SlideShare a Scribd company logo
1 of 1
Download to read offline
The cloud that is 
helping cure cancer. 
Develop 
new cancer 
therapies 
Big data 
is growing 3x faster than 
compute capability 
Cost to sequence 
one genome 
$100M 
$10M 
$1M 
$100K 
$10K 
$1K 
$4100 
$95M 
2002 2006 2010 2013 
What’s possible when you make the 
Microsoft Cloud part of your DNA? 
learn more at microsoftcloud.com 
Amazing 
possibilities 
Data is increasing 
exponentially 
Microsoft Azure 
is enabling more 
efficient analysis 
“Microsoft Azure is enabling us to keep up with 
the data deluge in the DNA sequencing space 
by analyzing data faster and more intelligently.” 
—Wu Feng, 
Professor of Computer Science, Virginia Tech 
data deluge 
1 in 3 people 
will develop cancer 
Cost of cancer: 
$458 billion 
per year in 2030 
Research that once took years now happens in 
hours. Using Microsoft Azure and HDInsight, 
scientists and engineers at Virginia Tech 
harness supercomputing power to analyze vast 
amounts of DNA sequencing information and 
help deliver lifesaving treatments. 
GATCAATACGATCACGATCATGATCA 
TGATCAACTGCGACAGATCATGATCG 
GTCAATACGATCAACGATCATGATCT 
15 petabytes 
As music, 
TGATCAACTGCGACAGATCATGATCG 
it would take 
TCAATACGATCATCGTATCAGGATCA 
of genome 
CAGATCATGATCGACGATCATGATCT 
30,000 
GATCAATACGATCACGATCATGATCA 
data available 
years to 
TGATCAACTGCGACAGATCATGATCG 
play! 
GTCAATACGATCAACGATCATGATCT 
Did you know? 
Combat 
drug-resistant 
bugs 
Locate 
undetected 
genes 
Extend 
analysis from 
the lab to 
the hospital 
Individualize 
treatment 
Amount of time Virginia 
Tech spent resourcing and 
building a new facility 0

More Related Content

Viewers also liked

Millennials and the Next Generation of IT
Millennials and the Next Generation of ITMillennials and the Next Generation of IT
Millennials and the Next Generation of ITMicrosoft
 
2016 Future of Cloud Computing Study
2016 Future of Cloud Computing Study2016 Future of Cloud Computing Study
2016 Future of Cloud Computing StudyNorth Bridge
 
5 Ways Affordable Innovation Can Revolutionize your Business
5 Ways Affordable Innovation Can Revolutionize your Business5 Ways Affordable Innovation Can Revolutionize your Business
5 Ways Affordable Innovation Can Revolutionize your BusinessMicrosoft
 
Build Better Games with Unity and Microsoft Azure
Build Better Games with Unity and Microsoft AzureBuild Better Games with Unity and Microsoft Azure
Build Better Games with Unity and Microsoft AzureXamarin
 
This is the Microsoft Cloud
This is the Microsoft CloudThis is the Microsoft Cloud
This is the Microsoft CloudMicrosoft
 
Microsoft to Acquire LinkedIn: Overview for Investors
Microsoft to Acquire LinkedIn: Overview for InvestorsMicrosoft to Acquire LinkedIn: Overview for Investors
Microsoft to Acquire LinkedIn: Overview for InvestorsMicrosoft
 
PPT on Microsoft Corporation
PPT on Microsoft CorporationPPT on Microsoft Corporation
PPT on Microsoft CorporationVijaykumar Nishad
 
Top 5 Deep Learning and AI Stories - October 6, 2017
Top 5 Deep Learning and AI Stories - October 6, 2017Top 5 Deep Learning and AI Stories - October 6, 2017
Top 5 Deep Learning and AI Stories - October 6, 2017NVIDIA
 

Viewers also liked (8)

Millennials and the Next Generation of IT
Millennials and the Next Generation of ITMillennials and the Next Generation of IT
Millennials and the Next Generation of IT
 
2016 Future of Cloud Computing Study
2016 Future of Cloud Computing Study2016 Future of Cloud Computing Study
2016 Future of Cloud Computing Study
 
5 Ways Affordable Innovation Can Revolutionize your Business
5 Ways Affordable Innovation Can Revolutionize your Business5 Ways Affordable Innovation Can Revolutionize your Business
5 Ways Affordable Innovation Can Revolutionize your Business
 
Build Better Games with Unity and Microsoft Azure
Build Better Games with Unity and Microsoft AzureBuild Better Games with Unity and Microsoft Azure
Build Better Games with Unity and Microsoft Azure
 
This is the Microsoft Cloud
This is the Microsoft CloudThis is the Microsoft Cloud
This is the Microsoft Cloud
 
