Your SlideShare is downloading. ×
0
Bioengineering Red Fluorescent Tags from  Thermosynechococcus  elongatus <ul><li>0911T Characterization & Contamination </...
Actual Result
Expected Result
What ’ s the opposite of Eureka? <ul><li>Identify the problem (What happened?) </li></ul><ul><li>Hypothesizing explanation...
Identifying the problem <ul><li>Pelleted proteins were the wrong color therefore,  </li></ul><ul><ul><li>Protein expressed...
Hypothesizing possibilities <ul><li>Exploring potential reasons for results </li></ul><ul><ul><li>Sample information was l...
Contamination <ul><li>Exploring possible sources of contamination </li></ul><ul><ul><li>Our glycerol stock of  E.coli  cel...
Procedures: preparing DNA for sequencing <ul><li>Mini prepping DNA </li></ul><ul><ul><li>Grow 2 mL cultures from the blue ...
Procedures: Sequencing DNA <ul><li>Off the samples go to UC Berkeley ’ s DNA sequencing facility where their powerful equi...
Procedures: Interpreting DNA results <ul><li>What we get back from UCB: </li></ul><ul><ul><li>Chromatograph  </li></ul></ul>
Procedures: Interpreting DNA results <ul><li>What we get back from UCB by email:  </li></ul><ul><li>Text file of raw seque...
Procedures: Interpreting DNA results <ul><li>Using a free tool provided by UCSD we upload sequences and compare them </li>...
Procedures: comparing sequences <ul><li>Sequenced &quot;911T&quot; aligned with Published 911 </li></ul>
Procedures: comparing sequences <ul><li>Sequenced &quot;911T&quot; aligned with Published 569 </li></ul>
Sequence comparison results <ul><li>This was the first explicit confirmation of what we suspected </li></ul><ul><li>“ 0911...
Tracking down the source <ul><li>Using lab books to determine possible dates where mislabeling could have occurred </li></...
Moving forward <ul><li>Ensuring the correct gene is being used </li></ul><ul><ul><li>Double checking DNA sequence data </l...
Thank you Spiller Lab! <ul><li>Many thanks to: Monica, Alex, Kristen, Rosa, Valerie, Stefanie, Ling, and Dr. Susan Spiller...
Upcoming SlideShare
Loading in...5
×

Mo's Barret Presentation

301

Published on

Published in: Education, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
301
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
1
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • As Monica mentioned we were getting beautiful blue 911T E. coli pellets.
  • Color is correct. Other reasons explain the small yield.
  • Our task was to capture the bacterial population from the blue pellet, grow it in nutrient broth using sterile technique for mini prepping of its plasmid DNA, Finally sequence its plasmid DNA to confirm its identity by aligning it with our known genes.
  • We are back on track – expressing and characterizing 911 in its truncated GAF only form.
  • Now Valerie Metea will tell you more about protein purification
  • Transcript of "Mo's Barret Presentation"

