RNA INTERFERENCE: TECNICHE E APPLICAZIONI




             Catia Giovannini
           U.O. Medicina Interna
             ...
Scoperta dell’RNA interference
La scoperta dell’RNAi avvene nel tentativo di aumentare l’attività del
gene della calcone s...
RNA interference (RNAi)

• RNAi compreso solo dopo gli esperimenti di Fire e Mello (Fire et al., Nature
  1998).

• RNA a ...
RNA interference
• L’RNAi è un processo mediante il quale RNA doppio-
  strand silenzia, in modo sequenza-specifico, l’esp...
RNA interference
• Funzioni biologiche:
  Resistenza ai virus (piante,insetti): il dsRNA si forma grazie ad
  appaiamenti ...
Meccanismo base dell’RNAi
Il modello funzionale dell’RNAi consta di tre fasi fondamentali:

      Fase di “iniziazione”:
 ...
Meccanismo
FASE DI INIZIAZIONE

                                      Enzima ribonucleasico della
                        ...
FASE EFFETTRICE




                           Costituito da due RNA binding proteins e
                           da una ...
RNA polimerasi-RNA dipendente: un sistema di
                  amplificazione

• Sono stati identificati due meccanismi di...
Amplificazione dell’mRNA aberrante


                RdRP




Serve come substrato per il Dicer nella fase
              d...
Amplificazione del singolo filamento di RNA generato dal
                          RISC
                              RISC...
RNAi in cellule di mammifero

•   In cellule di mammifero sono state riscontrate più difficoltà nell’indurre
    RNAi util...
siRNA
Il crescente interesse per questa metodologia di silenziamento
genico ha permesso lo sviluppo di software che, attra...
siRNA
• Numerose collezioni di siRNAs, sintetizzati chimicamente, sono oggi
  disponibili in commercio, per i diversi mRNA...
Progettare i siRNA


I piccoli RNA sintetizzati chimicamente (siRNA) sono facilmente
transfettabili. Una volta introdotti ...
Progettare i siRNA
    siRNA “potenzialmente” funzionale:
•   La regione target deve essere a valle del codone di inizio, ...
Scelta dei siRNA
         Confrontare i siRNAs forniti da almeno tre ditte diverse per uno
         stesso messaggero.
   ...
Scelta dei siRNA
       RISC




RISC incorpora il filamento con la minor stabilità interna al 5’
G      1   10   20    G      1   10   20


-13.0                 -13.0
-12.5                 -12.5
-12.0                 -...
Effect off-target

Testare sempre più siRNA per trovarne almeno due che abbiano lo
stesso effetto a livello cellulare. In ...
Vettori plasmidici
  RNA polymerase III
  promoter

        • U6 promoter

        • H1 promoter




Non necessitano di se...
shRNA
Vettori virali

                        shOligo
                      cloning site

                  XhoI or
            ...
Fattori determinanti l’efficienza di silenziamento


•   Incorporazione e stabilità all’interno del complesso RISC dei siR...
Technology
     Steps del silenziamento genico:

1.   Sintesi di siRNAs e/o scelta del vettore plasmidico.

2.   Ottimizza...
Applicazioni in vivo
Applicazioni in vivo
I siRNAs in circolo vengono rapidamente degradati dalle
 ribonucleasi del siero. Sono state, recentem...
Applicazioni
Antitumor activity of small interfering RNA/cationic liposome
complex in mouse models of cancer. (Yano J. Cli...
miRNA
RNA a singolo filamento, lunghi 19-25nt, funzionano come repressori
nella regolazione genica in eucarioti.

Alcuni m...
miRNA
• Circa la metà dei miRNA conosciuti si trova in prossimità
  di altri miRNA. Questi cluster di miRNA vengono trascr...
Il MicroProcessor protein complex
(che include la RNAsi III Drosha)
Taglia il pri-miRNA a pre-miRNA.




                 ...
RNAi nel nucleo
Nelle piante i miRNA maturi
possono rientrare nel nucleo e
appaiarsi all’mRNA target che sta
finendo di tr...
RdDM (RNA-directed DNA methylation)

Nelle piante si è osservato che dsRNA contenenti sequenze omologhe
a promotori posson...
Grazie per l’attenzione
Silenziamento genico
Upcoming SlideShare
Loading in …5
×

Silenziamento genico

5,998 views
5,806 views

Published on

Slides su Silenziamento Genico NON sono di mia produzione.

