• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Practical capillary electrophoresis
 

Practical capillary electrophoresis

on

  • 2,439 views

 

Statistics

Views

Total Views
2,439
Views on SlideShare
2,439
Embed Views
0

Actions

Likes
0
Downloads
55
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Practical capillary electrophoresis Practical capillary electrophoresis Presentation Transcript

    • PREFACE TO THE FIRST EDITION Capillary electrophoresis (CE) or high-performance CE (HPCE) is making the transition from a laboratory curiosity to a maturing microseparations technique. Now used in almost 1000 laboratories worldwide, CE is employed in an ever-widening scope of applications covering both large and small molecules. The inspiration for this book arose from my popular American Chemical Society short course entitled, as is this text, "Practical Capillary Electrophore- sis." During the first 18 months since its inception, nearly 500 students have enrolled in public and private sessions in the United States and Europe. I have been amazed at the diversity of the scientific backgrounds of my stu- dents. Represented in these courses were molecular biologists, protein chemists, analytical chemists, organic chemists, and analytical biochemists from indus- trial, academic, and government laboratories. Interestingly enough, CE provides the mechanism for members of this multidisciplinary group to actually talk with each other, a rare event in most organizations. But the diverse nature of the group provides teaching challenges as well. Most of the students are well versed in the art and science of liquid chromatography. However, CE is not chromatography (usually). It is electrophoresis, and it is gov- erned by the art and science of electrophoresis. For those skilled in electrophore- sis, CE offers additional separation opportunities that are not available in the slab-gel format. Furthermore, the intellectual process of methods development differs from that in either slab-gel electrophoresis or liquid chromatography. The key to grasping the fundamentals of CE is to develop an understanding of how ions move about in fluid solution under the influence of an applied electric field. With this background, it becomes painless to wander through the elec- trophoretic domain and explain the subdeties and permutations frequently illus- trated on the electropherograms. Accordingly, a logical approach to methods
    • XIV Preface development evolves from this treatment. This is the goal of my course, and hope- fully, I have translated this message into this text. Since I work independently, without academic or industrial affiliations, the writing of this text would have been impossible without the help of my friends and colleagues. In particular, 1 am grateful to Professor Ira Krull and his grad- uate student, Jeff Mazzeo, from Northeastern University for reviewing the entire manuscript; Dr. Michael Albin from Applied Biosystems, Inc., for providing his company's computerized bibliography on HPCE; and the Perkin-Elmer Corpo- ration including Ralph Conlon, Franco Spoldi, and librarian Debra Kaufman and her staff for invaluable assistance. I am also thankful to my associates throughout the scientific instrumentation industry for providing information, intellectual challenges, hints, electropherograms, comments, etc., many of which are included in this text. Last, I thank my students for helping me con- tinuously reshape this material to provide clear and concise explanations of elec- trophoretic phenomena. Finally, many of the figures in this text were produced by scanning the illus- tration in a journal article with subsequent graphic editing. While all efforts were made to preserve the integrity of the original data, subtle differences may appear in the figures produced in this book. Robert Weinberger Chappaqua, NY August 1992
