Cloning and sequence analysis of banana streak virus dna. harper 1998


Published on

Published in: Education
  • Be the first to comment

  • Be the first to like this

No Downloads
Total Views
On Slideshare
From Embeds
Number of Embeds
Embeds 0
No embeds

No notes for slide

Cloning and sequence analysis of banana streak virus dna. harper 1998

  1. 1. Virus Genes 17:3, 271±278, 1998 # 1998 Kluwer Academic Publishers, Boston. Manufactured in The Netherlands. Cloning and Sequence Analysis of Banana Streak Virus DNA GLYN HARPER & ROGER HULL* Virus Research Department, John Innes Centre, Norwich Research Park, Colney, Norwich, Norfolk NR4 7UH, UK Received January 26 1998; Accepted July 3 1998Abstract. Banana streak virus (BSV), a member of the Badnavirus group of plant viruses, causes severe problemsin banana cultivation, reducing fruit yield and restricting plant breeding and the movement of germplasm. Currentdetection methods are relatively insensitive. In order to develop a PCR-based diagnostic method that is bothreliable and sensitive, the genome of a Nigerian isolate of BSV has been sequenced and shown to comprise 7389 bpand to be organized in a manner characteristic of badnaviruses. Comparison of this sequence with those of otherbadnaviruses showed that BSV is a distinct virus. PCR with primers based on sequence data indicated that BSVsequences are present in the banana genome.Key words: banana streak badnavirus, virus sequence, virus diagnosis, badnavirus phylogenyIntroduction (RTBV; 4,5), sugarcane bacilliform virus (ScBV; 6), cocoa swollen shoot virus (CSSV; 7) and are knownBanana (Musa) is the worlds fourth most important for at least two other members. This information hascommodity and is a subsistence and cash crop for revealed common features of the group. They all havemany smallhold farmers particularly in West and similar genome organizations with three open readingCentral Africa. Currently, improvements in the frames (ORFs) (except RTBV, which has four)disease resistance, fruit yield and other agronomic encoded on one strand. The ®rst two ORFsqualities of bananas and plantains are being investi- potentially encode two small proteins (ORF 1gated by the International Institute for Tropical $ 22 kD, ORF 2 $ 14 kD) of unknown function.Agriculture (IITA), Nigeria. These improvements The third ORF ( $ 210 kD) encodes a polyprotein thathave been hampered by the recent diagnosis of is proteolytically cleaved to yield the viral coatbanana streak virus (BSV) (1) in the banana breeding protein which contains a region with homology to anstocks and quarantine regulations have been pre- RNA binding domain together with regions withventing the movement of infected plant materials, homology to aspartic protease (AP), reverse tran-even improved varieties. scriptase (RT) and RNase H (RH). In RTBV the extra BSV is a member of the badnavirus group (2) ORF, ORF 4, is downstream of ORF 3 and has anwhich have non-enveloped bacilliform particles of unknown function. These features, together with asize 30 Â 130±150 nm, containing a circular double- potential tRNAmet binding site, suggest that badna-stranded DNA genome of 7.4±8.0 kbp. The full viruses are pararetroviruses.sequences of the genomes of four members of this Following virus entry into the cell and nucleus thegroup have been reported, Commelina yellow mottle genome is transcribed into a greater than genomevirus (CoYMV; 3), rice tungro bacilliform virus length transcript, that ( presumably) is both a polycistronic mRNA and a replication template. The*Corresponding author: Professor Roger Hull. DNA negative strand, primed by host tRNAmet isThe nucleotide sequence data reported in this paper has beensubmitted to the EMBL nucleotide sequence database and have synthesized by a virally-encoded reverse transcrip-been assigned the accession number AJ002234. E-mail addresses: tase, and the positive strand by the same enzyme and the virally encoded RH.
