• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Genetics 101 April 23, 1953
 

Genetics 101 April 23, 1953

on

  • 242 views

 

Statistics

Views

Total Views
242
Views on SlideShare
242
Embed Views
0

Actions

Likes
0
Downloads
1
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • [Comment: Comments to help you are presented in these notes sections in brackets preceded by the word ‘Comment:’. Suggested script is not in brackets.] [Comment: There are many resources available on the net to make your visit to the school easy and fun. Primarily you want to be sure your excitement about genetics shines through - and that the students can relate to what you are saying - be yourself - the slides presented here are to help you do that - but feel free to modify them as you need. Be sure to visit http://www.geneticalliance.org/diseaseinfo/EduResources.html and http://www.genome.gov/10506367 and http://www.jgi.doe.gov/ ] April 25, 2003 - DNA DAY was proclaimed by Congress during April - which was declared Genome Month. You may or may not be doing this on April 25 - that is fine - you can refer to the historic proclamation and use relevant pieces of this presentation. Please mention the Genetic Alliance since this presentation is offered as a service to Genetic Alliance members - we are an international coalition of over 600 disease support group and genetics professionals working on genetics education, ethics, information, outreach and policy. Membership is free - visit the website for more information and resources.
  • DNA Day (or Genome Month) celebrates two things - the first is the 50th anniversary of the discovery of James Watson and Francis Crick of the structure DNA Helix. April 25, 1953 - [Comment: here tell as much of this story as you wish: resources - The Double Helix, James Watson (easy to read and entertaining) http://www.pbs.org/wgbh/aso/databank/entries/do53dn.html http://www.time.com/time/time100/scientist/profile/watsoncrick.html http://biocrs.biomed.brown.edu/Books/Chapters/Ch%208/DH-Paper.html - the actual 1953 paper http://www.nsta.org/jcst/ http://www.biotechinstitute.org/]
  • The Human Genome project announced completion on April 14, 2003. Now we enter a new era - the Genomic Era… an age where these new discoveries will contribute to benefits for human health. This is an event built on the discovery of the structure of the double helix - an incredible stride forward right in our lifetime!
  • To make sense of these two very special events - we must understand DNA.
  • Here is a picture of the cell - and it is within the cell that we will find DNA. Let’s start by looking at the genetic information that is passed down from generation to generation. Some of you might recognize this image that looks like a twisted ladder. This is a drawing of DNA. DNA is the genetic material that is present in almost every cell in our bodies, and DNA is what is passed down from parents to child. In the cell, DNA is the pink barbell shaped rods. You can see that when your stretch DNA out, it has a special structure, like a twisted ladder. Each rung of the ladder is made up of pairs of chemicals called bases and these rungs make up a special code that tells the body how to make certain things such as insulin, or how to grow hair. A strand of DNA is very long (here show a string) and contains the code for many different substances. If we look at just one strand of the DNA that codes for one particular substance, that is called a gene. Humans have all the same genes. That is to say, we all have DNA segments that are meant to code for certain substances. All of the genes in a cell make up a human genome. So the Human Genome Project is identifying all the genes that any and all people have. What makes us different from each other are the slight changes in the code within each segment, or gene.
  • So, what is DNA, anyway?      DNA is a long fiber, like a hair, only thinner and longer.  It is made from two strands that stick together with a slight twist. Cells divide regularly in order to reproduce. When they get ready to divide, proteins attach to the DNA and help the strands coil up into a chromosome. The DNA is organized into stretches of genes, stretches where proteins attach to coil the DNA into chromosomes, stretches that "turn a gene on" and "turn a gene off", and large stretches whose purpose is not yet known to scientists. The genes carry the instructions for making all the thousands of proteins that are found in a cell.  The proteins in a cell determine what that cell will look like and what jobs that cell will do.  The genes also determine how the many different cells of a body will be arranged.  In these ways, DNA controls how many fingers you have, where your legs are placed on your body, and the color of your eyes. So, what's the difference between DNA and a chromosome? A chromosome is made up of DNA and the proteins attached to it.  There are 23 pairs of chromosomes in a human cell.  One of each pair was inherited from your mother and the other from your father.  DNA is a particular bio-molecule.  All of the DNA in a cell is found in individual pieces, called chromosomes.  This might be like a town. So a State might be made up of 46 (23 pairs) towns. And the genes might be considered neighborhoods in the town - stretches along the street where we know there are occupied houses - all part of one project, or complex. But then there are some houses that seem not to belong to any neighborhood.
  • We said the human genome project is finished - what was it?
  • This incredibly unique collection of scientists from all over the world worked together, met weekly via conference call (on Fridays at 11 AM EST despite being spread over 20 time zones) and freely and immediately released their data for anyone in the world to use via the worldwide web. You can put the words “genome browser” into any search engine such as Google - and you will be able to access sites that allow you to walk through the genome letter by letter, base by base…
  • There are so many base pairs that if your class decided to read them from Chromosome 1 through to the end, and found it so intriguing that you stayed at it continuously, nights and weekends, it would take your class 32 years to read all of the letters!
