0
TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATT
GACTCACCCATCAACAACCGCTATGTATTTCGTACATTACT
GCCAGCCACCATGAATATTGTACGGTACCATAAATACT...
Genomes
Human                       Dog

 ~22,000 genes               ~19,000 genes

 ~3.0 billion nucleotides    ~2.4 bil...
Individual
    -biology
    -genotype



                     “Race”
DISEASE              is a crude
                     ...
“Race” as metapopulation is a complex
          composite variable
• “Race” as generally understood and as used in
 biomed...
Why is “Race” Problematic?
• Does not explain human biological variation.
• Socio-cultural meanings and the colloquial use...
Is “Ancestry” better?
•   Useful index for human biological variation.
•   No historical baggage.
•   Increased discourse ...
Era of Genomic Ancestry and challenges
related to Health.
1. Group definition and membership.

2. Can we accurately assess...
Promises in the post-
  genome sequencing era.

1. Advances in microarray and
   DNA chip technology.

2. Increased resear...
Section of Genetic Medicine
THE UNIVERSITY OF CHICAGO
Divergence of human populations




                         Mountain et al. 2002
Genetic variation among the major continents




     CD4 haplotype variation   Tishkoff 2003 ARGHG
• Genetic variation is not randomly distributed.
• Frequencies vary with age of allele.
        • Old = common across many...
Prevalence of Hypertension by Mean Body Mass Index
                    Among Populations of the African Diaspora

        ...
Alzheimer's Disease and APOE ε4 gene

                       6     5.6

                       5
                       4
...
Alzheimer's Disease and APOE ε4 gene

                       20                                            19%

          ...
Influencing factors

•Gene/gene and gene/environment interactions
•Discrimination and perceived racism (stress process)
•A...
Race
          (social)

Disease

          Ancestry
          (genetic)
Genetic features of African Americans

•   High genetic heterogeneity due to African ancestry and
    admixture w/ non-Afr...
Ancestry Informative Markers (AIMs)
• Genetic markers with large allele frequency difference (δ)
  between parental popula...
δ of AIM SNPs for West African/ Europeans




                         Tian et al. (2006) AJHG
Biogeographical ancestry
• Usefully accurate individual ancestry estimates
  possible using ancestry informative markers
•...
Plot of individual ancestry estimates using STRUCTURE
(Falush et al. 2003) on 112 AIMs




Bamileke (Cameroon)   European ...
Individual Ancestry:
Beyond Black and White

African-American sample
from Washington, D.C.
(n=221)

European-American samp...
Individual
Ancestry:
San Luis
Valley, CO
Hispanics




Bonilla et al. (2004) Annals of Human Genetics 68:139-153.
Individual
Ancestry:
Puerto Rican
Women from
New York City




Bonilla et al. (2004) Human Genetics 115:57-68.
European genetic contribution in African-American populations living
in different geographical areas of the US.




   Par...
Genetic Ancestry in Caribbean Populations




                              Jamaica: Closed circles
                      ...
Race
          (social)

Disease

          Ancestry
          (genetic)
PIA               PIN                   Pca




Nelson et al. Mechanism of Disease: Prostate Cancer.
NEJM 349:4, 2003
Prostate cancer: epidemiology
incidence rate per 100,000 men
                                 300

                       ...
Population differences
• Prostate cancer incidence.
  • Platz et al. 2000, JNCI, 92:24.

• Advanced stage prostate cancer....
Populations of African descent
• Kingston, Jamaica (Glover et al. 1998).
    • ~300/ 100,000 men
    • evidence for famili...
Risk Factors for Prostate Cancer
Positive family history is now considered the strongest risk factor for
prostate cancer, ...
Heterocyclic Aromatic Amines
• HCA - are small molecules formed when components of food
  proteins and creatine (component...
Why the differences in prevalence?
•   Overall increased genetic susceptibility.
•   Increased androgen biosynthesis.
•   ...
Scragg et al. (2004) Serum 25-
Hydroxyvitamin D, Diabetes,
and Ethnicity in the Third
National Health and Nutrition
Examin...
Garland et al. (2006) AJPH 96(2): 252-261
MODIFIERS OF VITAMIN D AND PROSTATE CANCER RISK
             LOW RISK                HIGH RISK
             for Pca       ...
Relationship between plasma 25(OH)-Vitamin D levels and lifetime
UVR exposure* in 260 African American men.


