• Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
475
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
11
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Beef Cattle Production Management Series (2008) Introduction to Biotechnology Part I GPVEC July 31st 2008 Clay Center, NE Jim Bono, PhD Microbiologist US Meat Animal Research Center Clay Center, NE
  • 2. Overview of Parts I and II Part I Biotechnology, GMOs, and Genetic Engineering Molecular Genetics (DNA, RNA, and Proteins) Part II Applied Molecular Genetics DNA extraction Cloning DNA libraries Polymerase Chain Reaction (PCR) DNA sequencing Single Nucleotide Polymorphism (SNP) Microarrays
  • 3. Biotechnology is the application of scientific techniques to modify and improve plants, animals, and microorganisms to enhance their value. Biotechnology Agricultural biotechnology is the area of biotechnology involving applications to agriculture. Agricultural biotechnology has been practiced for a long time, as people have sought to improve agriculturally important organisms by selection and breeding. An example of traditional agricultural biotechnology is the development of disease-resistant wheat varieties by cross-breeding different wheat types until the desired disease resistance was present in a resulting new variety. http://www.ctahr.hawaii.edu/gmo/intro/
  • 4. In the 1970s, advances in the field of molecular biology provided scientists with the ability to readily transfer DNA — the chemical building blocks that specify the characteristics of living organisms - between more distantly related organisms. Today, this technology has reached a stage where scientists can take one or more specific genes from nearly any organism, including plants, animals, bacteria, or viruses, and introduce those genes into another organism. This technology is sometimes called genetic engineering . An organism that has been modified, or transformed, using modern biotechnology techniques of genetic exchange is referred to as a genetically modified organism (“ GMO ”). Genetic Engineering & GMO Roundup herbicide resistance Insect resistance ( Bacillus thuringiensis ) Insulin production Enviropig (low phosphorus manure - phytate - phytase) http://www.ctahr.hawaii.edu/gmo/intro/
  • 5. Which bull would be the best sire? Can you tell by their appearance?
  • 6. Which bacteria is pathogenic to humans? pathmicro.med.sc.edu www.biology.iupui.edu Can you tell by their appearance?
  • 7. “ Genetic Playbook” www.petecarroll.com http://www.kursus.kvl.dk/shares/vetgen/_Popgen/genetics/10/10/sld003.htm
  • 8. All living organisms have DNA
  • 9. Genome = all genetic material in a cell Chromosomes Chromosome Plasmid/s Genome Eukaryotes Prokaryotes
  • 10. Deoxyribonucleic acid (DNA)
  • 11. Deoxyribonucleic acid (DNA) Nucleotides or bases Adenine - A Cytosine - C Guanine - G Thymine - T
  • 12. Deoxyribonucleic acid (DNA)
  • 13. http://en.wikipedia.org/wiki/DNA Deoxyribonucleic acid (DNA) Nucleotide or base Major groove Minor groove Phosphate-deoxyribose backbone Double Helix
  • 14. DNA Replication Spontaneous mutation Point mutation Insertion Deletion 1 error per 1,000 bacterial replication cycles
  • 15. A gene is a locatable region of genomic sequence, corresponding to a unit of inheritance, which is associated with regulatory regions, transcribed regions and/or other functional sequence regions. A gene is a union of genomic sequences encoding a coherent set of potentially overlapping functional products". A gene is often used to refer to an inheritable trait which is usually accompanied by a phenotype as in ("tall genes" or "bad genes") Gene Historically: “ One gene, one Protein” eae cesT tir L0028 L0029
  • 16. Gene content of various organisms 50,000 Oryza sativa 29,000 Mus musculus 27,000 Homo sapiens 25,500 Arabidopsis thaliana 23,300 Sea urchin 19,000 Caenorhabditis elegans 13,700 Drosophila melanogaster 5,800 Saccharomyces cerevisiae 4,400 Escherichia coli 2,300 Streptococcus pneumoniae 500 Mycoplasma genitalium Number of genes Species
  • 17. ATG TAA AATAA TATA (-30) I 5’-UT E E 3’-UT Promoter * * 5’ 3’ Model Gene EXONS INTRON Coding or Sense strand TATA - Promoter element ATG - Translational start codon TGA, TAA, TAG - Translational stop codon AATAA - Polyadenylation signal * - Transcriptional initiation /termination sites Typically, cartoon renderings reflect only the single, “sense” strand, but realize there is always also a complementary strand. (Exons contain protein coding sequence, bacterial genes don’t have introns)
  • 18. Protein Biosynthesis GGATCGGCTAGCTG……...CTACATAGCTAT GGAUCGGCUAAGCUAU Gly-Ser-AlA-………….. Gene mRNA Protein Transcription Translation