  • Many nations spent many years and much money trying to decipher the code - why is it so important to know the sequence of the human genome?
  • Although there are certainly many reasons to know something just for the sake of knowing, this project was done with the expressed purpose of understanding more about human health and disease.
  • You may have heard about genetics on television or read about some discoveries in magazines or newspapers. The discoveries made in genetics over the past twenty or so years have been applied to many different fields including: --In veterinary medicine and breeding of cats and dogs --Breeding of animals with certain characteristics, such as chickens that have more meat --alteration of crops such as tomatoes that don’t spoil as quickly --for cloning identical animals to create drugs that save some people’s lives
  • Genetics has also been used in --criminal investigations to help identify who was and who was not involved in a crime --to identify relationships between different people --to determine causes of disease and develop new ways to treat diseases, including gene therapy --for genetic testing to determine if a person has inherited a particular disease.
  • As we try to understand the importance of the code, it is important to start with a person. Each of us has two copies of every gene. We inherit one copy from our father and one from our mother. Each copy codes for the same thing, but the copies are often somewhat different from each other. [Comment: here you should begin to relate why genetics is personally important to you - the students will be engaged by your story]
  • Traits can refer to either things like hair color, or height, or to disease. We’ll look at a disease - Sometimes having just one changed copy of the gene causes disease, even though the other copy is fine. On this slide, the people who are purple are healthy. Those that are yellow are affected or have the disease. Because this mother has one working and one changed copy of the gene, half her children will receive the changed copy of the gene and so there is 50/50 chance that each of her kids will inherit this disease. There are several diseases like this. One you may have heard about is Huntington’s disease, a disease that affects the nervous system of adults. If a person inherits just one copy of the gene that causes Huntington’s disease from one of his or her parents, then that person will develop the disease.
  • Other genes work differently. As you can see in this slide, both of the parents have one copy of a changed gene and one copy of an unchanged gene. Yet they are not affected by the disease. But there is a chance that when these two people have children, a child might inherit a change copy from the mother and a changed copy from the father and have the disease. This child is shown in yellow and is affected. Some of their children might also inherit just one changed copy of the genes like the parents. A person who has just one copy of a changed gene and who doesn’t have the disease is called a carrier because they carry the changed gene but don’t have the disease. Examples of diseases where people can be healthy carriers are: sickle cell disease which causes health problems due to a different shape in the blood cells, and cystic fibrosis, a disorder that causes breathing and digestion problems.
  • Our own genetic story is revealed in our family history - it can be fun to know that history and it can also be helpful to our own understanding of our health and disease.
  • This is a diagram that geneticists and genetic counselors like to use to describe a family - this is a silly one made up by the Genetic Science Learning Center at the University of Utah. When individuals afflicted with Whirling Disorder hear old Rolling Stones tunes, even remade as Muzak, they let loose and dance uncontrollably. This is a large family in which some individuals have the disorder, and others don't. You can probably tell the pattern of inheritance for this condition. [Comment: you can encourage students to draw their own pedigree - you can pass out the Family History Brochure resource found on the Genetic Alliance web site - at http://www.geneticalliance.org/FamilyHistoryBrochure.html. (coming April 23). It isn’t a bad idea to interrupt your presentation and have the students draw a pedigree at this point to break up the activities…]
  • So it is great to understand DNA, understand genes and to understand family history - but what does it all matter?
  • All of this information must be translated into technologies and treatments in order to improve human health. We will touch on just a few of these new genetics applications. [Comment: you can read these next slides as lists and leave it at that, or you can read some of the examples of these as written below, or you can research some of them and present much more information, even over several days. You can take a pdf version of a genetic glossary with you to the class - http://www.geneticalliance.org/geneticissues/mediainfo/glossary.html] [Comment: You can look up all of the diseases I mention using the Genetic Alliance web site.] Prenatal screening - Screening the fetus for genetic conditions - for example - Down’s syndrome is caused by something called trisomy 21 - having three of chromosome 21. Newborn screening - something done in all 50 states for diseases like PKU and Galactosemia - you can look each state up on the National Newborn Screening and Genetics Resource Center website - http://genes-r-us.uthscsa.edu/resources/newborn/screenstatus.htm. Genotyping - What are the mutations in a gene? Predictive testing - do you have the genetic mutation associated with Alzheimer's or Huntington’s disease? Prognostic testing - what is the prognosis - do certain mutations in the gene cause certain expressions of the disease - more severe disease or less severe disease? Cancer profiling - a great deal of work is being done in this - using arrays of genes - one can begin to understand what is different from one cancer tumor to the next - what genes are overexpressed, or underexpressed and eventually what does this mean with regard to the progression of the cancer, possible reoccurrence and perhaps what treatments might be more effective… here is an example for a pediatric cancer: http://www.prnewswire.com/broadcast/5195/5195_consumer.html Infectious disease testing - viral load for HIV testing has been refined with genetic testing, as has resistance to drugs - here is an example press release: http://www.hsph.harvard.edu/press/releases/press03192001.html about this.