    • PREFACE TO THE SECOND EDITION It is hard to believe that seven years have passed since I wrote the first edition of this book. The time is ripe for a second edition. Not only has capillary electrophoresis matured, but my ability to articulate the field has improved as well. I have reorganized this book to better reflect usage in the field. There are now ten chapters instead of twelve. The material on isotachophoresis has been com- bined with the section on stacking, and the special topics chapter has been elimi- nated. With the exception of the introduction and the chapter on basic concepts, all of the other material has been extensively reorganized and rewritten. Empha- sis has been placed on commercially available apparatus and reagents, although gaps in the commercial offerings are discussed as well. Note that micellar electro- kinetic capillary chromatography (MECC) is considered as a variant of capillary zone electrophoresis (CZE) and is included in the chapter on secondary equilib- rium. Cyclodextrins and chiral recognition are covered here as well. Many thanks to Dr. Bruce McCord, Mr. Ira Lurie, and Professor Ira KruU for reviewing some of the chapters in this second edition. The author gratefully acknowledges the support of Hewlett-Packard and in particular Dr. David Heiger. Much has been said about the ability of capillary electrophoresis (HPCE) to replace liquid chromatography (HPLC). Clearly it has not. As the first high- performance condensed phase technique, HPLC quickly replaced gas chro- matography as the method of choice for separating polar molocules. As food for thought, imagine if capillary electrophoresis had a 25-year head start over HPLC. Then perhaps the chromatographers would be fighting the uphill battle of displacing HPCE. As noted in this text, HPCE is clearly superseding the slab gel, at least in the fields of DNA separations. Robert Weinberger Chappaqua, NY June 1,1999
    • MASTER SYMBOL LIST A Corrected peak area corr r^ A Raw peak area raw r a Fraction ionized a Molar absorptivity a Separation factor h Detector optical pathlength C, c Concentration C Coefficient for resistance to mass transfer in the mobile phase C^ Coefficient for resistance to mass transfer in the stationary phase CLOD Concentration limit of detection CMC Critical micelle concentration %C Percentage of crosslinker in a gel D Capillary diameter D, D Diffusion coefficient m D^^ Solute diffusion in stagnant mobile phase DR Dynamic reserve d Particle diameter, chromatography AH Height differential between capillary inlet and outlet Ap^ Difference in mobility between two solutes AP Pressure drop 6 Debye radius ^ Zeta potential e Charge per unit area E Field strength E Acceptable increase in H E Detector efficiency 8 Dielectric constant 8 Molar absorptivity 8o Permittivity of vacuum
    • XVi Master Symbol List / Frictional force (Stoke's law) g Gravitational constant Y Field enhancement factor Y Obstructive factor for diffusion, Van Deemter equation H Height equivalent of a theoretical plate dH/dt Rate of heat production I Current If Fluorescence intensity I Excitation source intensity k Conductivity k' Capacity factor k' Capacity factor in MECC K, X Thermal conductivity K Equilibrium constant L Length of capillary L^ Length of capillary to detector I^ Length of the detector window Lf Length of capillary from detector to fraction collector L^ ^^ Length of the unpacked portion of a CEC capillary L ^^^^^ Length of the packed portion of a CEC capillary L^ Total length of capillary l.^. Length of an injection plug X Tortuosity factor, Van Deemter equation m Mass M Actual mass MLOD Mass limit of detection N Number of segments in a polymer chain N Number of theoretical plates n Number of charges r Viscosity P Partition coefficient between water and micelle wm AP Pressure drop O Polymer concentration, size separations O Quantum yield O Overlap threshold Oj Fluorescence quantum yield O* Entanglement threshold, size separations p Density p Resistivity Q Quantity of injected material q Ionic net charge R Resistance R Peak ratio R Displacement ratio
    • Master Symbol List XVll R Resolution s r Ionic radius (Stokes' law) r Capillary radius S/N Signal to noise ratio a Peak variance a Peak variance due to capillary wall effects cap ^ J a^ Peak variance due to the detector det a, „ Peak variance due to diffusion diff a^^ Peak variance due to electrodispersion ^heat P^ak variance due to Joule heating a Peak variance due to injection mj J a^ Peak variance in units of length o Peak variance from all sources tot Time Absorption time to a stationary phase or wall Desorption time from a stationary phase or wall Lag time Migration time Migration time for a micellar aggregate Migration time for a neutral "unretained" solute Retention time T Temperature TR Transfer ratio %)T Percentage of monomer and crosslinker in a gel 0/ |JL Ionic mobility |i^ Apparent (measured) mobility |Li^^ Electroosmotic mobility |Li^ Electrophoretic mobility V Partial molar volume of micelle V Voltage 1) Ionic velocity 1) Mean linear velocity D^ Electrophoretic velocity 1) Electroosmotic velocity eo J 0)^ ^^ Solute velocity in the unpacked portion of a CEC capillary ) ^^^^^ Solute velocity in the packed portion of a CEC capillary W Power W.