Powerpoint

753 views
630 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
753
On SlideShare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
9
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • Death rates alone do not give a complete picture of the burden of cancer deaths. Another useful measure is person-years of life lost (PYLL) - the years of life lost due to early death from a particular cause. PYLL helps to describe the extent to which life is cut short by cancer. On average, each person who dies from cancer loses an estimated 15 years of life. PYLL due to cancer: The difference between the actual age of death due to a cancer and the expected age of death.
  • The years of life lost due to early death from a particular cause
  • The central dogma describes the concept of how genes lead to protein formation and cellular activity. Genes are transcribed into RNA which is then translated into protein. Proteins contain domains which are sequences that give the protein a specific function.
  • Cancer of the myeloid line of white blood cells Hematopoietic precursors are arrested in an early stage of development Interfere with normal blood cell development
  • Received induction therapy and consolidation chemotherapy with
  • Now that we have identified one of the genes involved in the translocation we were interested in determining NUP98s partner gene on chromosome 17p. This was performed by translocation breakpoint mapping. We know that the translocation occurred between TP53 and the subtelomeric probe at 17p13 – we created fluorescent probes from BACs spanning this region and hybridized it to the patients cells. Three BACs which are shown here helped determine the location of the breakpoint. 186b7 – shown in green was not involved in the translocation since we see both signals at the expected location. 4g17 – shown in orange was involved in the translocation since we see three signals instead of two – two signals on 17 and one on the translocated chromosome. 542c16 is also involved in the breakpoint since we also see three signals however this bac was not equally separated by the translocation. This schematic shows the relative position of the bacs involved in the translocation – based on this we know the translocation occurs here on the bacs.
  • Determining the BACs involved in this translocation allows us to identify candidate partner genes involved in the nup98 fusion gene. Component map with the location of the bacs and the corresponding genes in the genome. We utilized a candidate gene approach and from the translocation breakpoint mapping results as well as from its function we identified PHF23 as a candidate in the fusion.
  • MLL – myeloid/ lymphoid or mixed lineage leukemia; B melanoma antigen (expressed in tumors – tumor antigen) PHD finger has been recently recognized as a previously uncharacterized
  • Identification of potential interacting co-factors that could lead to new therapeutic targets.
  • Powerpoint

    1. 1. Characterization of a New Fusion Gene in Acute Myeloid Leukemia Jocelyn Reader Ph.D. Candidate in Human Genetics University of Maryland Baltimore Advisor: Dr. Yi Ning Feb. 28 th , 2007
    2. 2. Why a Ph.D. is for Me <ul><li>Educational and Scientific Research Experiences </li></ul><ul><li>Professoriate </li></ul><ul><li>Applied vs. Basic Research </li></ul><ul><ul><li>Basic research – research driven by scientist’s curiosity or interest in a scientific question </li></ul></ul><ul><ul><li>Applied research – research designed to solve practical problems rather than acquire knowledge for knowledge’s sake </li></ul></ul><ul><li>Career Goals and Options </li></ul>
    3. 3. Introduction <ul><li>Cancer genetics </li></ul><ul><li>Cytogenetics </li></ul><ul><ul><li>Studying the structure of chromosome material </li></ul></ul><ul><li>Cancer </li></ul><ul><ul><li>Leukemia </li></ul></ul><ul><ul><ul><li>Acute Myeloid Leukemia </li></ul></ul></ul>http://en.wikipedia.org/wiki/Image:Bcrablmet.jpg
    4. 4. Societal Impact of Cancer <ul><li>In 2007 </li></ul><ul><ul><li>~1.44 billion new cases of cancer expected </li></ul></ul><ul><ul><li>~560,000 deaths due to cancer in the U.S. </li></ul></ul><ul><ul><ul><li>> 1,500 people a day </li></ul></ul></ul><ul><ul><li>Leukemia </li></ul></ul><ul><ul><ul><li>New cases expected : 44,240 </li></ul></ul></ul><ul><ul><ul><li>Expected number of deaths : 21,790 </li></ul></ul></ul>American Cancer Society; National Cancer Institute
    5. 5. Societal Impact of Cancer <ul><li>Cancer is responsible for more estimated years of life lost than any other cause of death </li></ul><ul><li>Person-years of Life Lost </li></ul><ul><ul><li>The difference between the actual age of death due to a cancer and the expected age of death </li></ul></ul>
    6. 6. Background: DNA & Chromosomes http://www.genome.gov/Pages/Hyperion/DIR/VIP/Glossary/Illustration/chromosome.cfm?key=chromosome http://www.genome.gov/Pages/Hyperion/DIR/VIP/Glossary/Illustration/gene.cfm?key=gene
    7. 7. Background: The Central Dogma of Molecular Biology <ul><li>Concept of how genes lead to protein formation </li></ul><ul><li>Protein domains are sequences that give the protein a specific function </li></ul>http://fig.cox.miami.edu/~cmallery/150/gene/c7.17.12.domains.jpg
    8. 8. Background: Etiology of Cancer <ul><li>Cancer </li></ul><ul><ul><li>Uncontrolled growth of abnormal cells </li></ul></ul><ul><ul><li>Mutations in DNA sequence or gross chromosomal changes </li></ul></ul><ul><ul><ul><li>Usually occurring in tumor suppressor genes or proto-oncogenes </li></ul></ul></ul><ul><ul><ul><ul><li>Deletions or translocations </li></ul></ul></ul></ul>Campisi J. 2003. Nat Rev Cancer . 3:339-49. Chen Z, Sandberg AA. 2002. Am J Med Genet . 115:130-41.