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
5,998
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
49
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Silenziamento genico

  1. 1. RNA INTERFERENCE: TECNICHE E APPLICAZIONI Catia Giovannini U.O. Medicina Interna Prof. L. Bolondi
  2. 2. Scoperta dell’RNA interference La scoperta dell’RNAi avvene nel tentativo di aumentare l’attività del gene della calcone sintasi (un enzima coinvolto nella produzione di specifici pigmenti) in petunia. Inaspettatamente la pigmentazione non aumentò, si ebbe una variegazione del colore e, in alcuni casi la toatale perdita dello stesso. Questo fenomeno fu definito co-soppressione, intendendo la soppressione sia del gene introdotto che di quello endogeno.
  3. 3. RNA interference (RNAi) • RNAi compreso solo dopo gli esperimenti di Fire e Mello (Fire et al., Nature 1998). • RNA a singolo filamento agisce come inibitore poco efficiente. • L’RNA a doppia elica (dsRNA) è un inibitore potente. • Alterazioni fenotipiche possono essere indotte, in C. Elegans, solo con sequenze complementari a regioni esoniche suggerendo un silenziamento post-trascrizionale.
  4. 4. RNA interference • L’RNAi è un processo mediante il quale RNA doppio- strand silenzia, in modo sequenza-specifico, l’espressione genica attraverso l’appaiamento con l’ mRNA bersaglio seguito dalla sua degradazione, quindi: SILENZIAMENTO POST-TRASCRIZIONALE. • Meccanismo biochimico altamente conservato che coinvolge più di 10 geni e set di proteine correlate.
  5. 5. RNA interference • Funzioni biologiche: Resistenza ai virus (piante,insetti): il dsRNA si forma grazie ad appaiamenti intramolecolari dell’RNA virale. Silenziamento dei trasposoni (dimostrata dall’osservazione che l’innattivazione dei geni coinvolti nell’RNAi nei nematodi causa l’attivazione di molti trasposoni nella linea germinale). Regolazione dell’espressione genica.
  6. 6. Meccanismo base dell’RNAi Il modello funzionale dell’RNAi consta di tre fasi fondamentali: Fase di “iniziazione”: taglio del dsRNA in siRNA (21-23nt) Fase “effettrice”: il siRNA viene incorporato in un complesso proteico definito RISC “ RNA- induced silencing complex” Fase di “amplificazione”: sintesi di nuovo dsRNA da parte di una RNA-polimerasi RNA-dipendente
  7. 7. Meccanismo FASE DI INIZIAZIONE Enzima ribonucleasico della superfamiglia delle RNAsi III. Genera siRNA di 21-23 paia di basi ATP DICER ADP + Pi siRNA
  8. 8. FASE EFFETTRICE Costituito da due RNA binding proteins e da una nucleasi chiamata Slicer RISC RISC ATTIVATO ATTIVAZIONE ATP ADP + Pi Target mRNA
  9. 9. RNA polimerasi-RNA dipendente: un sistema di amplificazione • Sono stati identificati due meccanismi di amplificazione entrambi operati da una RNA polimerasi-RNA dipendente (RdRP). • Le amlificazioni aumentano il substrato per il Dicer o per il RISC, in entrambi i casi il RISC avrà la possibilità di effettuare un maggior numero di tagli.
  10. 10. Amplificazione dell’mRNA aberrante RdRP Serve come substrato per il Dicer nella fase di iniziazione
  11. 11. Amplificazione del singolo filamento di RNA generato dal RISC RISC Attivazione RdRp Taglio dell’ mRNA target