  2. 2. 272 Harper and Hull The use of RT in their replication can potentially quarantined for 1 month, prior to moving to thelead to high degree of variation between isolates and greenhouse and maintenance at 28 C day, 25 C night.different group members, and such variation has Leaf material was ®nely ground in liquid nitrogenalready been reported for BSV (8). and blended into 2 volumes buffer A [50 mM sodium BSV is becoming of major importance for two phosphate pH 6.1, 5 mM dithiothreitol, 5 mM diethyl-reasons; it is increasingly being recognized as causing dithiocarbamate, 0.5% polyethylene glycol (PEGdisease world-wide, especially in subsistance bananas 6000)]. Celluclast (Novo Nordisk) was added to 2%,and plantains; there is accumulating evidence for BSV incubated with stirring at 37 C for 2 h then overnightsequences being integrated into the Musa genome at room temperature. Triton X-100 was added to 1%causing problems not only in the safe movement of and the incubation carried out for a further 30 min. Allgermplasm, but also in breeding and tissue culture. subsequent steps were carried out at 4 C. TheThis highlights the need for the determination of supernatant from a low speed centrifugation atspeci®c properties of BSV that could be used for its 10,000 g for 10 min, was further centrifuged atdiagnosis. The symptoms of BSV can be confused 120,000 g for 90 min. The pellet was resuspended inwith those of cucumber mosaic virus (CMV). BSV is 100 ml buffer A, centrifuged through a 5% sucroseserologically heterogeneous (8) and is present at low cushion at 120,000 g for 2.5 h and the pellettitre in the host. Serological methods in use, resuspended in 5 ml buffer A. The virus was furtherparticularly ISEM, require sophisticated equipment puri®ed according to Lockhart (2) by centrifugation inand are relatively insensitive. Here we report on the a 0±40% Cs2SO4 gradient in 10% sucrose [steps 40,sequence of a Nigerian isolate of the virus which 30, 20, 10, 0%] at 120,000 g for 2.5 h. The viral bandcould be of use in PCR-based diagnostic systems. was identi®ed by ISEM, carried out according to To date there is little evidence of plant viral Lockhart (2) using mixed BSV antisera (kindlysequences integrated into host plants, and none for an supplied by Dr. B.E.L. Lockhart). The virus wasintegrant that could result in excision or the diluted four fold in buffer A, pelleted at 150,000 g forproduction of functional transcripts to give episomal 60 min and resuspended in 100 ml 50 mM sodiumvirus infection. Portions of a geminivirus are reported phosphate pH be integrated into the tobacco genome (9). Petuniavein-clearing virus (PVCV), a plant pararetrovirus, Cloning and Sequence Analysishas been shown to carry typical consensus sequenceelements of the integrase proteins of retroviruses and Virion DNA was puri®ed by digestion of virusLTR retrotransposons. Preliminary evidence suggests particles with Proteinase K at 1 mg/ml in 100 mMPVCV to be a covalent component of cellular DNA of TrisCl pH 8.0, 2 mM CaCl2, 2% SDS, for 2 h at 65 C.Petunia sp. (10). La Fleur et al. (11) suggested the Following phenol extraction, the DNA was precipi-possible integration of portions of the BSV genome tated, washed in 70% ethanol, dried and resuspendedinto Musa, and we have obtained similar evidence. in 50 ml TE [10 mM TrisCl, 1 mM EDTA pH 8.0)The nature of the potentially active integrated virus (12)]. The DNA was digested with EcoR1 and thewill have to be compared with the episomal form and resulting fragments cloned into pBluescript II SK ‡these data are presented here. (Stratagene). One clone had sequence homology to ScBV and other badnaviruses. Primers were designed using the clone sequence information to allowMaterials and Methods PCR ampli®cation of the entire virion DNA. The