            ...
African American Hereditary Prostate
               Cancer (AAHPC) Study
Royal, C. et al. Recruitment experience in the fi...
AAHPC Collaborative Recruitment Centers (1997-2004)



                                                        Detroit


 ...
Candidate prostate cancer susceptibility genes with
significant allele frequency differences between populations

•   SRD5...
Revolution in genetics



Colon
Prostate
Breast
Significance of identifying
                 susceptibility genes
•   Improved diagnostics
    •   better phenotype
•   ea...
Section of Genetic Medicine
THE UNIVERSITY OF CHICAGO
UCCRC Diversity and Community Outreach
          Mission Statement


 The UCCRC is committed to building strong
 meaningfu...
Efforts to Enhance Minority Accrual:


                       Development of
                       Southside Community
  ...
Opportunities/ Future Directions

Preparation of R25 - Cancer education grant
     “Community Curriculum on Cancer Dispari...
Summary
 African and Hispanic Americans are a socially,
culturally, and genetically heterogeneous macro-ethnic
group with ...
Summary
 Equitable benefits from genetic medicine
depends on population genetics, market
economics, and most importantly o...
Specifics…
Take genetic ancestry into account in biomedical study designs
(self-identified “Race” alone may be a confounde...
University of Chicago
Stanley Hooker           Rebecca Santos, MPH
Wenndy Hernandez, M.S.   Nefertiti Oji-Njideka
Hankui C...
COLLABORATORS
Howard University                         Johns Hopkins University
Chiledum Ahaghotu, M.D.                  ...
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...
Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...
Upcoming SlideShare
Loading in...5
×

Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ...

2,842

Published on

0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
2,842
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
34
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Transcript of "Race, Genetic Ancestry and Prostate Race, Genetic Ancestry ..."