  • 19. Transcription Making a copy of the gene that can be used for translation Protect the DNA Uracil (U) instead of Thymine (T) RNA polymerase reads the nucleotide sequence of the gene and makes a single stranded messenger RNA (mRNA) http://www.dnai.org/a/index.html
  • 20. Translation Process of making a protein from the mRNA Changing language from nucleotides to amino acids Ribosome is responsible for reading the mRNA and making the protein Translational start – ATG Translational stop – TAA, TGA, TAG 3 nucleotides are called a codon Each codon codes for a specific amino acid – 20 amino acids http://www.dnai.org/a/index.html
  • 21. The Genetic Code DNA Codon mRNA Codon Encoded Amino Acid
  • 22. The Genetic Code F.W. Nicholas, 1996, Introduction To Veterinary Genetics. Oxford Univ. Press Transfer RNA (tRNA) Anti-codon
  • 23. Protein Amino(N)-terminus Carboxyl(C)-terminus DNA synthesized 5’-3’ Protein synthesized amino - carboxyl
  • 24. Eukaryotic Protein Biosynthesis ATG TAA AATAA TATA (-30) Intron 5’-UT Exon 1 Exon 2 3’-UT Promoter TATA - Promoter element ATG - Translational start codon TAA, TGA, TAG - Translational stop codon AATAA - Polyadenylation signal 5’-UT Exon 1---Exon 2 3’-UT mRNA Gene Transcription AAAA Pre-Protein Translation (@ ribosomes & tRNA) * * - Transcriptional initiation /termination sites * * * 5’ 3’ 5’ 3’ N-terminus C-terminus (In nucleus) (In cyctoplasm)
  • 25. Homework Design you own gene Promoter element Translational start codon Translational stop codon Polyadenylation signal Transcriptional initiation /termination sites Intron Double stranded DNA
  • 26. Met Pro Ile Gly Asn tataa gaagatc taggaaaggagagattt ATG CCT ATT GGT AAC atattcttctagatcctttcctctctaaa TAC GGA TAA CCA TTG Asn Val Leu Gly Stop cttggtcataatccc AAT GTG CTT GGT TAA gaagatct aata gaaccagtattaggg TTA CAC GAA CCA ATT cttctagattat a gggatgcatccc tccctacgtaggg Homework example Legend tataa – Transcriptional initiation signal taggaaaggagagattt – 5’ UTR ATG – Translational start cttggtcataatccc – intron TAA – Translational termination gaagatct – 3’ UTR aataa – polyadenylation signal
  • 27. Beef Cattle Production Management Series (2008) Introduction to Biotechnology Part II GPVEC July 31st 2008 Clay Center, NE Jim Bono, PhD Microbiologist US Meat Animal Research Center Clay Center, NE
  • 28. Overview of Parts I and II Part I Biotechnology, GMOs, and Genetic Engineering Molecular Genetics (DNA, RNA, and Proteins) Part II Applied Molecular Genetics DNA extraction Cloning DNA libraries Polymerase Chain Reaction (PCR) DNA sequencing Single Nucleotide Polymorphism (SNP) Microarrays
  • 29. DNA extraction Important to have clean DNA for further experiments “ dirty” prep can have contaminates that inhibit enzymatic processes Agarose gel electrophoresis
  • 30. http://www.accessexcellence.org/RC/VL/GG/plasmid.php http://student.britannica.com/comptons/art-90884/DNA-sequences-can-be-cut-in-two-ways?&articleTypeId=31 Cloning
  • 31. Restriction endonucleases Enzymes that cuts double-stranded DNA following its specific recognition of short nucleotide sequences, known as restriction sites, in the DNA 5'---GAT ATC---3' 3'---CTA TAG---5' 5'GATATC 3'CTATAG Escherichia coli Eco RV* 5'---G GATCC---3' 3'---CCTAG G---5' 5'GGATCC 3'CCTAGG Bacillus amyloliquefaciens Bam HI 5'---G AATTC---3' 3'---CTTAA G---5' 5'GAATTC 3'CTTAAG Escherichia coli Eco RI Cut Recognition Sequence Source Enzyme
  • 32. Ligase An enzyme that can link together two DNA strands that have single-strand breaks, i.e. DNA cut with a restriction endonuclease.
  • 33. http://www.accessexcellence.org/RC/VL/GG/plasmid.php http://student.britannica.com/comptons/art-90884/DNA-sequences-can-be-cut-in-two-ways?&articleTypeId=31 Cloning
  • 34. DNA libraries Genomic library:  Contains entire DNA content of an organism                                 Suitable for determining genomic DNA sequence                                Requires chromosomal DNA isolation cDNA library:  Contains entire protein- encoding DNA content                           Messenger RNA used as a starting material                           Messenger RNA reverse transcribed into cDNA                           Requires mRNA isolation
  • 35. Polymerase Chain Reaction (PCR) www.mun.ca/biology/scarr/PCR_sketch_3.gif PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. DNA cloning for sequencing DNA-based phylogeny functional analysis of genes diagnosis of hereditary diseases identification of genetic fingerprints (used in forensic sciences and paternity testing) detection and diagnosis of infectious diseases.
