Genes y manipulación genética

3,469 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
3,469
On SlideShare
0
From Embeds
0
Number of Embeds
293
Actions
Shares
0
Downloads
482
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Genes y manipulación genética

  1. 1. GENES Y MANIPULACIÓN GENÉTICA
  2. 2. GENES Y MANIPULACIÓN GENÉTICA <ul><li>ESTRUCTURA DEL ADN </li></ul><ul><li>NIVELES DE EMPAQUETAMIENTO </li></ul><ul><li>FUNCIONES </li></ul><ul><li>REPLICACIÓN DEL ADN </li></ul><ul><li>TRANSCRIPCIÓN </li></ul><ul><li>TRADUCCIÓN DEL ADN </li></ul><ul><li>MUTACIONES </li></ul><ul><li>INGENIERÍA GENÉTICA </li></ul><ul><li>ORGANISMOS TRANSGÉNICOS </li></ul><ul><li>PROYECTO GENOMA HUMANO </li></ul><ul><li>APLICACIONES Y RIESGOS DE LA INGENIERÍA GENÉTICA </li></ul>
  3. 3. Estructura del ADN
  4. 4. Desoxirribonucleótido
  5. 9. NIVELES DE EMPAQUETAMIENTO DEL ADN
  6. 10. CROMÁTIDA CENTRÓMERO TELÓMERO
  7. 11. FUNCIONES DEL ADN <ul><li>LLEVAR LA INFORMACIÓN PARA LA FORMACIÓN DE UN SER VIVO DE UNA DETERMINADA ESPECIE </li></ul><ul><li>CONTROLAR LA APARICIÓN DE LOS CARACTERES </li></ul><ul><li>PASAR LA INFORMACIÓN A LA CÉLULA HIJA DURANTE EL PROCESO DE DIVISIÓN CELULAR </li></ul>
  8. 12. EL ADN SE REPLICA <ul><li>REPLICACIÓN DEL ADN </li></ul><ul><li>TRANSCRIPCIÓN DEL ADN </li></ul><ul><li>TRADUCCIÓN DEL ADN </li></ul>
  9. 13. ¿Qué es la replicación? <ul><li>Es el proceso por el cual la célula duplica su material genético. </li></ul><ul><li>Tiene lugar cuando la célula se va dividir, por ejemplo, para el crecimiento de los tejidos de un individuo, para la reparación de tejidos cuando tenemos una lesión o simplemente, para la reparación celular. </li></ul><ul><ul><li>Células que recubren el estómago 5 días. </li></ul></ul><ul><ul><li>Glóbulos rojos 120 días antes de ser enviadas al “cementerio” del bazo. </li></ul></ul><ul><ul><li>La epidermis -capa mas superficial de la piel- se recicla cada dos semanas. </li></ul></ul><ul><ul><li>El hígado,tiene un tiempo de renovación total calculado entre 300 y 500 días. </li></ul></ul><ul><ul><li>Todo el esqueleto humano se reemplaza cada diez años en los adultos. </li></ul></ul>
  10. 14. <ul><li>El proceso de replicación requiere proteínas iniciadoras especiales: </li></ul><ul><ul><li>Helicasas : rompen los puentes de H y abren la hélice en el origen de la replicación </li></ul></ul><ul><ul><li>Topoisomerasas : a medida que las hebras se desenrollan, las porciones contiguas de la doble hélice corren el peligro de enrollarse más y más, así que estas enzimas rompen y reconectan una o ambas cadenas a medida que se desenrollan las hebras, permitiendo que giren y se alivie la tensión . </li></ul></ul><ul><ul><li>Proteínas de unión a la cadena simple (SSB): se unen a las cadenas de ADN ya separadas para evitar que se retuerzan, posibilitando la síntesis real de las nuevas cadenas. </li></ul></ul><ul><ul><li>ADN polimerasas: cataliza la síntesis de las cadenas complementarias de ADN en cada una de las cadenas. Son de 2 tipos </li></ul></ul><ul><ul><ul><li>ADN polimerasa III : sintetiza nucleótidos en dirección 5´-3´, en la hebra contínua, mientras que en la retardada, sintetiza nucleótidos entre los espacios que quedan de cebador a cebador. </li></ul></ul></ul><ul><ul><ul><li>ADN polimerasa I : actúa en la hebra retardada sustituyendo a la ADN polimerasa III cuando ésta se topa con un cebador o primer. Su misión es sustituir los ARNs del cebador por nucleótidos de ADN. </li></ul></ul></ul><ul><ul><li>ADN ligasas: une los fragmentos que ha sintetizado la ADN polimerasa I entre sí </li></ul></ul>