Microsoft to Acquire LinkedIn: Overview for Investors
Microsoft to Acquire LinkedIn: Overview for InvestorsMicrosoft to Acquire LinkedIn: Overview for Investors
Microsoft to Acquire LinkedIn: Overview for Investors
 
PPT on Microsoft Corporation
PPT on Microsoft CorporationPPT on Microsoft Corporation
PPT on Microsoft Corporation
 
Top 5 Deep Learning and AI Stories - October 6, 2017
Top 5 Deep Learning and AI Stories - October 6, 2017Top 5 Deep Learning and AI Stories - October 6, 2017
Top 5 Deep Learning and AI Stories - October 6, 2017
 

More from Microsoft

Modern Finance at Microsoft US
Modern Finance at Microsoft USModern Finance at Microsoft US
Modern Finance at Microsoft USMicrosoft
 
Modern Marketing: The Case of Microsoft US
Modern Marketing: The Case of Microsoft USModern Marketing: The Case of Microsoft US
Modern Marketing: The Case of Microsoft USMicrosoft
 
Cybersecurity threats you should know about in 2018
Cybersecurity threats you should know about in 2018Cybersecurity threats you should know about in 2018
Cybersecurity threats you should know about in 2018Microsoft
 
Norwegian Refugee Council
Norwegian Refugee CouncilNorwegian Refugee Council
Norwegian Refugee CouncilMicrosoft
 
Reimagining Business Operations
Reimagining Business OperationsReimagining Business Operations
Reimagining Business OperationsMicrosoft
 
Top 5 Note Taking Tips from Future Innovators
Top 5 Note Taking Tips from Future InnovatorsTop 5 Note Taking Tips from Future Innovators
Top 5 Note Taking Tips from Future InnovatorsMicrosoft
 
Media in Transformation: A Technology Perspective
Media in Transformation: A Technology PerspectiveMedia in Transformation: A Technology Perspective
Media in Transformation: A Technology PerspectiveMicrosoft
 
Integrated Customer Service Maximization Experience Vision Demonstrator
Integrated Customer Service Maximization Experience Vision DemonstratorIntegrated Customer Service Maximization Experience Vision Demonstrator
Integrated Customer Service Maximization Experience Vision DemonstratorMicrosoft
 
Ignite Theater: Microsoft Enterprise Services Connected Collaboration Approach
Ignite Theater: Microsoft Enterprise Services Connected Collaboration ApproachIgnite Theater: Microsoft Enterprise Services Connected Collaboration Approach
Ignite Theater: Microsoft Enterprise Services Connected Collaboration ApproachMicrosoft
 
The Digital Airline
The Digital AirlineThe Digital Airline
The Digital AirlineMicrosoft
 
Driving results through a connected omni-channel retail sales experience
Driving results through a connected omni-channel retail sales experienceDriving results through a connected omni-channel retail sales experience
Driving results through a connected omni-channel retail sales experienceMicrosoft
 
Making Your Marketing More Effective
Making Your Marketing More Effective Making Your Marketing More Effective
Making Your Marketing More Effective Microsoft
 
10 real-world tips for building relationships and closing more on LinkedIn
10 real-world tips for building relationships and closing more on LinkedIn10 real-world tips for building relationships and closing more on LinkedIn
10 real-world tips for building relationships and closing more on LinkedInMicrosoft
 
Why Microsoft Dynamics AX
Why Microsoft Dynamics AXWhy Microsoft Dynamics AX
Why Microsoft Dynamics AXMicrosoft
 
Top Reasons to Buy
Top Reasons to BuyTop Reasons to Buy
Top Reasons to BuyMicrosoft
 
5 Steps to Help Your Organization Succeed This Year
5 Steps to Help Your Organization Succeed This Year5 Steps to Help Your Organization Succeed This Year
5 Steps to Help Your Organization Succeed This YearMicrosoft
 
5 Steps to Help Your Organization Succeed This Year
5 Steps to Help Your Organization Succeed This Year5 Steps to Help Your Organization Succeed This Year
5 Steps to Help Your Organization Succeed This YearMicrosoft
 
Enterprise social how to WLAN
Enterprise social how to WLANEnterprise social how to WLAN
Enterprise social how to WLANMicrosoft
 
3 reasons your biz needs ES
3 reasons your biz needs ES3 reasons your biz needs ES
3 reasons your biz needs ESMicrosoft
 
Why today’s businesses need enterprise social
Why today’s businesses need enterprise socialWhy today’s businesses need enterprise social
Why today’s businesses need enterprise socialMicrosoft
 

More from Microsoft (20)

Modern Finance at Microsoft US
Modern Finance at Microsoft USModern Finance at Microsoft US
Modern Finance at Microsoft US
 
Modern Marketing: The Case of Microsoft US
Modern Marketing: The Case of Microsoft USModern Marketing: The Case of Microsoft US
Modern Marketing: The Case of Microsoft US
 
