Biology 212 General Genetics            Spring 2007
Lectures 2 & 3 "Gene Function I and II"

Reading: Chap. 1 pp. 9-14, 14...
Phenylalanine
    X blocked in phenylketonuria

Tyrosine


4-hydroxyphenylpyruvic acid


homogentisic acid [accumulates in...
DNARNAprotein

   •      DNA does not code for protein directly
   •      RNA acts as an intermediary

RNA=ribonucleic a...
•   DNA opens up
   •   Ribonucleotides assemble on DNA template
   •   A pairs with T on DNA
   •   U pairs with A on DNA...
special codons

codon                          Amino acid                   Function
AUG                            Met   ...
Do genes determine destiny? Not completely

Phenotype=physical appearance of trait

        is due to

Genotype=all the ge...
Upcoming SlideShare
Loading in...5
×

2

226

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
226
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
2
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

2

  1. 1. Biology 212 General Genetics Spring 2007 Lectures 2 & 3 "Gene Function I and II" Reading: Chap. 1 pp. 9-14, 14-22 Lecture outline: 1. Genes code for proteins 2. Inborn errors of metabolism 3. DNARNAprotein 4. Genetic code 5. Mutations Lecture: 1. Genes code for proteins • order of bases on DNA specifies sequence of amino acids in a protein • proteins control the traits • enzymes are proteins that act as biological catalysts o break down organic molecules or assemble large molecules from smaller subunits 2. Inborn errors of metabolism 1908 Archibald Garrod • First to link errors in metabolism to defect in an enzyme • Studied alkaptunuria, a metabolic disease • Patient excretes abnormal substance in urine "homogentisic acid" urine turns black Metabolism: chemical reactions in cells Series of steps ABCD A=precursor B, C=intermediates D=product  =enzyme that catalyzes chemical reaction What happens in alkaptonuria? A critical enzyme is defective in the metabolic pathway to break down phenylalanine. Figures 1. 9, 1.10 1
  2. 2. Phenylalanine X blocked in phenylketonuria Tyrosine 4-hydroxyphenylpyruvic acid homogentisic acid [accumulates in alkaptonuria] X blocked in alkaptonuria 4-maleylacetoacetic acid Phenylketonuria (PKU) • Defect in different enzyme in same pathway • Enzyme defect: phenylalanine hydroxylase • Phenylalanine accumulates in individuals with the disorder • Can lead to mental retardation if not treated from birth • Treat by placing babies on diet low in phenylalanine • Screening with routine blood test just after birth • 1/8000 among Caucasians in U.S., therefore relatively common Defects in other enzymes of this pathway lead to other diseases. 3. DNARNA protein gene = sequence of DNA mRNA = temporary instructions for making protein protein = polypeptide chain • has 3D structure • proteins carry out a variety of tasks in cell • many proteins are enzymes (catalysts) mutant gene incorrect mRNA defective protein • doesn't form correct 3D structure The indirect way genes transfer information to make proteins is called the central dogma: 2
  3. 3. DNARNAprotein • DNA does not code for protein directly • RNA acts as an intermediary RNA=ribonucleic acid • Similar to DNA • Contains ribose sugar in place of deoxyribose • Contains the base uracil (U) in place of thymine (T) Three types of RNA mRNA=messenger RNA • Carries information from DNA • Used as a template for protein synthesis rRNA=ribosomal RNA • Several types of rRNA • Major components of ribosomes, the site of protein synthesis • rRNA in the ribosome provides the enzyme for protein synthesis (some enzymes are RNA) tRNA=transfer RNA • small RNAs • fold in cloverleaf structure • two functions o carry an amino acid to the ribosome o pair via 3 base anticodon to 3 bases on mRNA (codon) to direct correct incorporation of amino acids into a protein Process of information transfer DNA transcription mRNA translation protein Shown in more detail in Fig. 1.13 Process of transcription (Fig. 1.15) 3
  4. 4. • DNA opens up • Ribonucleotides assemble on DNA template • A pairs with T on DNA • U pairs with A on DNA • C pairs with G on DNA • G pairs with C on DNA • Synthesized in antiparallel orientation to DNA strand • RNA synthesis enzyme is RNA polymerase gene Initiation site termination site Process of translation (Fig. 1.16) Requires • mRNA: the coding sequence of bases specifies the amino acid sequence • tRNA: recognizes the triplets on mRNA and brings in an amino acid • Amino acid: building blocks of proteins; attach to 3' end of tRNA for assembly • Ribosome: structure where RNA synthesis occurs 4. Genetic code How do mRNA instructions specify a particular amino acid? • Requires knowledge of genetic code. • Genetic code discovered by o Looking at effects of mutations on specified information o Biosynthesis of proteins in a test tube with isolated components How to use genetic code table (Table 1.1) • Contains sequence of 3 bases on mRNA (codon) that specifies information for one amino acid • Read mRNA codon 5' 3' 5' A U G 3' specifies met (3 letter abbreviation) methionine M (single letter abbreviation) 4
  5. 5. special codons codon Amino acid Function AUG Met Start codon UAA No amino acid Stop codons UAG UGA DNA 5' ATGTCCACTGCGGTCCTGGAA 3' 3' TACAGGTGACGCCAGGACCTT 5' mRNA 5' AUGUCCACUGCGGUCCUGGAA 3' protein NH2--___ --___--___--___--___--___--___--COOH Use codon table to deduce amino acid sequence this mRNA would specify (Table 1.1) 5. Mutations • an inherited change in a gene • often affects the sequence of the protein mutant • result of a mutation • can refer to a mutant gene or mutant organism Some examples of mutations in the PAH (phenylalanine hydroxylase) gene that can lead to PKU (see Fig. 1.18 and 1.19): R408W mutant • One of four most common mutants • Codon 408 for arginine (R) is mutated into a codon for tryptophan (W) • Protein produced has an amino acid substitution • Mutant protein has no PAH enzyme activity Many different mutations (>400) can lead to PKU. These include • Missing part of a gene (deletion) • Genetic information to make complete enzyme is lacking • Base substitutions might o Change start codon o Change codon in middle of sequence o Leads to lack of enzyme or altered enzyme 5
  6. 6. Do genes determine destiny? Not completely Phenotype=physical appearance of trait is due to Genotype=all the genes + their interaction with the environment Example: PKU • Mutant genetic make-up leads to PKU • But you can alter affects of PKU by modifying diet (change in environment) 6

×