  12. 12. RNAi in cellule di mammifero • In cellule di mammifero sono state riscontrate più difficoltà nell’indurre RNAi utilizzando lunghi dsRNA. Questo perché a seguito dell’introduzione di dsRNA, spesso a rispondere non è un silenziamento sequenza specifico, ma un sistema che inibisce tutta l’espressione proteica cellulare. Il dsRNA introdotto in una cellula di mammifero interagisce con una proteina chinasica (PKR) che scatena la risposta immunitaria dell’interferone bloccando globalmente la trascrizione. • La risposta interferonica non viene scatenata se vengono introdotti nella cellula direttamente siRNA o shRNA.
  13. 13. siRNA Il crescente interesse per questa metodologia di silenziamento genico ha permesso lo sviluppo di software che, attraverso algoritmi specifici, generano i possibili siRNA applicabili ad un determinato mRNA target. La potenzialità di questi software, abbinata alla possibilità di allineare, attraverso BLAST, tutte le sequenze presenti nelle banche dati permette di individuare geni che potrebbero essere silenziati contemporaneamente per omologia di sequenza.
  14. 14. siRNA • Numerose collezioni di siRNAs, sintetizzati chimicamente, sono oggi disponibili in commercio, per i diversi mRNA delle diverse specie. • Non vengono fornite informazioni sulla sequenza dei siRNA, talvolta è indicato l’esone contenente la sequenza di appaiamento con il siRNA. • Solitamente testati in alcune linee cellulari.
  15. 15. Progettare i siRNA I piccoli RNA sintetizzati chimicamente (siRNA) sono facilmente transfettabili. Una volta introdotti in una cellula, non devono essere processati da Dicer e vengono direttamente incorporati nel RISC guidando la degradazione dell’mRNA. Massimo knockdown dopo 2-3 giorni dalla trasfezione.
  16. 16. Progettare i siRNA siRNA “potenzialmente” funzionale: • La regione target deve essere a valle del codone di inizio, ad una distanaza che varia da 50 a 100bp. • Lunghezza compresa fra 19-22 bp. • Contenuto in GC fra il 35-55% 2-nt 3´ overhangs di residui di uridina 5´-phosphate and 3´-hydroxyl group.
  17. 17. Scelta dei siRNA Confrontare i siRNAs forniti da almeno tre ditte diverse per uno stesso messaggero. 1005-1027 GTGAGAGCTGCAGTCAGAATATCGATG GGTGAGCTGCAGTCAGAATATCGATGA 1006-1028 TGCTCTGCGAGATTAATGAGGATGA 3546 42.86 ATGGGGGGACCTGCCGTGGCTATAT 3366-3386 TTGACCTCGTGGCCCGCTATCTCT 3495-3514 CCCGAGGTGATCGGCTCGGTAGTAA 4805 52.38 TGGGGGTGCTCTGCGAGATTAAT 3536-3558 AGGGCCCCTTTGTAACGTGGAGATC 2032 42.86 GGGGTGCTCTGCGAGATTAATGA 3538-3560 CGAGGGTGATCGGCTCGGTAGTAAT 4806-4826 CCTGCCACGAGGATGCTATCTGT 52.63 % 1158 CATAGGCCAGTTCACCTGTATCT 47.37 % 1429 GGCCGTACTGGTAGCCACTGTGA 52.63 % 3345 GGGGTGCTCTGCGAGATTAATGA 42.11 % 3542 GTGCTGGCGCCTCTTCAACAACA 52.63 % 4378 GAGGTGATCGGCTCGGTAGTAAT 47.37 % 4808 AGCTGCAGTCAGAATATCGATGA 42.11 % 1010
  18. 18. Scelta dei siRNA RISC RISC incorpora il filamento con la minor stabilità interna al 5’
  19. 19. G 1 10 20 G 1 10 20 -13.0 -13.0 -12.5 -12.5 -12.0 -12.0 -11.5 -11.5 -11.0 -11.0 -10.5 -10.5 -10.0 -10.0 -9.5 -9.5 -9.0 -9.0 -8.5 -8.5 -8.0 -8.0 -7.5 -7.5 -7.0 -7.0 -6.5 -6.5 -6.0 -6.0 -5.5 -5.5 -5.0 -5.0
  20. 20. Effect off-target Testare sempre più siRNA per trovarne almeno due che abbiano lo stesso effetto a livello cellulare. In questo modo si esclude la possibilità che i siRNAs utilizzati silenzino geni diversi dal target (effect off target). Il silenziamento aspecifico può essere causato anche dall’elica senso (identica all’mRNA bersaglio).
  21. 21. Vettori plasmidici RNA polymerase III promoter • U6 promoter • H1 promoter Non necessitano di sequenze indispensabili per la trascrizione a valle del promotore.
  22. 22. shRNA