^ Width of an injection plug W^ Spatial width of a sample zone W^ Temporal width of a sample zone X. Intital length of an injection plug X^ Zone length after stacking Z Number of valence electrons Z Charge
    • CHAPTER 1 Introduction 1.1 Electrophoresis 1.2 Microchromatographic Separation Methods 1.3 Capillary Electrophoresis 1.4 Capillary Electrochromatography 1.5 Micromachined Electrophoretic Devices 1.6 Historical Perspective 1.7 Generic HPCE Systems 1.8 Instrumentation 1.9 Sources of Information on HPCE 1.10 Capillary Electrophoresis: A Family of Techniques References 1.1 ELECTROPHORESIS Electrophoresis is a process for separating charged molecules based on their move- ment through a fluid under the influence of an applied electric field. If two solutes have differing electrophoretic mobilities, then separation v^U usually occur. The separation is performed in a medium such as a semisolid slab-gel. Gels provide physical support and mechanical stabiUty for the fluidic buffer system. In some modes of electrophoresis, the gel participates in the mechanism of separation by serving as a molecular sieve. Nongel media such as paper or cellulose acetate are alternative supports. These media are less inert than gels, as they contain charged surface groups that may interact with the sample or the run buffer. A carrier electrolyte is also required for electrophoresis. Otherwise known as the background electrolyte (BGE), the carrier electrolyte, or simply the run buffer, this solution maintains the requisite pH and provides sufficient conduc- tivity to allow the passage of current (ions), necessary for the separation. Fre- quently, additional materials are added to the BGE to adjust the resolution of the separation through the generation of secondary equilibria. Additives can also serve to maintain solubility and prevent the interaction of solutes or excip- ients with the gel matrix or, in the case of capillary electrophoresis, with the
    • ^ Chapter 1 Introduction capillary wall. The theory and practice of electrophoresis have been the subject of many textbooks and conference proceedings (1-9). Apparatus for conducting electrophoresis, such as that illustrated in Figure 1.1, is remarkably simple and low cost. The gel medium, which is supported on glass plates, is inserted into a Plexiglass chamber. Two buffer reservoirs make contact at each end of the gel. Electrodes immersed in the buffers complete the electrical circuit between the gel and power supply. Many samples can be sepa- rated simultaneously, since it is possible to use a multilane gel. One or two lanes are frequently reserved for standard mixtures to calibrate the electropherogram. Calibration is usually based on molecular size or, in isoelectric focusing, pi. Gels such as polyacrylamide or agarose serve several important functions: 1. they may contribute to the mechanism of separation; 2. they reduce the dispersive effects of diffusion and convection; and 3. they serve to physically stabilize the separation matrix. The gel composition is adjusted to define specific pore sizes, each for a nom- inal range of molecular sizes. This forms the basis for separations of macro- molecules based on size. By proper calibration, extrapolation to molecular weight is straightforward. Reduction of convection and diffusion is an important function of the gel matrix. The production of heat by the applied field induces convective move- ment of the electrolyte. This movement results in band broadening that reduces the efficiency of the separation. The viscous gel media inhibits fluid movement in the electric field. Such a material is termed anticonvective. Since the gel is of high viscosity, molecular diffusion is reduced as well, further enhancing the effi- ciency of the separation. CATHODE ANODE BUFFER SOLUTION GEL BUFFER SOLUTION FIGURE 1.1 Drawing of an apparatus for slab-gel electrophoresis.