primers were contiguous, facing in oppositeVirus Isolation and Puri®cation directions (nucleotide numbering for the com- pleted BSV sequence, see below): V1514 5HBSV-infected banana plants (cultivar TMPx 4698, a TGCGGGTGCTTCTTCACCC (anti-sense @ 2778),tetraploid hybrid of Obino lEwai  Calcutta 4) were V1517 5H TATGCACCAGCTACAAGTGC (sense @supplied, as in vitro plantlets or screenhouse-grown 2779). The ExpandTM Long Template PCR systemplant suckers, by IITA, Onne Field Station, Nigeria. (Boehringer) was used, following the manufacturersPlant sucker outer tissue was removed and the corms protocol for a 0.5±12 kb template (system 1). Thewere sterilized in 1% sodium hypochlorite for 1 h and template was 0.1±1.0 ml of the isolated virus DNA and
  3. 3. Banana Streak Badnavirus Sequence 273the primers were used at a ®nal concentration of separated by electrophoresis through a 1.5% agarose300 nM. The ampli®cation cycle conditions were gel and detected by ¯uorescence of ethidium bromide94 C Â 1 min, [92 C Â 20 s, 50 C Â 30 s, 68 C Â under UV light. Following photography, the reaction6 min] Â 10, [92 C Â 20 s, 50 C Â 30 s, 68 C Â products were transferred onto nylon membrane6 min with 20 s increment/cycle] Â 15 and a ®nal (Hybond-N, Amersham). A 32P-labeled probe wasextension for 68 C Â 7 min. synthesized by random priming using the full-length The 7.39 kb PCR product and sub-clones derived BSV PCR product as template (15). Hybridization andfrom it were sequenced manually using Sequenase washing was at 65 C using the solutions and protocolsversion 2.0 (USB, United States Biochemicals) and described by the membrane supplier (Amersham).automatically using the Prism system (AppliedBiosystems) and an ABI 373 sequencer. The sequencewas analyzed using the GCG sequence package (13). ResultsAll DNA manipulations were performed according toSambrook et al. (12). Virus Puri®cation For isolation of RNA, 2 g symptomatic bananaleaves were ground to a powder in liquid N2, added to The virus puri®cation gave a low yield of bacilliform24 ml 100 mM Tris-Cl pH 8.0, 20 mM EDTA, 500 mM particles of size $ 30 Â 130 nm, that could be trappedNaCl, 20 mM mercaptoethanol, 2% SDS and incu- on BSV antiserum-coated carbon grids but not onbated at 65 C for 10 min. After the addition of 8 ml CSSV antiserum-coated grids. The virus could be3M sodium acetate and incubation on ice for 10 min, detected by ISEM in a crude extract of infected leaf,the solution was centrifuged at 10,000 Â g for 10 min but not in leaf-dip preparations.and the supernatant was ®ltered through two layers ofMiracloth. The nucleic acid was precipitated by theaddition of 0.7 vol. isopropanol, incubation at À 20 C Virus Sequence Analysisfor 30 min and centrifugation. The pellet wasresuspended in 2 ml TE, extracted with phenol/ The complete 7389 bp nucleotide sequence of bothchloroform then chloroform and the RNA precipitated strands of the Nigerian isolate of BSV was determinedby the addition of lithium acetate to give 2 M and (accession AJ002234 in EMBL database). As withincubation at 4 C overnight. The RNA pellet was other badnaviruses and caulimoviruses the numberingwashed twice in 80% ethanol and resuspended in 40 ml of the sequence begins at the putative 5H minus-strand metwater. Formaldehyde-containing agarose gel electro- priming site and this conserved tRNAinit binding sitephoresis and northern blotting of RNA was as sequence is found in BSV.described in Sambrook et al. (12). The 5H end of the Overall the sequence shows low but recognizabletranscript was mapped by primer extension using the similarity to other badnaviruses, with highest simi-method of Medberry et al. (3). The primer used was larity to ScBV and least to RTBV (Table 1)5H - ATCTTGCGCTCTACTCGC at 7361 bp in the (Dioscorea alata bacilliform