  1. 1. TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATT GACTCACCCATCAACAACCGCTATGTATTTCGTACATTACT GCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGA Race, Genetic Ancestry and Prostate CCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCT CCCCCCATGCTTACAAGCAAGTACAGCAATCAACCTTCAAC Cancer Risk TATCACACATCAACTGCAACTCCAAAGCCACCCCTTACCCA TTAGGATATCAACAAACCTACCCGCCCTTAACAGTACATAG CACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAA Rick Kittles, Ph.D. TCCCTTCTCGCCCCCATGGATGACCCCCCTCATTCTTTCAT Section of Genetic Medicine GGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCC ATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCAC CATGAATATTGTACGGTACCATAAATACTTGACCACCTGTA GTACATAAAAACCCAATCCACATCAAAACCCTCCCCCCATG CTTACAAGCAAGTACAGCAATCAACCTTCAACTATCACACA
  2. 2. Genomes Human Dog ~22,000 genes ~19,000 genes ~3.0 billion nucleotides ~2.4 billion nucleotides ~10 million SNPs Currently 600,000 SNPs 23 pairs of chromosomes 39 pairs of chromosomes
  3. 3. Individual -biology -genotype “Race” DISEASE is a crude proxy. Environment -diet, lifestyle -SES, exposures
  4. 4. “Race” as metapopulation is a complex composite variable • “Race” as generally understood and as used in biomedical research refers to both cultural and biological features of metapopulation groups. • “Race” is composed of: • Ethnic heritage – social component • Biogeographical ancestry – biological component • Interaction – social and biological components may affect each other in non-additive ways Section of Genetic Medicine THE UNIVERSITY OF CHICAGO
  5. 5. Why is “Race” Problematic? • Does not explain human biological variation. • Socio-cultural meanings and the colloquial use of the term. • Lack of discourse between disciplines. • When used as a causal genetic variable it perpetuates biological determinism. Section of Genetic Medicine THE UNIVERSITY OF CHICAGO
  6. 6. Is “Ancestry” better? • Useful index for human biological variation. • No historical baggage. • Increased discourse between disciplines. • When used as an index for genetic background it allows for a better investigation of biological risk factors. Section of Genetic Medicine THE UNIVERSITY OF CHICAGO
  7. 7. Era of Genomic Ancestry and challenges related to Health. 1. Group definition and membership. 2. Can we accurately assess genomic ancestry? 3. How does genomic ancestry relate to skin color and possibly SES? 4. How useful is genomic ancestry for informing us about disease risk? 5. Health Disparities: are they due to biological differences? 6. How do we prevent repeating the negative past abuses of “race”.
  8. 8. Promises in the post- genome sequencing era. 1. Advances in microarray and DNA chip technology. 2. Increased research in diverse populations. 3. Integration of epidemiological, cultural, and population history.
  9. 9. Section of Genetic Medicine THE UNIVERSITY OF CHICAGO
  10. 10. Divergence of human populations Mountain et al. 2002
  11. 11. Genetic variation among the major continents CD4 haplotype variation Tishkoff 2003 ARGHG
  12. 12. • Genetic variation is not randomly distributed. • Frequencies vary with age of allele. • Old = common across many populations • Recent = low frequency and localized • Population demographic history usually affects all loci similarly. • Natural selection acts upon specific loci. Section of Genetic Medicine THE UNIVERSITY OF CHICAGO
  13. 13. Prevalence of Hypertension by Mean Body Mass Index Among Populations of the African Diaspora 0.35 M ayw ood North America 0.30 Percent Hypertensive B arbados S t. Lucia 0.25 Jam aica Caribbean 0.20 C am eroon 0.15 N igeria West Africa 0.10 22 23 24 25 26 27 28 29 30 Cooper R, Rotimi C. et al. AJPH. 1997 B ody M ass Index
  14. 14. Alzheimer's Disease and APOE ε4 gene 6 5.6 5 4 3 Relative Risk 3 2 1.1 1 0 Japanese Caucasian African American Farrer LA, JAMA 1997
  15. 15. Alzheimer's Disease and APOE ε4 gene 20 19% 14% 15 9% Relative Risk 10 5.6 5 3 1.1 0 Japanese Caucasian African American Farrer LA, JAMA 1997
  16. 16. Influencing factors •Gene/gene and gene/environment interactions •Discrimination and perceived racism (stress process) •Accumulated stress (weathering, allostatic load, etc.) •Life course selection •Cultural factors •Behavioral differences •SES and institutional arrangement
  17. 17. Race (social) Disease Ancestry (genetic)
  18. 18. Genetic features of African Americans • High genetic heterogeneity due to African ancestry and admixture w/ non-African populations. • Increased LD due to admixture. • Pattern of variation differs geographically. • High levels of population stratification may confound association studies.