    • 1.2 Microchromatographic Separation Methods 3 Finally, the gel must be sufficiently viscous to provide physical support. Low viscosity solutions or gels would flow if the plate is not held level. Immersion in detection reagents would be impossible, since handling or contact with fluid solutions would destroy the matrix and separation. In the capillary format, the gel is unnecessary since the walls of the capillary provide the mechanical sta- bility for the separation. The basic procedure for performing gel electrophoresis is as follows: 1. prepare, pour and polymerize the gel; 2. apply the sample; 3. run the separation; 4. immerse the gel in a detection reagent;^ 5. destain the gel; 6. preserve the gel; and 7. photograph or scan the gel for a permanent record.^ These steps are extremely labor intensive. High performance capillary elec- trophoresis (HPCE) is the automated and instrumental version of slab-gel elec- trophoresis. In the DNA applications arena, the most important of which include DNA sequencing, human identification, and genetic analysis, HPCE is rapidly replacing the slab-gel as the separation method of choice. The separation of some polymerase chain reaction (PCR) products is shown in Figure 1.2. A restriction digest, used as a sizing standard, appears in the outer lanes. The middle three lanes of the gel show a triplicate run of a 500-mer dou- ble-stranded DNA PCR reaction. Quantitation for such a separation is difficult and often imprecise, but such information can be obtained with the aid of a gel scanner. Recoveries of material from the gel are performed using procedures such as the Southern blot (10). Sufficient material is recoverable for sequenc- ing or other bioassays. Separations of the sizing standard and 500-mer PCR product by HPCE using a size selective polymer network are shown in Figure 1.3. Quantitation is read- ily performed using peak area comparison with the standard. However, fraction collection is difficult relative to the slab-gel, particularly for trace impurities, since only minuscule amounts of material are injected into the capillary. 1.2 MICROCHROMATOGRAPHIC SEPARATION METHODS The evolution of chromatographic methods over the last 40 years has produced a systematic and rational trend toward miniaturization. This is particularly true lOn-line detection is performed on an instrument such as an automated DNA sequencer. ^Automated gel scanners can be used in place of gel archiving or photography.
    • Chapter 1 Introduction If FIGURE 1.2 Slab-gel electrophoresis of a 500-mer double-stranded PCR reaction product in a 1.8% agarose ethidium bromide gel. Courtesy of Bio-Rad. for gas chromatography, where the advantages of the open tubular capillary dis- placed the use of packed columns for most applications. Chromatographic separations all function via differential partitioning of a solute between a stationary phase and a mobile phase. A packed column offers solutes "a multiplicity of flow paths, some short, the majority of average length, and some long (11)." Solute molecules select various paths through the chro- matographic maze. The detected peak suggests this distribution and is broad- ened. In the open tubular capillary, the choices for solute transport are limited, so that the solute elutes as a narrow band. In order for the open tubular capillary to function properly, its diameter must be quite small. Larger diameter capillaries present a problem, since solutes away from the walls do not sense the stationary phase in a timely fashion. However, a major problem with narrow inner diameter (i.d.) capillaries is loading capac- ity. Injection sizes must be kept small to avoid overloading the system. In gas chromatography (GC) this problem is overcome in part, since sensitive detec- tors such as the flame ionization detector (FID), electron capture detector (ECD), and mass spectrometer are easily interfaced. Improved efficiency is one of several advantages obtained through minia- turization. The most important of those is improved mass limits of detection
    • 1.2 Microchromatographic Separation Methods i 500 IL 1746 303 ^^ 10 15 TIME (min.) 20 FIGURE 1.3 Capillary gel electrophoresis of a 500-mer (top) double-stranded PCR reaction prod- uct and a low molecular weight sizing standard (bottom). Capillary: 50 cm x 50 [im i.d. Bio-Rad coated capillary; buffer: 100 mM tris-borate, pH 8.3, 2 mM EDTA with linear polymers; injection: electrokinetic, 8 kV, 8 sec; detection UV, 260 nm. Courtesy of Bio-Rad. (MLOD). Since dilution of the solute is minimized in the miniaturized system, better MLODs are obtained than in large scale systems. This is particularly important when the available sample size is small, as sometimes happens in bio- molecule separations. Miniaturization of GC has been exquisitely successful. These triumphs could not be directly transferred to liquid chromatography (LC) for several reasons. The most important is the lack of good detectors. Interface to the FID and ECD is not practical due to the incompatibility of the mobile phase with each detec- tor. Pumping of the mobile phase at the low flow rates required by miniatur- ization is also more complex, particularly when gradient elution is required. Despite these problems, |I-LC systems are useful in sample-limited situations and for mass spectrometry where the reduced liquid flow rate is advantageous. Several books have been devoted to this important field (12-14).