    9. 9. Background: Tumor Suppressor Genes & Proto-oncogenes <ul><li>Gatekeepers </li></ul><ul><ul><li>Tumor Suppressors </li></ul></ul><ul><li>Proto-oncogene </li></ul><ul><ul><li>Typically involved in cellular growth </li></ul></ul><ul><ul><li>Can become an oncogene through several mechanisms </li></ul></ul>Campisi et al . 2003
    10. 10. Background: Chromosomal Alterations <ul><li>Types </li></ul><ul><ul><li>Deletions </li></ul></ul><ul><ul><li>Translocations </li></ul></ul><ul><li>Why study? </li></ul><ul><ul><li>Role in disease diagnosis, prognosis and treatment </li></ul></ul><ul><ul><li>Identification of new tumor suppressor genes or proto-oncogenes </li></ul></ul><ul><li>Outcome </li></ul><ul><ul><li>Loss of an important gene(s) </li></ul></ul><ul><ul><li>Create a new gene with a new function </li></ul></ul>Deletion
    11. 11. Background: Hematological Malignancies <ul><li>Hematological Malignancies </li></ul><ul><ul><li>Cancers that affect the blood, bone marrow and lymph node </li></ul></ul><ul><ul><li>Lymphoma and Leukemia </li></ul></ul><ul><li>Lymphoma </li></ul><ul><ul><li>Hodgkin’s disease </li></ul></ul><ul><ul><li>Non-Hodgkin lymphoma </li></ul></ul><ul><li>Leukemia </li></ul>
    12. 12. <ul><li>Leukemia </li></ul><ul><ul><li>Speed of cell growth </li></ul></ul><ul><ul><ul><li>Acute / Chronic </li></ul></ul></ul><ul><ul><li>Cell lineage </li></ul></ul><ul><ul><ul><li>Lymphoid / Myeloid </li></ul></ul></ul><ul><ul><ul><ul><li>Acute lymphoblastic </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Acute myeloid </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Chronic lymphoblastic </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Chronic myeloid </li></ul></ul></ul></ul><ul><li>Acute Myeloid Leukemia (AML) </li></ul><ul><ul><li>Arrests cells in early stage of development </li></ul></ul><ul><ul><li>Most common acute leukemia in adults </li></ul></ul>Background: Hematological Malignancies http://www.bloodlines.stemcells.com/img/Metcalf_Fig3_2.gif
    13. 13. Patient History <ul><li>42-year-old male patient with recurrent AML </li></ul><ul><li>Presented with a possible abnormality on 17p </li></ul><ul><li>4 months after last treatment – patient relapsed with same abnormality </li></ul>
    14. 14. Objectives & Experimental Design <ul><li>Identify/ verify the chromosomal anomaly in the patient </li></ul><ul><ul><li>Fluorescence in situ hybridization (FISH) </li></ul></ul><ul><li>Identify and characterize the genes involved in the chromosomal anomaly </li></ul><ul><ul><li>Molecular Genetic Techniques </li></ul></ul><ul><ul><ul><li>RT-PCR </li></ul></ul></ul><ul><ul><ul><li>Cloning and Sequencing </li></ul></ul></ul>
    15. 15. Molecular Cytogenetics & Genetics Techniques <ul><li>Fluorescence in situ hybridization (FISH) </li></ul>http://en.wikipedia.org/wiki/Image:FISH_%28technique%29.gif
    16. 16. PCR & RT-PCR <ul><li>Reverse transcriptase – polymerase chain reaction (RT-PCR) </li></ul><ul><ul><li>Start with RNA instead of DNA </li></ul></ul><ul><ul><li>First reaction use a RNA-dependent DNA polymerase </li></ul></ul><ul><ul><li>Make cDNA (complementary DNA) </li></ul></ul><ul><li>PCR products are visualized by agarose gel electrophoresis </li></ul><ul><li>Polymerase Chain Reaction (PCR) </li></ul>http://en.wikipedia.org/wiki/Image:Pcr.png#file
    17. 17. Cloning of DNA sequences http://employees.csbsju.edu/hjakubowski/classes/SrSemMedEthics/Human%20Genome%20Project/plasmid.gif
    18. 18. Identification and Characterization of a New Oncogenic Fusion Gene in Acute Myeloid Leukemia