  11. 15. Replicación del ADN
  12. 16. Replicación del ADN <ul><li>Además de la cadena vieja que sirve de molde, hace falta una secuencia de inicio para que se empiece a crear la nueva cadena . Este primer fragmento de inicio, se llama “ cebador o primer” , y está formado por 10 nucleótidos de ARN. </li></ul><ul><li>La síntesis del “cebador” es catalizado por la “RNA primasa”. </li></ul><ul><li>Con los cebadores de RNA colocados en el lugar correcto y apareados a la cadena de ADN complementaria, las DNA polimerasas comienzan a sintetizar nuevas cadenas complementarias. </li></ul><ul><li>Las cadenas que se van creando a partir de las viejas, no lo hacen a la misma velocidad sino que hay una cadena llamada “conductora” y otra llamada “retardada”. Ello es debido a que la ADN polimerasa III sólo inserta nuevos nucleótidos en dirección 5´ a 3´, por lo que, una hebra se sintetiza de forma continua, en la misma dirección en la que se va abriendo la horquilla de replicación, mientras que la otra, se sintetiza de forma discontinua en dirección opuesta, y de ahí el retraso. </li></ul><ul><li>En la hebra retardada se forman los llamados “fragmentos de Okazaki”. Cuando uno de estos fragmentos ha crecido lo suficiente como para encontrar un cebador de RNA por delante de él, la DNA polimerasa I reemplaza a la DNA pol III y sustituye a los nucleótidos de RNA del cebador con nucleótidos de DNA. </li></ul><ul><li>Finalmente, la ADN ligasa conecta cada fragmento de Okazaki con el fragmento contiguo recién sintetizado en la cadena. </li></ul>
  13. 17. TRANSCRIPCIÓN <ul><li>Proceso por el cual se copia un fragmento de ADN y se pasa a ARNm para luego ser leído en el citoplasma y transformarse en una proteína. </li></ul><ul><li>Las moléculas de ARNm son largas copias (o transcriptos) de secuencias(500 a 10.000) de nucleótidos de una cadena simple de ADN. </li></ul><ul><li>El proceso de transcripción es catalizado por la ARN polimerasa , que opera de la misma manera que la ADN polimerasa, es decir, en dirección 5´-3´. Así, la cadena de ARNm es antiparalela a la de ADN de la que transcripta. </li></ul><ul><li>En los eucariotas, para poder iniciar la transcripción, la ARN polimerasa requiere que un grupo de proteínas llamadas “factores generales de transcripción” se ensamblen en la región promotora del gen que se va transcribir. Esto permite la unión de la ARN polimerasa y la posterior transcripción. Después de esta unión, el ADN se abre y comienza la transcripción. </li></ul><ul><li>El proceso continua hasta que la ARN polimerasa se encuentra “la señal de terminación”, en ese momento la ARN polimerasa libera a la cadena de ADN molde y al ARNm recién formado. </li></ul>
  14. 18. PROCESAMIENTO DEL ARNm <ul><li>La unión de la ARN polimerasa al promotor (ADN), tiene lugar en una región del ADN rica en A y T conocida como TATA box (caja TATA). </li></ul><ul><li>Cada gen transcribe un ARNm con un solo mensaje (monocistrónico), </li></ul>
  15. 19. PROCESAMIENTO DEL ARNm <ul><li>El pre-ARNm, sufre un proceso de maduración que tras cortes y empalmes sucesivos elimina ciertos segmentos del ADN llamados “intrones” para producir el ARNm final. </li></ul>