    • 6 Chapter 1 Introduction Most of work with i-LC employs 250 |im i.d. packed columns, and so the advantages enjoyed by open tubular GC are not realized in |Li-LC. The instru- mental problems of injection and detection posed by open tubular LC have inhibited most people from using this technology 1.3 CAPILLARY ELECTROPHORESIS The arrival of HPCE solved many experimental problems of gels. Use of gels is unnecessary since the capillary walls provide mechanical support for the car- rier electrolyte.3 The daunting task of automation for the slab-gel format is solved with HPCE. Sample introduction (injection) is performed in a repeatable manner. Detection is on-line, and the instrumental output resembles a chro- matogram. The use of narrow diameter capillaries allows efficient heat dissipa- tion. This permits the use of high voltage to drive the separation. Since the speed of electrophoresis is directly proportional to the field strength, separations by HPCE are faster than those in slab-gels. On the other hand, the relative speed of the slab-gel is enhanced, since multiple samples can be separated at once. HPCE is a serial technique; one sample is followed by another. This limitation has been overcome through the use of the capillary array for high throughput applications such as DNA sequencing (15,16) and serum protein analysis (17). Commercial instruments are now available for these applications. HPCE represents a merging of technologies derived from traditional elec- trophoresis and high performance liquid chromatography (HPLC). Both HPCE and HPLC employ on-line detection. Developments in on-column micro-LC detec- tion have directly transferred over to capillary electrophoresis. One of the modes of HPCE, micellar electrokinetic capillary chromatography (Chapter 4), can be considered a chromatographic technique. Electrically driven separations through packed columns (Chapter 7) have been reported from many laboratories. While there is much in common between chromatography and electrophoresis, the fun- damentals of HPCE are based on electrophoresis, not chromatography. Professor Richard Hartwick, formerly from the State University of New York at Binghamton, started many of his lectures on capillary electrophoresis with a discussion of transport processes in separations. While performing a separation, there are two major transport processes occurring: Separative transport arises from the free energy differences experienced by molecules with their physicochemical environment. The separation mechanism may be based on phase equilibria such as adsorption, extraction, or ion exchange. Alternatively, kinetic processes such as electrophoresis or dialysis provide the mechanism for separation. Whatever the mechanism for separation, each indi- vidual solute must have unique transport properties for a separation to occur. ^Gels are occasionally used in HPCE for running size separations. Pumpable polymer networks are preferred, since they can be changed for each run.
    • 1.3 Capillary Electrophoresis 7 Dispersive transport, or band broadening, is the sum of processes of the dis- persing zones about their center of gravities. Examples of dispersion processes are diffusion, convection, and restricted mass transfer. Even under conditions of excellent separative transport, dispersive transport, unless properly con- trolled, can merge peaks together. According to the late Professor Calvin Giddings as paraphrased by Hartwick, "separation is the art and science of maximizing separative transport relative to dispersive transport." In this regard, capillary electrophoresis is perhaps the finest example of optimizing both transport mechanisms to yield highly effi- cient separations. Figures 1.4 and 1.5 illustrate this concept, using a series of barbiturate sep- arations to compare HPCE and HPLC. The mode of electrophoresis used in Fig- ure 1.5 is micellar electrokinetic capillary chromatography (MECC), an electrophoretic technique that resembles reversed-phase LC. In the LC separa- tion amobarbital and pentabarbital coelute, but they are resolved by HPCE. With some optimization work, amobarbital and pentabarbital can be sepa- rated by HPLC. But with HPCE, methods development often progresses rapidly because of the enormous peak capacity of the technique. Peak capacity simply describes the number of peaks can be separated per unit time. With a couple of hundred thousand theoretical plates,"^ many separations occur without exten- sive optimization efforts. In addition, peak symmetry is excellent using HPCE unless wall effects (Section 3.3) occur. With the absence of a stationary phase, many factors that contribute to peak broadening and tailing are minimized. It would be misleading to state that all separations are superior by HPCE or that methods development will always be straightforward. It is realistic, how- ever, based on the experiences of many separation scientists skilled in the art of both techniques, to predict that HPCE will provide the requisite speed and res- olution in the shortest possible run time with the least amount of methods development, under most circumstances. These same two figures illustrate an important limitation of HPCE, the con- centration limit of detection (CLOD). In Figure 1.4, the LC separation requires a 1.25 |Lig/mL solution to give full scale peaks with 1-2% noise (the postcolumn reagent merely alkalized the mobile phase, permitting sensitive detection at 240 nm). The CLOD is approximately 30-fold better by HPLC. The MECC separa- tion shown in Figure 1.5 required a solute concentration of 100 |ag/mL for a similar response, although the noise was lower (0.5%).^ On the other hand, the MLOD by capillary electrophoresis exceeds HPLC by a factor of 100. The ideal detector for HPCE will be mass sensitive and not depend on the narrow optical pathlength defined by the capillary itself. Descriptions, advantages, and limita- tions of many HPCE detectors can be found in Chapter 9. ^The theoretical plate (N) is a measure of the efficiency of a chromatographic of electrophoretic peak; N = 5.5'(t^/Wiy, where t^ is the migration time and W is the peak width at half height. 5The CLOD can easily be improved through the use of stacking and/or extended pathlength flowcells.