  19. 19. Ancestry Informative Markers (AIMs) • Genetic markers with large allele frequency difference (δ) between parental populations. • For biallelic markers δ = ⎜p1-p2 ⎜ • Single Nucleotide Polymorphisms (SNPs) or Deletion/ Insertion Polymorphisms (DIPs).
  20. 20. δ of AIM SNPs for West African/ Europeans Tian et al. (2006) AJHG
  21. 21. Biogeographical ancestry • Usefully accurate individual ancestry estimates possible using ancestry informative markers • Many populations show variation in individual ancestry levels • Ancestry estimates can be used to control for heterogeneity in admixed populations • Conditioning variable for regression models • Matching cases and controls • Bayesian Admixture Mapping
  22. 22. Plot of individual ancestry estimates using STRUCTURE (Falush et al. 2003) on 112 AIMs Bamileke (Cameroon) European Americans (MD) African Americans (DC) (23.2% European ancestry)
  23. 23. Individual Ancestry: Beyond Black and White African-American sample from Washington, D.C. (n=221) European-American sample from State College, PA (n=193)
  24. 24. Individual Ancestry: San Luis Valley, CO Hispanics Bonilla et al. (2004) Annals of Human Genetics 68:139-153.
  25. 25. Individual Ancestry: Puerto Rican Women from New York City Bonilla et al. (2004) Human Genetics 115:57-68.
  26. 26. European genetic contribution in African-American populations living in different geographical areas of the US. Parra et al. AJHG 1998; Parra et al. AJPA 2002; Kittles et al. unpublished
  27. 27. Genetic Ancestry in Caribbean Populations Jamaica: Closed circles Barbados: Open circles St. Thomas: Triangles
  28. 28. Race (social) Disease Ancestry (genetic)
  29. 29. PIA PIN Pca Nelson et al. Mechanism of Disease: Prostate Cancer. NEJM 349:4, 2003
  30. 30. Prostate cancer: epidemiology incidence rate per 100,000 men 300 250 200 ? 150 100 50 0 Asian/Pacific White Black Islander SEER data – 1998-2002 age adjusted
  31. 31. Population differences • Prostate cancer incidence. • Platz et al. 2000, JNCI, 92:24. • Advanced stage prostate cancer. • Hoffman et al. 2001, JNCI, 93:5. • Prostate cancer mortality. • Thompson et al. 2001, JNCI, 93:3.
  32. 32. Populations of African descent • Kingston, Jamaica (Glover et al. 1998). • ~300/ 100,000 men • evidence for familial Pca • Nigeria (Osegbe, 1997; Ogunbiyi and Shittu, 1999). • ~127/ 100,000 men • increased incidence not related to screening • Cameroon (Angwafo et al. 2003). • ~195/ 100,000 men • rural population from Dibombari (significant Pca and HGPIN)
  33. 33. Risk Factors for Prostate Cancer Positive family history is now considered the strongest risk factor for prostate cancer, especially early-onset disease (2 to 11-fold increased risk). Many genes have been implicated in hereditary and sporadic prostate cancer. Dietary risk factors include total fat intake, animal fat intake and consumption of red meat. Behavioral risk factors include smoking. Dietary components that protect against Pca include the antioxidants lycopene (common in tomatoes), vitamins A, D, and E, and selenium.
  34. 34. Heterocyclic Aromatic Amines • HCA - are small molecules formed when components of food proteins and creatine (components found in muscle) are exposed to high heat. » Grilling/ Barbecuing » Broiling » Pan Frying • PhIP - 2- Amino-1methyl-6phenylimidazo[4,5-b]pyridine - is a carcinogen “cancer causing”. Felton et al. 1986
  35. 35. Why the differences in prevalence? • Overall increased genetic susceptibility. • Increased androgen biosynthesis. • Strong environmental influences. • Diet, exercise, carcinogen and /or pathogen exposures • UVR exposure and Vitamin D. • Plasma Vitamin D levels influenced by UVR exposure, skin color, BMI, and diet • Lower UVR intensity in northern latitudes
  36. 36. Scragg et al. (2004) Serum 25- Hydroxyvitamin D, Diabetes, and Ethnicity in the Third National Health and Nutrition Examination Survey. Diabetes Care 27:2813–2818.
  37. 37. Garland et al. (2006) AJPH 96(2): 252-261
  38. 38. MODIFIERS OF VITAMIN D AND PROSTATE CANCER RISK LOW RISK HIGH RISK for Pca for Pca LIGHT DARK SKIN COLOR Luscombe et al. 2001 UVR High Moderate Low EXPOSURE Grant, 2002 DIETARY High LOW Vitamin D Vitamin D VITAMIN D intake intake GENETIC Protective Risk Genotypes Genotypes BACKGROUND
  39. 39. Relationship between plasma 25(OH)-Vitamin D levels and lifetime UVR exposure* in 260 African American men. P=0.008 *Based on UVQ (Harvey et al. 1996; Ramsay et al. 2000)