  16. 21. Síntesis de proteínas
  17. 22. Transcripción
  18. 23. TRADUCCIÓN <ul><li>Una vez que se ha copiado un fragmento de ADN (transcripción), este ARNm sale del núcleo y se dirige al citoplasma donde se acopla a uno o varios ribosomas y comienza una nueva fase llamada Traducción, donde se generan proteínas. </li></ul>
  19. 25. Traducción
  20. 26. A. Messenger RNA (mRNA) Traducción methionine glycine serine isoleucine glycine alanine stop codon protein A U G G G C U C C A U C G G C G C A U A A mRNA start codon Primary structure of a protein aa1 aa2 aa3 aa4 aa5 aa6 peptide bonds codon 2 codon 3 codon 4 codon 5 codon 6 codon 7 codon 1
  21. 27. Código genético
  22. 29. LA MUTACIÓN MUTACIONES
  23. 30. <ul><li>Mutación es cualquier cambio o alteración estable de la estructura del material hereditario </li></ul><ul><li>Fuente de variabilidad en una especie. </li></ul><ul><li>Tipos: </li></ul><ul><li>GENÓMICAS O NUMÉRICAS : afectan al nº de cromosomas o a todo el genoma, pueden ser: </li></ul><ul><li>POLIPLOIDÍA: Es la mutación que consiste en el aumento del número normal de “juegos de cromosomas” . </li></ul><ul><li>HAPLOIDÍA: Son las mutaciones que provocan una disminución en el número de juegos de cromosomas. </li></ul><ul><li>ANEUPLOIDÍA: Son las mutaciones que afectan sólo a un número de ejemplares de un cromosoma o más, pero sin llegar a afectar al juego completo. Las aneuploidías pueden ser monosomías, trisomías, tetrasomías, etc. </li></ul><ul><li>CROMOSÓMICAS : Afectan a uno o varios cromosomas, pero normalmente no disminuye el número de éstos. </li></ul><ul><li>GÉNICAS : afectan a un solo gen. </li></ul><ul><li>Las cromosomopatías se observan en un 0.5 a un 1% de los recién nacidos vivos; se encuentran en un 6% de los fallecimientos de los bebés de menos de 18 meses, y en un 39% de los abortos espontáneos. </li></ul>La mutación y la variación genética
  24. 31. MUTACIÓN GENÓMICAS CROMOSOMICA GÉNICAS POLIPLOIDÍA HAPLOIDÍA INVERSIONES DELECIÓN O DUPLICACIÓN TRANSLOCACIÓN POR SUSTITUCIÓN DE BASES INSERCIÓN O DELECIÓN DE BASES ANEUPLOIDÍA
  25. 32. Triploidía Cariotipo 69,XXX Mutaciones Genómicas Poliploidía
  26. 33. TRIPLOIDÍA <ul><li>Los fetos triploides pueden ser 69,XXX; 69, XXY; 69, XYY; 69, YYY, estos últimos al carecer de un cromosoma X nunca son viables. </li></ul><ul><li>Características clínicas: </li></ul><ul><ul><li>Cabeza grande en relación al tronco. </li></ul></ul><ul><ul><li>Sindactilia del tercer y cuarto dedo de la mano y/o el segundo y tercer dedos de los pies. </li></ul></ul><ul><ul><li>Frecuentes malformaciones en la boca, ojos y genitales. </li></ul></ul>
  27. 34. Triploidía Trisomía completa 69XXY Mutaciones Genómicas Poliploidía
  28. 35. Síndrome de Turner Cariotipo de (45, X)/ INCEDENCIA 1/700 NACIMIENTOS Mutaciones Genómicas Poliploidía Aneuploidía
  29. 36. CLÍNICA: Baja estatura Cuello unido por membranas (pterigium colli) Párpados caídos (ptosis) Baja implantación del cabello y de las orejas Cubito valgo (deformidad del codo) Desarrollo retrasado o incompleto de la pubertad Mamas pequeñas y vello púbico disperso Infertilidad Ojos resecos Ausencia de la menstruación Carencia de la humedad normal en la vagina; relaciones sexuales dolorosas.