virus (DaBV) sequenceBSV sequence. was kindly provided by R. Briddon). A phylogeneticPrimer Design and PCR Table 1. Comparison of BSV sequence with those of other badnavirusesPCR primer pairs were chosen from aligned amino BSVacid sequences corresponding to the aspartic protease Amino Acid Similarities%and reverse transcriptase regions of the derived BSV Nucleotide Similarity% ORF 1 ORF 2 ORF 3sequences. The PCR was performed on DNA isolatedfrom banana leaves using the method of Li et al. (14), CoYMV 43.4 63.7/48.2a 52.6/28.5 66.1/45.8using the basic protocol described by manufacturers CSSV 48.8 56.3/32.6 48.3/24.6 64.4/44.5of the Taq DNA polymerase (Gibco BRL). The DaBV 47.8 55.4/31.6 44.6/20.6 65.5/46.1 ScBV 51.6 57.1/41.1 45.2/25.0 63.9/45.3conditions were 94 C for 2 min, [94 C for 1 min, 40± RTBV 39.6 52.0/21.0 36.9/18.9 50.6/30.550 C for 1 min, 72 C for 1 min] Â 30 cycles, followedby a 5 min extension at 72 C. Reaction products were a familial identity/direct identity
  4. 4. 274 Harper and Hullanalysis of the relationship of BSV to otherbadnaviruses is shown in Fig. 1. The close relation-ship to SCBV con®rms the serological relationshipnoted by Lockhart (1). The sequence is suf®cientlydifferent from those of other badnaviruses for BSV tobe considered a distinct virus. The + strand contains three large ORFs (Fig. 2).This number, their size and order are similar to otherbadnavirus sequences, with the exception of RTBVwhich possesses an additional ORF (4,5). At theamino acid level BSV shows most similarity toCoYMV and least to RTBV (Table 1). BSV ORF 3 ismore similar to those of other badnaviruses than isORF 1 which, in turn, is more similar than ORF 2. Thesimilarity in ORF 3 is particularly notable overregions that encode the putative viral replicasefunctions AP, RT and RH and shows the conservationof critical residues in three functions in this Fig. 2. Organization of the BSV genome. The complete circlepolyprotein (Fig. 3). The majority of differences are represents the double-stranded DNA genome. The inner circlebetween RTBV and the other badnaviruses. Other shows the mapping of the RNA transcript with the position of thesequence elements identi®ed in other plant parare- 3H end being estimated. The outer arcs indicate the positions oftroviruses including the as-1 sequence motif have also the three open reading frames (ORFs). The location of the 675 bpbeen detected in BSV (Fig. 4). cloned viral fragment is indicated by the shaded arc and its position corresponds to BSV 2663±3338. Transcript Mapping The proportion of viral RNA in RNA isolated from infected leaves is very small and for this reason the analysis of RNA gives weak results. Different methods of isolation give similar results. Northern blots of total RNA from BSV-infected banana tissue revealed only one BSV-speci®c band of approxi- mately 7.5 kb (Fig. 5a). This is the size expected for the major transcript of a pararetrovirus the size of BSV. To map the 5H end of the major transcript, RNA extracted from infected banana tissue was used for primer extension. The primer was designed to be near the position expected from other badnaviruses to be the start of a full-length transcript. Two strong stops were found (Fig. 5b) indicating that the transcript startFig. 1. Phylogenetic analysis of badnavirus sequences. Phylogeny site was at 7260 or 7261 bp, 25 nt downstream of awas inferred from the complete DNA genomes of the indicated potential TATA box (TATATAA) sequence (see later).viruses using the maximum likelihood method DNAML 4 of thePhylip suite of program (J. Felsenstein. Dept of Genetics, Attempts to map the 3H end of the transcript usingUniversity of Washington, unpublished). The sequences used are the approach of Medberry et al. (3) proveddescribed in the text. unsuccessful.