  • Because of our understanding of DNA and genes we are now able to begin to think about interventions for diseases, about treating disease and about therapies for disease. Two examples of this are: Pharmacogenomics - changing drugs, or drug dosage, based on a person’s genotype - understanding who will benefit from a drug or treatment - for example, some women with breast cancer have a receptor for estrogen on the tumor that allows the use of a drug called Herceptin, and combats the cancer by targeting the receptor - you can read more here: http://www.herceptin.com/
  • DNA testing on missing persons in Argentina, on remains in wars and disasters, like the World Trade Center bombing, and for proving someone was or wasn’t at a crime scene are all examples of forensic applications. You can mention Saddam Hussein and Osama bin Laden…
  • And DNA can be used for non-medical things - Paternity - to prove someone is or is not the father of a child Evolution - both human and non-human - all sorts of fascinating applications - knowing the family tree of a squid, as well as what led to higher life forms - for a great web site of evolutionary trees see: http://evolution.genetics.washington.edu/phylip.html Comparative genomics - comparing our genome to that of other animals and plants - what does the same gene do in different life forms - what genes do we have that other animals do not, what genes are no longer used by humans but are used by other animals or plants? For more information: http://www.ornl.gov/TechResources/Human_Genome/faq/compgen.html Human History - we can tell through our DNA where humans migrated throughout human history - some terrific resources are Steve Olson’s book - Mapping Human History; and the PBS series The Journey of Man, available from Amazon.com
  • All of these interesting ways that genetics will enter our lives must also cause you to pause and think about how they will change our lives in other ways. Some of the impact will be felt in what is called the Ethical, Social and Legal Implications of this research.
  • [Comment: Whew! Your class will probably have picked up on some of these issues as you discussed other issues - and you can delve into these as deeply as you wish - a great time for some role playing…] Privacy and Genetic Nondiscrimination - check out the Genetic Alliance website on this - http://www.geneticalliance.org/GND_Respage.html Who can use our genetic information, can we be discriminated against for having a predisposition for a disease or a symptom of a disease? Are there laws against this - for employment or health insurance? Disparities - will everyone have access to these terrific new technologies? Will any of this information stigmatize the groups of people it comes from? Human Research Participant Protections - people who participate in research need strong protections - for example - informed decision making about whether to participate and what their rights will be during the course of the project. You can read about African Americans and the horrendous treatment they received in the course of a highly unethical research project - http://www.scils.rutgers.edu/~lyonsm/tuskegeelinks.html Reproductive decision making - there are many ethical considerations when one considers testing embryos for sex, disease, or compatibility with other siblings who have a disease - you can read about these issues at this website: http://www.dnapolicy.org/ Enhancement - genetically modifying a muscle will create all sorts of issues for sports authorities - http://www.cnn.com/2002/HEALTH/diet.fitness/02/20/engineered.athletes/ And the prospect of eventually being able to modify behavior - intelligence, aggression will have many ethical issues associated with it…
  • It is important to consider, as you are considering your future, various careers. Let’ s look at who does this research and who delivers these services:
  • [Comment: These you can just name and give examples of or you can bring one or more with you into the classroom - and you should not hesitate to mention lay advocacy leaders if that is your experience of this] Researchers - working in universities, for the government and for industry - working on all sorts of issues from basic science to developing drugs Clinicians - doctors, genetic counselors, nurses, therapists… all sorts of people who deliver healthcare services Ethicists - people working on the ethical concerns - working in bioethics, religion, psychology, ethics, theology, sociology, history, anthropology… Policy Makers - legislators, legislative aids, lobbyists, political scientists working to define law and policy issues [Comment: Here, if I were an advocacy group leader, I would add- and I work in genetics in a meaningful way that doesn’t fit any of these categories - I provide education, support, information to people who have a genetic condition. I also initiate, conduct and coordinate research on that condition. You can describe your work here to whatever degree you are comfortable.]
  • Then - after we have the science, and the various stakeholders have thought about it - who make decisions about how we use new technologies in an ethical and productive manner?
  • You! Your family - in the community with your legislators…
  • Informed decision making only happens in the context of the family, connected to the in community, with the research and health enterprises founded on strong policy! [Comment: you can give examples of how work in genetics without considering the cultural context and the communities wishes can be detrimental to the community - reproductive technology and evolution in fundamentalist Christian communities, associating diseases with a community in a stigmatizing way - breast cancer and Tay Sachs with the Jewish community, Sickle Cell Disease in the African American Community…]
  • Welcome to the Genome Era! We hope that these advances and discoveries will help us promote healthy lives.