  40. 40. African American Hereditary Prostate Cancer (AAHPC) Study Royal, C. et al. Recruitment experience in the first phase of the African American Hereditary Prostate Cancer (AAHPC) study. Ann Epidemiol 10, S68-77 (2000). Powell, I.J. et al. African-American heredity prostate cancer study: a model for genetic research. J Natl Med Assoc 93, 25S-28S (2001). Ahaghotu, C. et al. Clinical characteristics of African-American men with hereditary prostate cancer: the AAHPC Study. Prostate Cancer Prostatic Dis 7, 165-9 (2004). • Recruit 100 informative AAHPC families • minimum of 4 clinically diagnosed males • age of onset less than or equal to 65 years • minimum of 8 family members • HPC only on 1 side of family • Find HPC genes
  41. 41. AAHPC Collaborative Recruitment Centers (1997-2004) Detroit Chicago New York Washington DC Atlanta South Carolina Houston
  42. 42. Candidate prostate cancer susceptibility genes with significant allele frequency differences between populations • SRD5A21 • COX-24 • CYP11A11 • EphB25 • GST-T1,GST-M1, GST-P11 • MSR18 • IGF-11 • RNASEL8 • IGFBP-31 • TRPV68 • Vitamin D receptor2 • CYP3A4 and CYP3A56,8 • Vitamin D binding protein2 • ICAM gene cluster7 • Androgen receptor3 1Nam et al. 2004; 2Kidd et al. 2004; 3Kittles et al. 2001; 4Panguluri et al. 2004; 5Kittles et al. 2005; 6Plummer et al 2003; 7Chen et al. 2006; 8unpublished
  43. 43. Revolution in genetics Colon Prostate Breast
  44. 44. Significance of identifying susceptibility genes • Improved diagnostics • better phenotype • early detection and prevention • pharmacogenomics • efficient designer drugs • avoid complications
  45. 45. Section of Genetic Medicine THE UNIVERSITY OF CHICAGO
  46. 46. UCCRC Diversity and Community Outreach Mission Statement The UCCRC is committed to building strong meaningful relationships with the surrounding community and recognizes the importance of education and trust in increasing participation of underrepresented communities in population research, clinical trials and basic research.
  47. 47. Efforts to Enhance Minority Accrual: Development of Southside Community Partnerships • DuSable Museum of African American History • Chicago Public Schools • Southside Farmer’s Markets • Southside Health Collaborative – UHI • Southside Health and Vitality Study (SSHVS)
  48. 48. Opportunities/ Future Directions Preparation of R25 - Cancer education grant “Community Curriculum on Cancer Disparities: Education and Action” January submission Partner with City Colleges Develop forums surrounding population-based research: HPV, vaccinations and Cervical Cancer (March 2009 – Ken Alexander) Marrow donors and transplantation Leverage our relationships with community health centers:
  49. 49. Summary African and Hispanic Americans are a socially, culturally, and genetically heterogeneous macro-ethnic group with diverse ancestries and continental U.S. experiences. Exhibit significant population substructure. Need to estimate genetic ancestral background to fully assess genetic and non-genetic confounders and predictors of complex diseases.
  50. 50. Summary Equitable benefits from genetic medicine depends on population genetics, market economics, and most importantly on historical and cultural identities. Inclusion means paying attention to context…. (social, cultural and historical)
  51. 51. Specifics… Take genetic ancestry into account in biomedical study designs (self-identified “Race” alone may be a confounder). Figure out effects (interaction) of “Race”/ skin color, racism and poverty on health disparities. Engage social scientists more to gain better appreciation and understanding of critical non-genetic (and genetic) variables which should also be explored.
  52. 52. University of Chicago Stanley Hooker Rebecca Santos, MPH Wenndy Hernandez, M.S. Nefertiti Oji-Njideka Hankui Chen, Ph.D. Jada Benn, Ph.D. Ohio State University Oxford University Cassandra Grenade Carolina Bonilla, Ph.D.
  53. 53. COLLABORATORS Howard University Johns Hopkins University Chiledum Ahaghotu, M.D. William Isaacs, Ph.D. Aaron Jackson, M.D. University of Illinois, Chicago Georgia Dunston, Ph.D. Vincent Freeman, M.D. Medical College of Georgia Liberia Sally Weinreich, Ph.D. Linda Sanvee, M.D. St. Thomas, Virgin Islands Cameroon Neil Garbutt, M.D. Fru Angwafo III, M.D. University of Louisville Nigeria La Creis Kidd, Ph.D. Usifo Osime, M.D. Penn State University Clement Adebamowo, M.D. Mark Shriver, Ph.D. Meharry Medical College Translational Genomics Flora Ukoli, M.B.B.S., MPH John Carpten, Ph.D. University of Washington Layron Long, M.D. FUNDING NIGMS, NCRR, NCI, ORMH, and NHGRI of the National Institutes of Health. Department of Defense
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×