  30. 37. SÍNDROME DE PATAU trisomía del Cr 13
  31. 38. CLÍNICA (SÍNDROME DE PATAU) trisomía del Cr 13 <ul><li>INCIDENCIA 1/8000 a 12000 NACIMIENTOS </li></ul><ul><li>Retardo mental severo </li></ul><ul><li>Malformaciones congénitas en muchos sistemas de órganos </li></ul><ul><li>Defectos en corazón </li></ul><ul><li>Anomalías en riñón y tracto digestivo </li></ul><ul><li>Defectos oculares </li></ul><ul><li>Polidactilia </li></ul><ul><li>La mayoría, escasamente sobreviven al nacimiento, la muerte intrauterina es elevada, </li></ul><ul><li>El 90% de los pacientes mueren en los primeros meses </li></ul><ul><li>El 5% sobreviven por espacio de 3 años. </li></ul><ul><li>Existe un incremento de incidencia en hombres sobre las mujeres. </li></ul>
  32. 39. Síndrome de Patau Trisomía del cromosoma 13. INCIDENCIA 1/8000 a 12000 NACIMIENTOS Mutaciones Genómicas Poliploidía Aneuploidía
  33. 40. Síndrome de Edwards Trisomía (47, +18), INCEDENCIA: 1 /6000 a 8000 nacimientos Mutaciones Genómicas Poliploidía Aneuploidía Se la ha considerado como una enfermedad de tipo “letal”. Las expectativas de vida de un recién nacido con trisomia completa del par 18 no supera el año.
  34. 41. SÍNDROME DE EDWARS <ul><li>Crecimiento lento </li></ul><ul><li>Sindactilia </li></ul><ul><li>Malformaciones del pabellón de la oreja </li></ul><ul><li>Dislocación congénita de las caderas </li></ul><ul><li>Retraso mental severo </li></ul><ul><li>Puños cerrados con el segundo y quinto dedo superpuestos al tercero y cuarto. </li></ul>
  35. 42. Síndrome de Down Cariotipo de trisomía 21, INCIDENCIA: 1/700 Mutaciones Genómicas Poliploidía Aneuploidía
  36. 43. Síndrome de Down Norma lateral de recién nacido normal, joven normal y joven (47, +21) Mutaciones Genómicas Poliploidía Aneuploidía
  37. 44. <ul><li>Capacidad mental limitada con un rango de coeficiente intelectual entre 25-70 </li></ul><ul><li>Hipotonía muscular </li></ul><ul><li>Retraso del crecimiento corporal y del comportamiento </li></ul><ul><li>Protusión de la lengua por hipoplasia maxilar y del paladar, que da lugar a que la boca permanezca parcialmente abierta </li></ul><ul><li>Defectos oculares </li></ul><ul><li>Manos anchas y cortas, con un patrón característico de huellas dactilares y palmares </li></ul><ul><li>Desórdenes psicóticos en edad avanzada </li></ul>Síndrome de Down Mutaciones Genómicas Poliploidía Aneuploidía
  38. 45. SINDROME DE KLINEFELTER 47,XXY
  39. 46. Síndrome de Klinefelter Principales carácterísticas de (47, XXY) Mutaciones Genómicas Poliploidía Aneuploidía Sin entradas Poco vello Desarrollo de pechos Patrón de vello púbico femenino Pequeño tamaño testicular Inberbe Hombros estrechos Caderas anchas Largos brazos y piernas
  40. 47. SÍNDROME DE KLINEFELTER, XXY
  41. 48. MUTACIÓN CROMOSÓMICA
  42. 49. Leucemia mieloide aguda Cariotipo y células leucémicas Mutaciones Genómicas Poliploidía Aneuploidía Cromosómicas Translocación recíproca
  43. 50. Mutaciones Genómicas Poliploidía Aneuploidía Cromosómicas Translocación recíproca Deleción Cri du chat Cri du chat
  44. 51. <ul><li>Retraso mental y del crecimiento </li></ul><ul><li>Microcefalia </li></ul><ul><li>Hipertelorismo (aumento de la separación de los ojos) </li></ul><ul><li>Pliegues palpebrales antimongoloides (el canto externo del ojo más bajo que el canto interno) </li></ul><ul><li>Pliegue de la mano simiesco </li></ul><ul><li>Afecta a las niñas principalmente </li></ul><ul><li>1/20000-50000 nacimientos </li></ul>Cri du chat Mutaciones Genómicas Poliploidía Aneuploidía Cromosómicas Translocación recíproca Deleción
  45. 52. CRI DU CHAT
  46. 53. Retinoblastoma Mutación del gen Rb Mutaciones Genómicas Poliploidía Aneuploidía Cromosómicas Translocación recíproca Deleción Leucocoria en un niño con retinoblastoma
