosome 5D Aegilops ventricosa DDNN × Triticum persicum Ac.1510 AABB ABDN AABBDDNN × Marne AABBDD VPM1 × Hobbit CWW1176-4 Rendezvous dpTa1 pSc119.2 Genomic Ae.ventricosa Piko Dwarf A × Virtue × {Kraka × (Huntsman × Fruhgold)} 96ST61
  • 41. Multiple repeat (dpTa1) variants of each chromosome e.g. 5DL Bardsley, Schwarzacher & HH
  • 42. S 1A L Multiple dpTa1 variants of each chromosome S 2A L S e.g. 5DL 3A L S 4A L S 5A L S 6A L S 7A L 5BS. 5BL. 7BS 7BL Bardsley, Schwarzacher & HH
  • 43. Proportion of chromosome arms with identical in situ signal Correlation between genetic relationships and similarity of dpTa1 hybridization 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 0 0.1 0.2 0.3 0.4 0.5 0.6 Coefficient of parentage 0.7 0.8 0.9 1
  • 44. • • • • Tandem Repeats Where each arrow is a single unit of a repeat – - often a multiple of 180 bp but up to 10kb long Head-to-tail organization TCGCTAGA TCGCTAGA TCGCTAGA TCGCTAGA TCGCTAGA TCGCTAGT TCGCTAGA TCGCTAGA
  • 45. ancestral High-copy number A High-copy number B Low-copy number High-copy number C High-copy number D Low-copy number High copy spp: homogenized, amplification from a limited number of master copies Low copy spp: much variation Kuhn, Schwarzacher, PHH
  • 46. Use of repetitive DNA sequences as chromosome markers
  • 47. Wheat Streak Mosaic Virus in North America Bob Graybosch, USDA
  • 48. Wsm-1: only highly effective source of resistance to WSMV
  • 49. Mace wheat Graybosch et al. 2009 In situ: Niaz Ali & Schwarzacher
  • 50. Retroelements Sequences which amplify through an RNA intermediate •50% of all the DNA!
  • 51. Retroelement Markers Insertion LTR Retrotransposon LTR IRAP – InterRetroelement PCR LTR LTR Retrotransposon Retrotransposon LTR LTR LTR LTR LTR Retrotransposon Retrotransposon LTR Retrotransposon LTR LTR
  • 52. UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae. tauschii subsp Copyright restrictions may apply. Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042
  • 53. Retroelements •Homologous BAC sequences from Calcutta 4 Homologous over the full length •except for a 5kb insert •a Ty1-copia retroelement
  • 54. Musa balbisiana (MBP 81C12) hAT 1 1676 TE Musa acuminata (MA4 82I11) 384 bp TE + 781 MITE Microsatellite (AT) hAT 2 Transposed Element 621 bp MBT hAT 3 4192 bp TE Sr. No. Primer Pairs Product Size (bp) Sequence hAT 4 1. hAT18486 hAT19037 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC Microsatellite (AT) MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs.69 16/12/2013
  • 55. 1KB 800 600 400 200 HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 hAT1 insertion sites in Musa diversity collection hAT486F and hAT037R Top bands (560-bp) amplified hAT element and lower bands amplifying the flanking 16/12/2013 70 sequences only – Menzel, Nouroz, Schmidt, Schwarzacher, Heslop-Harrison 2013/14
  • 56. Size and location of chromosome regions from radish (Raphanus sativus) carrying the fertility restorer Rfk1 gene and transfer to spring turnip rape (Brassica rapa)
  • 57. Chromosome and genome engineering Cell fusion hybrid of two 4x tetraploid tobacco species Patel, Badakshi, HH, Dav ey et al 2011 Annals of Botany
  • 58. Nicotiana hybrid 4x + 4x cell fusions Each of 4 chromosome sets has distinctive repetitive DNA when probed with genomic DNA Patel et al Ann Bot 2011
  • 59. Diploid 2n=2x=22 Musa / banana metaphase probed red with transposable element Teo & Schwarzacher
  • 60. Six-way Venn diagram showing the distribution of shared gene families (sequence clusters) among M. acuminata, P. dactylifera, Arabidopsis thaliana, Oryza sativa, Sorghum bicolor and Brachypodium distachyon genomes. A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241 A D’Hont et al. Nature 2012 doi:10.1038/nature11241
  • 61. Whole-genome duplication events. A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241
  • 62. A D’Hont et al. Nature 2012 doi:10.1038/nature11241
  • 63. Arachis hypogaea - Peanut Tetraploid of recent origin, ancestors separated only 3 My ago Ana Claudia Araujo, David Bertioli, TS & PHH EMBRAPA, Brasília. Annals of Botany 2013
  • 64. Retroelement abundance and diversity in barley Gypsy elements are present in 25% of all BAC clones Barley gypsy: Vershinin, Druka, Kleinhofs, HH: PMB 2002; cf Brassica Alix & HH PM