Cybersecurity threats you should know about in 2018
Cybersecurity threats you should know about in 2018Cybersecurity threats you should know about in 2018
Cybersecurity threats you should know about in 2018
 
Norwegian Refugee Council
Norwegian Refugee CouncilNorwegian Refugee Council
Norwegian Refugee Council
 
Reimagining Business Operations
Reimagining Business OperationsReimagining Business Operations
Reimagining Business Operations
 
Top 5 Note Taking Tips from Future Innovators
Top 5 Note Taking Tips from Future InnovatorsTop 5 Note Taking Tips from Future Innovators
Top 5 Note Taking Tips from Future Innovators
 
Media in Transformation: A Technology Perspective
Media in Transformation: A Technology PerspectiveMedia in Transformation: A Technology Perspective
Media in Transformation: A Technology Perspective
 
Integrated Customer Service Maximization Experience Vision Demonstrator
Integrated Customer Service Maximization Experience Vision DemonstratorIntegrated Customer Service Maximization Experience Vision Demonstrator
Integrated Customer Service Maximization Experience Vision Demonstrator
 
Ignite Theater: Microsoft Enterprise Services Connected Collaboration Approach
Ignite Theater: Microsoft Enterprise Services Connected Collaboration ApproachIgnite Theater: Microsoft Enterprise Services Connected Collaboration Approach
Ignite Theater: Microsoft Enterprise Services Connected Collaboration Approach
 
The Digital Airline
The Digital AirlineThe Digital Airline
The Digital Airline
 
Driving results through a connected omni-channel retail sales experience
Driving results through a connected omni-channel retail sales experienceDriving results through a connected omni-channel retail sales experience
Driving results through a connected omni-channel retail sales experience
 
Making Your Marketing More Effective
Making Your Marketing More Effective Making Your Marketing More Effective
Making Your Marketing More Effective
 
10 real-world tips for building relationships and closing more on LinkedIn
10 real-world tips for building relationships and closing more on LinkedIn10 real-world tips for building relationships and closing more on LinkedIn
10 real-world tips for building relationships and closing more on LinkedIn
 
Why Microsoft Dynamics AX
Why Microsoft Dynamics AXWhy Microsoft Dynamics AX
Why Microsoft Dynamics AX
 
Top Reasons to Buy
Top Reasons to BuyTop Reasons to Buy
Top Reasons to Buy
 
5 Steps to Help Your Organization Succeed This Year
5 Steps to Help Your Organization Succeed This Year5 Steps to Help Your Organization Succeed This Year
5 Steps to Help Your Organization Succeed This Year
 
5 Steps to Help Your Organization Succeed This Year
5 Steps to Help Your Organization Succeed This Year5 Steps to Help Your Organization Succeed This Year
5 Steps to Help Your Organization Succeed This Year
 
Enterprise social how to WLAN
Enterprise social how to WLANEnterprise social how to WLAN
Enterprise social how to WLAN
 
3 reasons your biz needs ES
3 reasons your biz needs ES3 reasons your biz needs ES
3 reasons your biz needs ES
 
Why today’s businesses need enterprise social
Why today’s businesses need enterprise socialWhy today’s businesses need enterprise social
Why today’s businesses need enterprise social
 

V tinfographic final_061114_no_footer

  • 1. The cloud that is helping cure cancer. Develop new cancer therapies Big data is growing 3x faster than compute capability Cost to sequence one genome $100M $10M $1M $100K $10K $1K $4100 $95M 2002 2006 2010 2013 What’s possible when you make the Microsoft Cloud part of your DNA? learn more at microsoftcloud.com Amazing possibilities Data is increasing exponentially Microsoft Azure is enabling more efficient analysis “Microsoft Azure is enabling us to keep up with the data deluge in the DNA sequencing space by analyzing data faster and more intelligently.” —Wu Feng, Professor of Computer Science, Virginia Tech data deluge 1 in 3 people will develop cancer Cost of cancer: $458 billion per year in 2030 Research that once took years now happens in hours. Using Microsoft Azure and HDInsight, scientists and engineers at Virginia Tech harness supercomputing power to analyze vast amounts of DNA sequencing information and help deliver lifesaving treatments. GATCAATACGATCACGATCATGATCA TGATCAACTGCGACAGATCATGATCG GTCAATACGATCAACGATCATGATCT 15 petabytes As music, TGATCAACTGCGACAGATCATGATCG it would take TCAATACGATCATCGTATCAGGATCA of genome CAGATCATGATCGACGATCATGATCT 30,000 GATCAATACGATCACGATCATGATCA data available years to TGATCAACTGCGACAGATCATGATCG play! GTCAATACGATCAACGATCATGATCT Did you know? Combat drug-resistant bugs Locate undetected genes Extend analysis from the lab to the hospital Individualize treatment Amount of time Virginia Tech spent resourcing and building a new facility 0