  • 36. In 1989 Science Magazine named Taq polymerase its first "Molecule of the Year". Kary Mullis received the Nobel Prize in 1993, the only one awarded for research performed at a biotechnology company. Taq polymerase Chien A, Edgar DB, Trela JM (1976). "Deoxyribonucleic acid polymerase from the extreme thermophile Thermus aquaticus". J. Bact. 174: 1550–1557 http://www.yellowstone.net/geysers/thermalfeatures.htm en.wikipedia.org
  • 37. DNA sequencing The process of determining the exact order of the nucleotides/bases (A, T, C, and G) that make up the DNA of an organism. Gene number, exact locations, and functions Gene regulation DNA sequence organization Chromosomal structure and organization Noncoding DNA types, amount, distribution, information content, and functions Coordination of gene expression, protein synthesis, and post-translational events Interaction of proteins in complex molecular machines Predicted vs experimentally determined gene function Evolutionary conservation among organisms Protein conservation (structure and function) Proteomes (total protein content and function) in organisms Correlation of SNPs (single-base DNA variations among individuals) with health and disease Disease-susceptibility prediction based on gene sequence variation Genes involved in complex traits and multigene diseases Complex systems biology including microbial consortia useful for environmental restoration Developmental genetics, genomics
  • 38. Roche FLX 454 100 million bases per chip $6,000 1 week from DNA extraction to sequence data E. coli genome 5.5 million bases – a 454 run will give an 18x coverage Human genome 3 billion base – 30 runs would give a 1X coverage ABI 3730 (384 well plate) 422 thousand bases per plate 9 plates = $6,000 4 million bases 2 weeks from DNA extraction to sequence data New Sequencing technologies
  • 39. Single Nucleotide Polymorphism (SNP) DNA sequence variation occurring when a single nucleotide - A, T, C, or G - in the genome (or other shared sequence) differs between members of a species (or between paired chromosomes in an individual). Not all SNPs cause a phenotypic change 50K SNP chip – interrogates 50,000 SNP Parentage Association of disease traits –FPT Heaton MP, Harhay GP, Bennett GL, Stone RT, Grosse WM, Casas E, Keele JW, Smith TP, Chitko-McKown CG, Laegreid WW. Selection and use of SNP markers for animal identification and paternity analysis in U.S. beef cattle. Mamm Genome. 2002 May;13(5):272-81. Clawson ML, Heaton MP, Chitko-McKown CG, Fox JM, Smith TP, Snelling WM, Keele JW, Laegreid WW. Beta-2-microglobulin haplotypes in U.S. beef cattle and association with failure of passive transfer in newborn calves. Mamm Genome. 2004 Mar;15(3):227-36.
  • 40. 0 5 10 15 20 25 30 35 100 0 0 100 91 89 87 100 0 0 0 0 0 0 0 0 0 100 97 94 95 78 bovine bovine bovine bovine bovine bovine bovine bovine human human human human bovine bovine human bovine bovine bovine human bovine human bovine human SNPs in E. coli O157:H7 Ability to predict those isolates which can cause disease in humans B. Finlay KS368 KS546 TX265 TX723 NE972 NE1370 CO50 TX376 Mass2 EDL 931 1271-84 EDL 933 CO147 CO713 IDPH31277 MARC611 NE1124 TW04863 WRRC1 NE1270 Sakai TW05356 3526-87
  • 41. SNPs paternal chromosome maternal chromosome … aatggtatc T attaatgctt… … aatggtatc T attaatgctt… individual #3: individual #2: paternal chromosome maternal chromosome … aatggtatc A attaatgctt… … aatggtatc A attaatgctt… Exon 3 Exon 1 Exon 2 Exon 4 gene SNP paternal chromosome maternal chromosome … aatggtatc A attaatgctt… … aatggtatc T attaatgctt… individual #1: T/T DNA trace files A/A A/T T/T 5100 5400 5700 A/A MALDI-TOF spectra A T
  • 42. Many different technologies for SNP interrogation Biotrove Affymetrix Illuminia Sequenome Real-time PCR
  • 43. DNA Microarrays A high-throughput technology that consists of an arrayed series of thousands of microscopic spots of DNA oligonucleotides of a specific DNA sequence. This can be a short section of a gene or other DNA element that are used as probes to hybridize DNA or cDNA sample (called target) under high-stringency conditions. Probe-target hybridization is usually detected and quantified by fluorescence-based detection of fluorophore-labeled targets to determine relative abundance of nucleic acid sequences in the target.
  • 44. Hybridization is the process of combining complementary, single-stranded nucleic acids into a single molecule. Hybridization mRNA expression SNPs Gene content DNA microarrays http://www.bio.davidson.edu/Courses/genomics/chip/chip.html ...ATGCATGCATGCATGC... ...TACGTACGTACGTACG*.. :::::::::::::::: Perfect- ...ATGCATGGGTGCATGC... ...TACGTACGTACGTACG*.. ::::::: ::::::: Imperfect- ...ATGCATG TGCATGC... ...TACGTACGTACGTACG*.. ::::::: Imperfect- G G T T G :::::::
  • 45. Homework Describe PCR in your own words and pictures Describe a potential application for SNP genotyping in veterinary medicine or beef production
  • 46. http://www.blackwellpublishing.com/trun/artwork/Animations/cloningexp/cloningexp.html http://www.dnai.org/ http://dynamicgene.dnalc.org/structure/structure.html Websites