  • 65.  Bertioli et al. Annals of Botany 2013 •Arachis hypogea 2n=4x=40 probed with •(green) A. duranensis; (red) A. ipaënsis
  • 66. Oscillations: noise and stability • Stochastic fluctuations – preserve stable oscillations – ensure robustness of the oscillations to cell-to-cell variations • Robustness analysis requires stochastic simulation JongRae Kim et al. Stochastic noise and synchronisation during Dictyostelium aggregation make cAMP oscillations robust. PLoS Computational Biology 2007
  • 67. Weak Stronger Coupling Kim J-R, Shin D, Jung SH, Heslop-Harrison P, Cho K-H. 2010. A design principle underlying the synchronization of oscillations in cellular systems. Journal of Cell Science 123(4): 537-543
  • 68. • Dynamic interactions between dependent modules • • Valeyev et al. Mol Biosyst 2009 5: 612 Kim J-R, Kim J, Kwon Y-K, Lee H-Y, Heslop-Harrison P, Cho K-H. 2011. Reduction of complex signaling networks to a representative kernel. Science Signaling 4, ra35. doi: 10.1126/scisignal.2001390
  • 69. • Stable cAMP oscillations in the cells with other molecules/ions Valeyev et al. Mol Biosyst 2009
  • 70. • • • • “Biochemistry explains biology” “Chemistry explains biochemistry” “Physics explains chemistry” “Mathematics explains physics”
  • 71. From Chromosome to Nucleus Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
  • 72. Outputs –Crops (Chemical energy) – Food – Feed – Fuel – Fibre – Flowers – Pharmaceuticals – Fun 90
  • 73. The genepool has the diversity to address these challenges … New methods to exploit and characterize germplasm let use make better and sustainable use of the genepool Molecular cytogenetics …
  • 74. How to use diversity • Cross two varieties • Genome manipulations • Cross two species and make a new one • Cell fusion hybrids • Chromosome manipulation • Backcross a new species • Generate recombinants • Chromosome recombinations • Transgenic approaches • Use a new species
  • 75. Are there many candidates? • • • • 250,000 plants 4,629 mammals 9,200 birds 10,000,000 insects • But only 200 plants, 15 mammals, 5 birds and 2 insects are domesticated!
  • 76. Nothing special about crop genomes? Crop Genome size 2n Ploidy Food Rice 400 Mb 24 2 3x endosperm Wheat 17,000 Mbp 42 6 3x endosperm Maize 950 Mbp 10 4 (palaeo-tetraploid) 3x endosperm Rapeseed B. napus 1125 Mbp 38 4 Cotyledon oil/protein Sugar beet 758 Mbp 18 2 Modified root Cassava 770 Mbp 36 2 Tuber Soybean 1,100 Mbp 40 4 Seed cotyledon Oil palm 3,400 Mbp 32 2 Fruit mesocarp Banana 500 Mbp 33 3 Fruit mesocarp Heslop-Harrison & Schwarzacher 2012. Genetics and genomics of crop domestication. In Altman & Hasegawa Plant Biotech & Agriculture. 10.1016/B9780-12-381466-1.00001-8 Tinyurl.com/domest
  • 77. Rules for successful domestication • There aren’t any! • Crops come from anywhere (new/old world; temperate/tropical; dry/humid) • They might be grown worldwide • Polyploids and diploids (big genomes-small genomes, many chromosomes-few chromosomes) • Seeds, stems, tubers, fruits, leaves
  • 78. Probably not many more (at least for plants) • Spread of the few species • Little change since early agriculture • Repeated domestication of these species (sometimes) • But wider use of current species with suitable genetic changes, or of newly created hybrids • A few species where wild-collections must be replaced sustainably • New needs – biofuels, neutraceuticals
  • 79. 50 years of plant breeding progress GM maize 4 Maize Rice Wheat Human Area Genetics 3.5 3 Agronomy 2.5 2 1.5 1 0.5 0 1961 1970 1980 1990 2000 2007
  • 80. United Nations Millennium Development Goals-MDGs • Goal 1 – Eradicate extreme poverty and hunger • Goal 2 – Achieve universal primary education • Goal 3 – Promote gender equity and empower women • Goal 4 – Reduce child mortality • Goal 5 – Improve maternal health • Goal 6- Combat HIV/AIDS, malaria and other diseases • Goal 7 - Ensure environmental sustainability • Goal 8 - Develop a global partnership for development
  • 81. Chromosomes, Crops and Superdomestication Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com and www.molcyt.org Twitter, YouTube and Slideshare: pathh1 17 December 2013 10-12

×