  47. 54. Retinoblastoma Retinoblastoma calcificado por quimioterapia Mutaciones Genómicas Poliploidía Aneuploidía Cromosómicas Translocación recíproca Deleción
  48. 55. Retinoblastoma Tumor Mutaciones Genómicas Poliploidía Aneuploidía Cromosómicas Translocación recíproca Deleción
  49. 56. La anemia falciforme Mutaciones Genómicas Poliploidía Aneuploidía Cromosómicas Translocación recíproca robertsoniana Entrecruzamiento desigual Deleción Duplicación Inversión Génicas Sustitución
  50. 57. La anemia falciforme Mutaciones Genómicas Poliploidía Aneuploidía Cromosómicas Translocación recíproca robertsoniana Entrecruzamiento desigual Deleción Duplicación Inversión Génicas Sustitución
  51. 58. La anemia falciforme Mutaciones Genómicas Poliploidía Aneuploidía Cromosómicas Translocación recíproca robertsoniana Entrecruzamiento desigual Deleción Duplicación Inversión Génicas Sustitución
  52. 59. ¿Qué es la clonación? Obtención de organismos genéticamente idénticos En el campo de la Ingeniería genética consiste en aislar y multiplicar un gen, o en general, un trozo de ADN En Animales superiores consiste en obtener un individuo a partir de una célula o de un nucleo de otro individuo
  53. 60. Conjunto de técnicas nacidas de la Biología molecular que permiten manipular el genoma de un ser vivo Homo sapiens Mediante la ingeniería genética se pueden introducir genes en el genoma de un individuo que carece de ellos cromosoma gen Escherichia coli
  54. 61. Enzimas de resricción (tijeras moleculares) <ul><ul><li>Aislamiento y manipulación de fragmentos </li></ul></ul><ul><ul><li>de ADN de un organismo para introducirlo </li></ul></ul><ul><ul><li>en otro (ADN recombinante) </li></ul></ul>Nathans D., Arber W., y Smith H. (premio Nobel de Fisiología y Medicina en 1978 por el descubrimiento de las enzimas de restricción y su aplicación en Genética Molecular)
  55. 62. Molécula A Molécula B Digestión de ambas moléculas con la misma enzima de restricción, BamHI Mezclar Tratar con ADN-ligasa ADN recombinante Extremos cohesivos
  56. 63. Es un proceso cíclico (cada ciclo consta de 3 pasos) 94ºC Desnaturalización (separación de las dos hebras de ADN ) 50ºC Acoplamiento de &quot;cebadores&quot; 72ºC Copia de cada una de las hebras de ADN por la ADN polimerasa <ul><ul><li>En 1983 Kary Mullis da a conocer esta técnica y en 1993 recibió el Premio Nobel de Química por este descubrimiento </li></ul></ul>35 ciclos 2 36 = 68 billones de copias
  57. 64. Separación de los fragmentos de ADN (electroforesis)
  58. 65. 1 gen de resistencia a la ampicilina Inserción de los fragmentos de ADN (vectores de clonación) <ul><ul><li>Plásmidos </li></ul></ul>Inserción de los fragmentos de ADN (vectores de clonación) <ul><ul><li>Plásmidos </li></ul></ul>2 Extremos cohesivos Plásmido 3 Molécula de ADN recombinante
  59. 66. Introducción del vector (Obtención de un clon celular) Plásmido
  60. 67. Secuenciación automática ACTTTGTCCACGGCCTAAGCGTTTTTTGCCC AGTGACTTTGTCCAAC GTCCAACAGTTACCAAGTGACTTTGTCCAC TTTTGCCC AGTGACTTTGTCCA ACGGCCTAAGCGTTTTTTTT ALINEAMIENTO DE TODAS LAS SECUENCIAS Y RECONSTRUCCIÓN DEL CROMOSOMA Secuenciación de genomas
  61. 68. <ul><ul><ul><li>Detección de mutaciones </li></ul></ul></ul><ul><ul><ul><ul><li>Método de diagnóstico rutinario (relación entre enfermedad y mutación puntual) </li></ul></ul></ul></ul><ul><ul><ul><li>Secuenciación de ADNs fósiles </li></ul></ul></ul><ul><ul><ul><li>Posibilidad de aislar secuencias de ADN a partir de unas pocas copias (la mayoría </li></ul></ul></ul><ul><ul><ul><li>están dañadas o degradadas) </li></ul></ul></ul><ul><ul><ul><li>Diagnóstico de enfermedades genéticas </li></ul></ul></ul><ul><ul><ul><ul><li>Diagnóstico prenatal / Diagnóstico preimplantación de enfermedades hereditarias o determinación del sexo del feto previamente a su implantación en procesos de </li></ul></ul></ul></ul><ul><ul><ul><ul><li>fecundación in vitro </li></ul></ul></ul></ul><ul><ul><ul><li>Identificación de especies y control de cruces entre animales </li></ul></ul></ul><ul><ul><ul><li>Para descubrir fraudes comerciales , tales como vender carne de una especie más </li></ul></ul></ul><ul><ul><ul><li>barata a los precios de otra más cara, o el comercio ilegal de especies en peligro </li></ul></ul></ul><ul><ul><ul><li>Secuenciación de genomas </li></ul></ul></ul><ul><ul><ul><li>Conocimiento básico y aplicado de diferentes organismos (incluido el genoma humano ) </li></ul></ul></ul>Aplicaciones de la secuenciación de ADN