  5. 5. Banana Streak Badnavirus Sequence 275Fig. 3. Comparison of conserved amino acid sequences in ORF 3 of BSV and other badnaviruses. * ˆ Familial similarity.Fig. 4. Sequence comparison of promoter elementsa. The sequence and relative positions of as-1 and TATA sequences in members of twogroups of plant pararetroviruses. a Adapted from Medberry et al. (23). * CoYMV as-1 sequence is from 7149±7127.PCR Detection of BSV probe and sequencing of this product con®rmed its origin as BSV. Ampli®cation of this band could alsoPrimer sequences for PCR were selected from within be achieved from crude preparations from infectedthe conserved sequences putatively coding for RT and plants. All Musa plants tested gave this same sizeAP. This primer pair consistently gave a strong band, and all plants from Onne station gave the sameampli®cation product of the expected size of 644 bp pattern when the band was cut with Alu 1 (data notwith Musa DNA (Fig. 6). Hybridisation with a BSV shown).
  6. 6. 276 Harper and Hull Fig. 6. PCR ampli®cation of BSV sequences from DNA isolated from banana cultivars. 1. Control BSV DNA; 2. Field accessionFig. 5a. Northern analysis of BSV RNA. RNA isolated from 115-bc; 3. Cuban accession; 4. TMPx 5511/2; 5.TMPx 4698/1; 6.leaves of BSV infected Musa was separated by formaldehyde- Dwarf Cavendish; 7. Field accession T-3-1a using primers basedcontaining agarose gel electrophoresis. Following blotting the on the conserved sequences putatively encoding BSV RT and AP.membrane was probed with radio-labeled BSV DNA and the Track M is 1 kbp marker ladder. The size of the PCR product ishybridizing band is arrowed. Marked bp sizes are Promega RNA 644 bp.markers. Discussion The sequence of the Nigerian isolate of BSV con®rms that this is a badnavirus as it has a similar genome organization to other badnaviruses. The BSV genome contains three large ORFs (Fig. 2) potentially coding for proteins of 20.8, 14.5 and 208 kD. The size and order of the ORFs are very similar to those of most other badnaviruses. Characteristically the ORFs overlap, that between ORFs 1 and 2 being ATGA (ATG being start of ORF 2 and TGA stop of ORF 1) and thus resembling RTBV (4) and that between ORFs 2 and 3 being TAATG. Badnaviruses are characterised by having very few AUG translational start codons in the ®rst two ORFs (see reference 16). È Futterer et al. (16) proposed that ORFs 2 and 3 of RTBV (and other badnaviruses) are translated by leaky scanning due to the paucity or poor context of start codons in ORFs 1 and 2. It was also suggestedFig. 5b. Characterization of the BSV transcript by primer that the AUG-rich leader sequence is bypassed, atextension. The reaction products to the extension of a primer (5H least in RTBV, by a ``ribosome-shunt mechanismend at nucleotide 7361) on BSV RNA are in lane PE; the twotranscript termination bands are identi®ed by arrows The (17). The leader sequence of BSV is rich in AUGsequencing reactions using the same primer are in lanes A, C, G, codons. ORF 1 has four AUG codons which is moreT which are the included dideoxynucleotide. than other badnaviruses but they are all in poor