  23. 23. Vettori virali shOligo cloning site XhoI or HdIII Bgl 2 RI Puro MSCV 3’SIN LTR Ts H1 Pgk Blast LTR GFP pSuper.retro puro original (pSR); and Blast and GFP derivatives (pSB & pSG): Moloney retroviral vectors harboring H1 Pol III promoter driven shRNAs AMP ori = PCR primers for H1= HI Pol III promoter DNA sequencing Pgk= Phosphoglycerol kinase Pol II promoter and pENTR/D-Topo Ts = 5 X Tter Pol III termination signal > Gateway cloning
  24. 24. Fattori determinanti l’efficienza di silenziamento • Incorporazione e stabilità all’interno del complesso RISC dei siRNA • Frequenza di traduzione dell’ mRNA target • Abbondanza ed emivita dell’ mRNA target • Struttura secondaria e terziaria dell’mRNA • Quantità di polisomi ancorati all’mRNA in traduzione • Proliferazione cellulare
  25. 25. Technology Steps del silenziamento genico: 1. Sintesi di siRNAs e/o scelta del vettore plasmidico. 2. Ottimizzare la trasfezione del siRNA o del vettore plasmidico. 3. Valutare l’efficenza del silenziamento mediante PCR e westen blot. Un siRNA è efficente se il silenziamento genico è superiore al 70%
  26. 26. Applicazioni in vivo
  27. 27. Applicazioni in vivo I siRNAs in circolo vengono rapidamente degradati dalle ribonucleasi del siero. Sono state, recentemente, sviluppate modificazioni chimiche che proteggono le molecole di siRNA dalla degradazione e che potrebbero indirizzare i siRNA in tessuti specifici.
  28. 28. Applicazioni Antitumor activity of small interfering RNA/cationic liposome complex in mouse models of cancer. (Yano J. Clin Cancer Res. 2004) Cholesteryl Oligoengine delivering vascular endothelial growth factor siRNA effectively inhibits tumor growth in colon adenocarcinoma. (Kim W. J. Mol. Ther. 2006) Efficient delivery of small interfering RNA to bone-metastatic tumors by using atelocollagen in vivo. (Takeshita F., Proc Natl Acad Sci, 2005)
  29. 29. miRNA RNA a singolo filamento, lunghi 19-25nt, funzionano come repressori nella regolazione genica in eucarioti. Alcuni miRNA possiedono un proprio locus, altri sono contenuti all’interno di regioni introniche di sequenze codificanti Regolano l’espressione di geni target a livello della traduzione bloccando il legame del ribosoma. Omologia non completa con l’RNA target a livello del 3’UTR. Mediano la degradazione dell’RNA bersaglio solo nelle piante.
  30. 30. miRNA • Circa la metà dei miRNA conosciuti si trova in prossimità di altri miRNA. Questi cluster di miRNA vengono trascritti da propri promotori a partire da una singola unità di trascrizione policistronica generando un trascritto primario policistronico (pri-miRNA) • La trascrizione dei geni del miRNA viene effettuata dalla RNA polimerasi II (polII)
  31. 31. Il MicroProcessor protein complex (che include la RNAsi III Drosha) Taglia il pri-miRNA a pre-miRNA. Ida Adriansson
  32. 32. RNAi nel nucleo Nelle piante i miRNA maturi possono rientrare nel nucleo e appaiarsi all’mRNA target che sta finendo di trascriversi dal suo DNA codificante. Il DNA viene così metilato a valle delle sequenze di legame con il miRNA.
  33. 33. RdDM (RNA-directed DNA methylation) Nelle piante si è osservato che dsRNA contenenti sequenze omologhe a promotori possono determinare la metilazione degli stessi generando un silenziamento trascrizionale del gene a valle. L’RdDM attua una metilazione de novo delle citosine presenti in qualsiasi contesto di sequenza, non solo in presenza dei dinucleotidi GC, considerati il tipico target della metilazione.
  34. 34. Grazie per l’attenzione

×