  62. 69. <ul><ul><ul><li>Beneficios médicos tras el conocimiento de la estructura de cada gen humano </li></ul></ul></ul><ul><ul><ul><li>Diagnóstico en individuos con riesgo de ser portadores del gen de alguna enfermedad </li></ul></ul></ul><ul><ul><ul><li>Marco de trabajo para el desarrollo de nuevas terapias , además de nuevas estrategias para la terapia génica </li></ul></ul></ul>16 de Febrero de 2001 Celera Genomics 15 de Febrero de 2001 Consorcio público internacional Proyecto genoma humano La secuencia del genoma es un atajo valioso: ayuda a los científicos a encontrar los genes más fácil y rápidamente y sienta las bases para averiguar la función de los genes identificados
  63. 70. Aplicaciones de la ingeniería genética Obtención de proteínas de interés médico, comercial, etc... (insulina, hormona del crecimiento, factores de coagulación antes se obtenían a partir de los tejidos que las producen o fluidos corporales) aplicaciones médicas
  64. 71. Obtención de vacunas recombinantes (alternativa al uso de organismos patógenos inactivos) Aplicaciones de la ingeniería genética aplicaciones médicas La levadura fabrica las proteínas víricas con poder inmunológico Inyección de proteínas víricas en un chimpancé plásmido bacteriano Integración del plásmido híbrido en el núcleo de una célula de levadura ADN Extracción del ADN del virus
  65. 72. Conocimiento previo de la secuencia de ADN enfermo Mediante ingeniería genética se construye una sonda de ADN, marcada (marcaje fluorescente), con la secuencia complementaria del ADN enfermo ADN enfermo ADN sano ADN complementario del ADN enfermo Diagnóstico de enfermedades de origen genético ADN de la persona que se quiere diagnosticar ¿Hibridación? ¿No hibridación? Renaturalización del ADN con la sonda fluorescente Desnaturalización del ADN Aplicaciones de la ingeniería genética aplicaciones médicas Si aparecen bandas fluorescentes demuestra que la persona presenta la anomalía DIAGNÓSTICO Biochip Microarray DNAchip
  66. 73. Aplicaciones de la ingeniería genética en agricultura <ul><ul><ul><li>Resistencia a herbicidas, insectos y enfermedades microbianas </li></ul></ul></ul><ul><ul><ul><li>El maíz transgénico de Novartis es resistente al herbicida Basta y también es </li></ul></ul></ul><ul><ul><ul><li>resistente al gusano barrenador europeo (contiene el Gen de resistencia a la </li></ul></ul></ul><ul><ul><ul><li>toxina Bt de Bacillus thuringiensis ) produce su propio insecticida </li></ul></ul></ul><ul><ul><ul><li>Problemas: La toxina Bt en las plantas transgénicas tiene propiedades </li></ul></ul></ul><ul><ul><ul><li>sustancialmente diferentes a la toxina Bt en su forma natural . </li></ul></ul></ul><ul><ul><ul><li>La toxina puede ser transmitida a través de la cadena alimenticia, un </li></ul></ul></ul><ul><ul><ul><li>efecto que nunca ha sido observado en la toxina Bt en su forma natural. </li></ul></ul></ul><ul><ul><ul><li>Larvas de especies de insectos predadores benéficos (larvas verdes de </li></ul></ul></ul><ul><ul><ul><li>crisopa) murieron cuando fueron alimentadas con el gusano barrenador </li></ul></ul></ul><ul><ul><ul><li>europeo </li></ul></ul></ul><ul><ul><ul><li>Gold rice de Monsanto con color amarillo por los altos niveles de vitamina A </li></ul></ul></ul><ul><ul><ul><li>Mejora de la calidad de los productos agrícolas </li></ul></ul></ul><ul><ul><ul><li>Producción de aceites modificados </li></ul></ul></ul><ul><ul><ul><li>Síntesis de productos de interés comercial </li></ul></ul></ul><ul><ul><ul><ul><li>Anticuerpos animales, interferón, e incluso elementos de un poliéster destinado a la fabricación de plásticos biodegradables </li></ul></ul></ul></ul>