Genetics 101 April 23, 1953 Genetics 101 April 23, 1953 Presentation Transcript

  • Genetics 101
  • April 23, 1953 Watson & Crick’s discovery of the DNA helix
  • Completion of the Human Genome Project April 14, 2003 GGCACGAGGGTAAATATGGCATAAGTTAATAACA CTTTTCCCCAAAATGGTGCTTTGGATTTGAAAAGG GTCTGATGGGGAGAAGGAGAACGTATCATCCTAGC TTCCTCTCTTAATAAACCTAGAAAAACGGGTAGTA AACTGTGGATAGTCAGGAAAACACCCAGCAAGGGA CACAGC TGTCAGGAAATGAATCTTCCCCCCAACCC CCACCATGCAGATGGATAGACAGAATCTTTCCTGA CTAGTCATTAGGATCAGGGGCCTCTGTTGGATTTGT GTTTCTTGAAGAATAGCTGGCAGAGTGGTATAAAA GACACGAATATCTCCTGGTCTATAAGGATACTCTGA TTTGGGGTTTGCATTTTTCATGGTTTTTATTTCCTGT TCCCCCTGGAGTTTTCCATTAGTGAGTTTTTG Entering the Genomic Era
  • What is DNA?
  • Image from the National Cancer Institute
    • Image from U.S. Department of Energy Human Genome Program http://www.ornl.gov/hgmis
  • WHAT IS THE HUMAN GENOME PROJECT?
  • AN INTERNATIONAL COLLABORATIVE EFFORT OF SCIENTISTS
    • United Kingdom
    • France
    • Germany
    • Japan
    • China
    • United States
    • Led by the National Human Genome Institute,
    • National Institutes of Health in Bethesda, MD
    • http://www.genome.gov
  • GOAL ACHIEVED
    • To Spell Out All of the Base Pairs in the Human Genome
  • What is the big deal about knowing the code?
  • Apply basic scientific findings to health
  • Genetics in the news Slide
  • Genetics in the news Slide
  • Chromosomes Slide
  • How a dominant trait is inherited Slide
  • How a recessive trait is inherited Slide
  • Our genetic story is expressed through our family history
    • Pedigree of a Family with Whirling Disorder
    • (‘discovered’ by the
    • Genetic Science Learning Center at the University of Utah)
  • And if we know all of this – what next?
  • Genetic Testing
    • Prenatal screening,
    • newborn screening, genotyping,
    • predictive testing,
    • prognostic testing,
    • cancer profiling,
    • infectious disease testing
  • Interventions, Treatments & Therapies
    • Pharmacogenomics, gene therapy
  • Forensic Applications
    • DNA testing for positive identification of missing persons, or human remains; for exonerating unjustly incarcerated prisoners
  • Non-medical Uses
    • Paternity, Enhancement,
    • Comparative Genomics, Human History
  • Ethical, Legal and Social Implications
  • Privacy and Genetic Nondiscrimination Disparities Human Research Participant Protections Reproductive Decision Making
  • Who Works on this Stuff?
  • Researchers Clinicians Ethicists Policy Makers
  • Who Makes the Decisions?
  • You Your Family Your Community Our Policy Makers
  • Informed Decision Making Healthcare Enterprise I POLICY Community Research Enterprise Family
  • WELCOME TO THE GENOME ERA!!
  • Credits:
    • Author: Sharon Terry, President & CEO, Genetic Alliance
    • Reviewers:
    • Emily Soper, Information Specialist, Genetics and Rare Disease Information Center
    • Roxane Brown, Outreach Program Manager
    • Patrick Terry, Director of Consumer Advocacy, Genomic Health
    We also express our appreciation to: National Human Genome Research Institute (NHGRI), NIH, DHHS Genetic Services Branch, Maternal and Child Health, DHHS Office of Rare Diseases, NIH, DHHS Department of Energy, DHHS