  7. 7. Banana Streak Badnavirus Sequence 277context (18); the sole AUG codon in ORF 2, that at the virus 20 nt; (26)]. Although it was not possible to mapstart, is also in a poor context. Thus, although there are the 3H end of the BSV transcript it can not bemore AUG codons than other badnaviruses in ORF 1 downstream of the tRNA binding site as this wouldit is likely that the expression strategy is similar to that affect the replication mechanism. The 5H end of the Èdescribed by Futterer et al. (16). transcript is 128/127 nt from the tRNA binding site The presence and arrangement of functional but no polyadenylation signal motifs were founddomains in ORF 3, cysteine rich zinc ®nger-like downstream of that at 7295.RNA-binding domain common to all retroelements Using the sequence information, a potential(19), AP, RT and RH found in ORF 3 are identical to diagnostic PCR assay has been developed thatthe those found in other badnaviruses (Fig. 4). This allows highly sensitive and speci®c detection ofORF also contains the additional cysteine-motif BSV in Nigerian banana plants. However, all Musacharacteristic of all other badnaviruses thus far plants tested so far, whether displaying symptoms orsequenced. The function of this extra ``cys sequence not, give positive results with this assay. For exampleis unknown but it may be involved with translational in Fig. 6 two of the six plants were not showing typicalcontrol (20). BSV symptoms at the time of sampling. Symptomatic Phylogenetic analysis of the currently available and serological examination of plants gave anbadnavirus sequences shows BSV to be more closely apparent infection rate of around 30%. The apparentlyrelated to ScBV and the other ``three ORF high degree of infection of Musa by BSV shown inbadnavirus than to RTBV. However, at the amino this study, is also echoed by the widespread infectionacid level, BSV is more similar to CoYMV than to of sugarcane by ScBV (27). One strong possibility isother badnaviruses. As previously noted RTBV is the that viral sequences are integrated into the hostmost divergent badnavirus (20): it has four ORFs and genome and genomic Southern analysis does showis transmitted only with rice tungro spherical virus hybridisation of a BSV probe to high molecular(RTSV) by a leafhopper vector. In contrast, all other weight Musa DNA. If this is the case, a detectionbadnaviruses described so far including BSV have method for episomal BSV will have to be serologi-three ORFs and are transmitted by a mealybug cally based but could include PCR by using immune-vector. We only detect a single BSV transcript by capture PCR. This would increase the sensitivity overNorthern analysis in contrast to RTBV (4). normal serological techniques. The 5H end of the transcript was mapped to the There are very few examples of plant viralcytosine/adenosine doublet at 7260/7261, a similar sequences integrating into the host sequence withresult and relative position in the genome as in that of a geminivirus thought to be random (9) but thatCoYMV (3) and at ‡ 25 nt with respect to a potential of petunia vein-clearing caulimovirus (PVCV) beingTATA box. In RTBV the transcription start site is also suggested to be potentiated by a virus-encodeddetected as a doublet (20). There is an as-1 like integrase (10). Unlike PVCV, no obvious integrasesequence as described in CaMV (21,22) and in motif could be found in the BSV sequence.CoYMV (23). In CaMV the as-1 element is in part In the present study, the virus isolated fromresponsible for promoter activity in the root and acts Nigerian plants appeared to have low variability asas non-speci®c enhancer for other cis elements in judged by restriction length polymorphism analysisCaMV (21). There is a difference in the spacing (data not shown) in contrast to the serologicalpattern from the as-1 element to the TATA box variation of other isolates observed in other studiesbetween the caulimovirus sequences (22±34 bp) and (8). This may be an indication of the inheritance of thebadnavirus sequences (176±181 