    1. 1. Bioengineering Red Fluorescent Tags from Thermosynechococcus elongatus <ul><li>0911T Characterization & Contamination </li></ul><ul><li>Mo Kaze </li></ul>
    2. 2. Actual Result
    3. 3. Expected Result
    4. 4. What ’ s the opposite of Eureka? <ul><li>Identify the problem (What happened?) </li></ul><ul><li>Hypothesizing explanations for unexpected result (Why did it happen?) </li></ul><ul><li>Locate source (How did it happen?) </li></ul><ul><li>Find the real 911T ! </li></ul>
    5. 5. Identifying the problem <ul><li>Pelleted proteins were the wrong color therefore, </li></ul><ul><ul><li>Protein expressed was NOT the correct gene </li></ul></ul><ul><li>So which one was it? </li></ul>
    6. 6. Hypothesizing possibilities <ul><li>Exploring potential reasons for results </li></ul><ul><ul><li>Sample information was labeled incorrectly, entirely different gene was expressed </li></ul></ul><ul><ul><li>Samples themselves were contaminated by another plasmid and the blue clone was dominant </li></ul></ul>
    7. 7. Contamination <ul><li>Exploring possible sources of contamination </li></ul><ul><ul><li>Our glycerol stock of E.coli cells (LMG-194-PCB or DH5α) was contaminated with the blue (mutated) clone </li></ul></ul><ul><ul><li>Tools or other implements contaminated our cultures during the expression process and the blue clone was dominant </li></ul></ul>
    8. 8. Procedures: preparing DNA for sequencing <ul><li>Mini prepping DNA </li></ul><ul><ul><li>Grow 2 mL cultures from the blue pellet </li></ul></ul><ul><ul><li>Centrifuge to collect the bacteria </li></ul></ul><ul><ul><li>Add lysis buffer to E.coli </li></ul></ul><ul><ul><li>Extract proteins, chromosomal DNA, cell walls </li></ul></ul><ul><ul><li>Centrifuge to remove debris </li></ul></ul><ul><ul><li>Bind and wash and elute plasmid DNA </li></ul></ul><ul><ul><li>Miniprep product = pure plasmid DNA </li></ul></ul><ul><ul><li>Make 2 separate samples for sequencing </li></ul></ul><ul><ul><ul><li>One with pBAD forward DNA PCR primers </li></ul></ul></ul><ul><ul><ul><li>One with CBD reverse DNA PCR primers </li></ul></ul></ul>
    9. 9. Procedures: Sequencing DNA <ul><li>Off the samples go to UC Berkeley ’ s DNA sequencing facility where their powerful equipment can sequence DNA and have results back in less than 2 days time </li></ul><ul><li>http://mcb.berkeley.edu/barker/dnaseq/ </li></ul>
    10. 10. Procedures: Interpreting DNA results <ul><li>What we get back from UCB: </li></ul><ul><ul><li>Chromatograph </li></ul></ul>
    11. 11. Procedures: Interpreting DNA results <ul><li>What we get back from UCB by email: </li></ul><ul><li>Text file of raw sequence </li></ul><ul><li>ATTGAGCAGGCAGCCAAATGTGCAGATTGCTTACGTCAGGCTGCGGTGCAGTTAAGTGAGTTGCGCGATC </li></ul><ul><li>GCCAAGCCATTTTTGAGACCCTTGTGGCAAAGGGCCGTGAACTATTGGCCTGCGATCGTGTCATTGTCTA </li></ul><ul><li>TGCCTTTGATGACAACTATGTGGGAACAGTCGTAGCCGAGTCGGTGGCAGAGGGTTGGCCACAAGCTCGA </li></ul><ul><li>GATCAGGTAATTGAGGATCCCTGTTTCCGCGAACACTGGGTAGAGGCCTACCGCCAGGGCCGCATTCAAG </li></ul><ul><li>CCACGACGGATATTTTCAAGGCAGGGCTAACGGAGTGTCACCTGAATCAACTCCGGCCCCTCAAGGTTCG </li></ul><ul><li>GGCAAATCTTGTCGTGCCGATGGTGATCGACGACCAACTTTTTGGTCTCCTGATTGCCCACCAGTGCAGT </li></ul><ul><li>GAACCACGCCAGTGGCAGGAGATCGAGATTGACCAATTCAGTGAACTGGCGAGCACCGGCAGCCTTGTCC </li></ul><ul><li>TGGAGCGTCTCCATTTCCTTGAGCAG </li></ul>
    12. 12. Procedures: Interpreting DNA results <ul><li>Using a free tool provided by UCSD we upload sequences and compare them </li></ul><ul><li>We have the entire gene </li></ul><ul><li>sequences uploaded to the </li></ul><ul><li>database already so we </li></ul><ul><li>can compare our sequence </li></ul><ul><li>to the known, published </li></ul><ul><li>gene sequences from </li></ul><ul><li>T.elongatus </li></ul>
    13. 13. Procedures: comparing sequences <ul><li>Sequenced &quot;911T&quot; aligned with Published 911 </li></ul>
    14. 14. Procedures: comparing sequences <ul><li>Sequenced &quot;911T&quot; aligned with Published 569 </li></ul>
    15. 15. Sequence comparison results <ul><li>This was the first explicit confirmation of what we suspected </li></ul><ul><li>“ 0911T ” was NOT what we had expressed </li></ul><ul><li>0911T was actually 0569TM another one of our T.elongatus genes </li></ul>
    16. 16. Tracking down the source <ul><li>Using lab books to determine possible dates where mislabeling could have occurred </li></ul><ul><li>Locating properly labeled glycerol stocks prior to the suspected date and then sequencing plasmid DNA </li></ul>
    17. 17. Moving forward <ul><li>Ensuring the correct gene is being used </li></ul><ul><ul><li>Double checking DNA sequence data </li></ul></ul><ul><ul><li>Segregating samples </li></ul></ul><ul><ul><li>Using consistent, sterile technique </li></ul></ul><ul><ul><li>Start expression process to verify expected result: </li></ul></ul><ul><ul><li>Yellow! </li></ul></ul>
    18. 18. Thank you Spiller Lab! <ul><li>Many thanks to: Monica, Alex, Kristen, Rosa, Valerie, Stefanie, Ling, and Dr. Susan Spiller </li></ul>
    1. A particular slide catching your eye?

      Clipping is a handy way to collect important slides you want to go back to later.

    ×