  67. 74. Aplicaciones de la ingeniería genética en animales Clonación de animales (TRANSFERENCIA NUCLEAR DE CÉLULAS EMBRIONARIAS)
  68. 75. cLONACIÓN REPRODUCTIVA Clonación de animales (TRANSFERENCIA DEL NÚCLEO DE UNA CELULA SOMATICA: CÉLULA DIFERENCIADA)
  69. 76. Terneros clonados y manipulados genéticamente (fábrica de anticuerpos humanos) genes para anticuerpos células dérmicas clonación humanos recombinantes Objetivo: Tratamiento de enfermedades inmunológicas Futuro: Tratamiento de una amplia gama de enfermedades ocasionadas por bacterias y virus, como hepatitis, ántrax (utilizada como arma biológica) Clonan terneros en EE UU para producir anticuerpos humanos efe- Washington - agosto 2002 
  70. 77. Clonan cerdos destinados a trasplantar sus órganos a humanos La empresa escocesa PPL Therapeutics logra retirar de los cerditos el gen que provoca el rechazo en transplantes a humanos &quot;alfa 1,3 galactosil transferasa&quot; Enero 2002. AP Photo/Roanoke Times, Gene Dalton (IDEAL-EFE) Paso importante en favor del xenotrasplante (transferencia de células u órganos de una especie a otra) Ayudará a superar la escasez de órganos humanos para hacer trasplantes de todo tipo
  71. 78. Un laboratorio de Texas clona al primer animal doméstico &quot;Copycat&quot; es el primer gatito nacido mediante clonación&quot; febrero 2002 Universidad College Station (Texas) El experimento abre las puertas de la clonación masiva de animales domésticos, un fin sin explorar cuya sola posibilidad había desencadenado ya el almacenamiento de células de mascotas por parte de sus ricos propietarios El sexto día El ataque de los clones
  72. 79. cLONACIÓN REPRODUCTIVA EN HUMANOS Para obtener a Dolly: 277 fusiones de ovocitos con células mamarias, solo 29 embriones fueron aptos. De estos solo uno resultó un éxito La clonación humana ya se esté intentando de forma clandestina por varios laboratorios en el mundo La clonación reproductiva no arroja los resultados suficientes, no existen garantías como para decir 'Vamos a clonar un ser humano' CLONAID ANTINORI Por cada intento de clonación hay detrás miles de fallos, abortos y malformaciones genéticas
  73. 80. Declaración Universal de Derecho Humanos y Genoma Humano de la UNESCO (1997), adoptada en 1998 por la Asamblea General de ONU ( busca un balance entre una continuación en las investigaciones y la salvaguarda de los derechos humanos) Frente a los múltiples beneficios de la ingeniería genética pueden surgir algunos problemas Problemas sanitarios nuevos microorganismos patógenos , efectos secundarios de nuevos fármacos de diseño , etc... Problemas ecológicos desaparición de especies con consecuencias desconocidas, nuevas contaminaciones debidas a un metabolismo incontrolado , etc... Problemas sociales y políticos en el campo de la producción industrial, agrícola y ganadera, pueden crear diferencias aún más grandes entre países ricos y pobres. El sondeo génico en personas puede llevar a consecuencias nefastas en la contratación laboral, por ejemplo, y atenta contra la intimidad a que tiene derecho toda persona (empleo, agencias de seguros, discriminación..). Problemas éticos y morales Poder conocer y modificar el patrimonio genético humano puede ser una puerta abierta al eugenismo &quot;Eugenesia: la ciencia del incremento de la felicidad humana a través del perfeccionamiento de las características hereditarias &quot;. Repercusiones sociales valoraciones éticas

×