    19. 19. FISH Analysis on 17p <ul><li>FISH Analysis </li></ul><ul><ul><li>TP53 not affected </li></ul></ul><ul><ul><li>Sub-telomeric probe shows translocation to 11p </li></ul></ul>TP53 (Orange) 17p13.2 (Green)
    20. 20. Identification of a Candidate Gene for the 11;17 Translocation <ul><li>NUP98 </li></ul><ul><ul><li>11p15.5 </li></ul></ul><ul><ul><li>Protein that forms part of nuclear pore complex </li></ul></ul><ul><li>Promiscuous fusion partner gene plays a role in hematological malignancies </li></ul>http://www.infobiogen.fr/services/chromcancer/Genes/NUP98.html
    21. 21. Identification of NUP98s Involvement in 11;17 Translocation <ul><li>Created two probes that contained sequence from the 5’ and 3’ end of the NUP98 gene </li></ul><ul><li>No involvement </li></ul><ul><ul><li>Fused signal </li></ul></ul><ul><li>Involvement </li></ul><ul><ul><li>Split signal </li></ul></ul>Nup98 cen (Green) Nup98 tel (Orange)
    22. 22. Translocation Breakpoint Mapping on 17p RP1-4G17 RP11-542C16 RP11-186B7 (Green) RP1-4G17 (Orange) RP11-542C16 (Green)
    23. 23. NUP98 Fusion Gene Partner Candidate Gene <ul><li>Candidate Gene </li></ul><ul><ul><li>PHF23 </li></ul></ul>Modified from NCBI Map Viewer http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi?taxid=9606&query=542c16&qchr=&strain=All&advsrch=off Component Map RP11-542C16 RP1-4G17
    24. 24. RT-PCR Amplification and Sequence Analysis of NUP98 - PHF23 Fusion Transcript <ul><li>Create DNA primer for NUP98 and PHF23 gene </li></ul><ul><li>RT-PCR Amplification and visualization </li></ul><ul><li>Clone PCR product </li></ul><ul><li>Perform sequence analysis </li></ul><ul><li>NUP98-PHF23 Gene Fragment </li></ul><ul><li>Full-length NUP98-PHF23 Fusion Gene </li></ul>NUP98 - PHF23 5’- CCGATGTCAGACCCTAAGAAGAAGGAAGAG GCCCCCGACAGTGCTACCTTGCTTGAGAAG -3’ P M S D P K K K E E A P D S A T L L E K
    25. 25. Schematic of Normal and Predicted Proteins <ul><li>NUP98-PHF23 fusion protein combination of NUP98 and PHF23 proteins </li></ul><ul><ul><li>Predicted to have a function different from the normal proteins </li></ul></ul>COOH NH 2 FG FG GLEBS NUP98 920 aa NUP98-PHF23 FG GLEBS FG NH 2 COOH PHD 797 aa 403 aa NH 2 COOH PHF23 PHD Normal and Fusion Proteins RNP binding domain
    26. 26. PHF23 <ul><li>PH D F inger Protein 23 </li></ul><ul><li>PHD motif </li></ul><ul><ul><li>P lant H omeo d omain Finger </li></ul></ul><ul><ul><li>Involved in regulating transcription </li></ul></ul><ul><li>Additional fusion genes leading to AML contain PHD domains </li></ul><ul><ul><li>NUP98-NSD1 </li></ul></ul><ul><ul><li>NUP98-NSD3 </li></ul></ul>Jaju RJ, et al . 2001. Blood 98:1264-7. Rosati R, et al . 2002 Blood 99:3857-60. NUP98/NSD3 NH 2 COOH PHD
    27. 27. Summary and Conclusions <ul><li>Summary </li></ul><ul><ul><li>Types and causes of leukemia </li></ul></ul><ul><ul><li>Identified a novel fusion gene </li></ul></ul><ul><li>Conclusion </li></ul><ul><ul><li>Why study this fusion gene </li></ul></ul><ul><ul><ul><li>Possible common mechanism of action for these cancer causing genes </li></ul></ul></ul><ul><ul><ul><li>New therapeutic drug targets </li></ul></ul></ul><ul><ul><ul><li>Application to other cancers </li></ul></ul></ul><ul><li>Future Directions </li></ul><ul><ul><li>Verify oncogenicity of fusion gene </li></ul></ul>
    28. 28. Acknowledgements <ul><li>Dr. Yi Ning – Advisor </li></ul><ul><li>Clinical Cytogenetics Laboratory – University of Maryland Baltimore </li></ul><ul><li>PROMISE </li></ul><ul><li>Program in Human Genetics </li></ul><ul><li>Marlene and Stewart Greenebaum Cancer Center </li></ul>

    ×