bp). In BSV a same BSV sequences in the breeding stocks frompotential polyadenylation signal (AAATAAAAA) is which the material in this study was drawn.found at 7295 bp. which would give a 35 nt terminalredundancy to the full-length transcript. This terminalredundancy is smaller than those of other plant Acknowledgmentspararetroviruses [e.g. CoYMV 109±132 nt, RTBV215±216 nt; CaMV 176 nt; (3,24,25)] but of similar This work was funded by The Gatsby Foundation as asize to some of the retrovirus terminal redundancies collaborative project with IITA Nigeria. We thank Sue[mouse mammary tumor virus, 15 nt; avian leukosis Phillips and Dr A Brunt (Horticulture Research
  8. 8. 278 Harper and HullInternational) for invaluable assistance with electron A Laboratory Manual. Cold Spring Harbor Laboratory Press,microscopy and Mr Mike Harvey for oligonucleotide New York. 1989. 13. Devereux J., Haeberli P., and Smithies O., Nucl Acid Res 12,synthesis. BSV is held under MAFF Plant Health 387±395, 1984.licence No. PHL11/2044(8/96). 14. Li Q.B., Cai Q., and Guy C.L., Pl Molec Biol Rep 12, 215±220, 1994. 15. Feinberg A.P. and Vogelstein B., Anal Biochem 132, 6±13, 1983.References 16. È Futterer J., Rothnie H.M., Hohn T., and Potrykus I., J Virol 71, 7984±7989, 1997. 1. Lockhart B.E.L., Phytopathology 76, 995±999, 1986. 17. È Futterer J., Potrykus I., Bao Y., Li L., Burns M., Hull R., and 2. Lockhart B.E.L., Phytopathology 80, 127±131, 1990. Hohn T., J Virol 70, 2999±3010, 1996. 3. Medberry S.L., Lockhart B.E.L., and Olszewski N.E., Nucl 18. Lutche H.A., Chow K.C., Mickel F.S., Moss K.A., Kern H.F., Acid Res 18, 5505±5513, 1990. and Scheele G.A., EMBO J 6, 43±48, 1987. 4. Hay J.M., Jones M.C., Blakeborough M.L., Dasgupta I., Davis 19. Covey S.N., Nucl Acids Res 14, 623±633, 1986. J.W., and Hull R., Nucl Acids Res 19, 2615±2621, 1991. 20. Hull R., Ann Rev Phytopathol 34, 275±297, 1996. 5. Qu R., Bhattacharyya M., Laco G.S., de Kochko A., Subba Rao 21. Lam E., Benfey P.N., Gilmartin P.M., Fang R.-X., and Chua B.L., Kaniewska M.B., Elmer J.S., Rochester D.E., Smith C.E., N.H., Proc Natl Acad Sci USA 86:, 7890±7894, 1989. and Beachy R.N., Virology 185, 354±364, 1991. 22. Lam E. and Chua N.-H., Plant Cell 1, 147±1156, 1989. 6. Bouhida M., Lockhart B.E.L., and Olszewski N.E., J Gen Virol 23. Medberry S.L., Lockhart B.E.L., and Olszewski N.E., Plant 74, 15±22, 1993. Cell 4, 185±192, 1992. 7. Hagen L.S., Jacquemond M., Lepingle A., Lot H., and Tepfer 24. Bao Y. and Hull R., Virology 197, 445±448, 1993. M., Virology 196, 619±628, 1993. 25. Á Guilley H., Dudley R.K., Jonard G., Balas E., and Richards 8. Lockhart B.E.L. and Olszewski N.E., In: Breeding Banana and K.E., Cell 30, 763±773, 1983. Plantain for Resistance to Diseases and Pests. J Ganry (ed.). 26. Cof®n J.M., Essex M., Gallo R., Graf T.M., Hinuma Y., Hunter CIRAD/INIBAP, Montpellier, France, pp 105±113, 1993. E., Jaenisch R., Nusse R., Oroszlan S., Svoboda J., Teich N., 9. Bejarano E.R., Khashoggi A., Witty M., and Lichtenstein C., Toyoshima K., and Varmus H., In Virus Taxonomy: Proc Natl Acad Sci 93, 759±764, 1996. Classi®cation and nomenclature of viruses. (eds.) Murphy È10. Richert-Poggeler K.R. and Shepherd R.J., Virology 236, 137± F.A., Fauquet C.M., Bishop D.H.L., Ghabrial S.A., Jarvis A.W., 146, 1997. Martelli G.P., Mayo M.A., and Summers M.D. pp. 193±204,11. LaFleur D.A., Lockhart B.E.L., and Olszewski N.E., Springer Verlag, 1995. Phytopathology 86, S100±S101, 1996. 27. Comstock J.C. and Lockhart B.E.L., Plant Disease 74, 530,12. Sambrook J., Fritsch E.F., and Maniatis T., Molecular Cloning: 1990.