    • 8 Chapter 1 Introduction W^ wW u TIME (MIN.) 11 FIGURE 1.4 Reversed-phase liquid chromatography of barbiturates. Column: Econosphere Cis, 25 cm X 4.6 mm i.d.; mobile phase: acetonitrile : water, 55/45 (v/v); injection size: 20 jxL; flow rate: 1.2 mL/min; postcolumn reagent: borate buffer, pH 10, 0.2 mL/min; detection: UV, 240 nm; solutes: (1) barbital, (2) butethel, (3) amobarbital and pentabarbital, (4) secobarbital; amount injected: 25 ng of each barbiturate from a 1.25 |Llg/mL solution. The preceding comparison is significant since a |Li-separation technique is compared with conventional HPLC using a 4.6 mm i.d. column. Would it be bet- ter to compare HPCE with |i-LC? Perhaps so from an academic standpoint, but this would not reflect the current usage and thinking in the real world. Chemists are contemplating using HPCE to replace or augment conventional HPLC as well as |i-LC. Table 1.1 provides a comparison of slab-gel electrophoresis, |I-LC, HPLC, and HPCE. Two disadvantages of HPCE compared to conventional HPLC are sensitivity of detection and precision of analysis. These have prevented the most widespread use of HPCE. On the other hand, HPCE is replacing the slab- gel for most high-throughput DNA applications. In this case, the ease of automa- tion, precision and ruggedness of HPCE supercede the slab-gel.
    • 1.3 Capillary Electrophoresis X TIME (MIN.) 10 FIGURE 1.5 Micellar electrokinetic capillary chromatography of barbiturates. Capillary: 50 cm (length to detector) X 50 |lm i.d.; buffer: 110 mM SDS, 50 mM borate, pH 9.5; injection: 1 sec vac- uum (5 nL); detection: UV, 240 nm; solutes: (1) phenobarbital, (2) butethel, (3) barbital, (4) amo- barbital, (5) pentobarbital, (6) secobarbital; amount injected: 500 pg of each barbiturate from a 100 |lg/mL solution. HPCE is a novel and alternative format for both liquid chromatography and electrophoresis. The unique properties of this technique include the use of: 1. capillary tubing in the range of 25-100 jim; 2. high electric field strength; 3. on-line detection in real time; 4. only nanoliters of sample; 5. limited quantities of mostly aqueous reagents; and 6. inexpensive capillaries relative to HPLC columns. The molecular weight range of analytes separable by HPCE is enormous. A search of the literature reveals applications covering small ions, small molecules,
    • 10 Chapter 1 Introduction TABLE 1.1 Comparison of Slab-Gel Electrophoresis, p-LC, Conventional LC, and HPCE Speed Intrumentation cost Sensitivity CLOD MLOD Efficiency Automation Precision Quantitation Selectivity Methods development Reagent consumption Preparative mode Ruggedness Separations DNA Proteins Small molecules Slab-Gel slow low poor poor moderate Htde poor difficult moderate slow low good good excellent excellent poor p-LC moderate high poor good moderate yes good easy moderate moderate low fair good fair good excellent HPLC moderate moderate excellent poor moderate yes excellent easy moderate moderate high excellent excellent fair good excellent HPCE fast moderate poor excellent high yes good easy high rapid minimal poor good excellent excellent excellent peptides, proteins, DNA, viruses, bacteria, blood cells, and colloidal particles. The molecular weight range of HPCE is easily from 3 for a lithium ion to 100,000,000 for a virus or particle. 1.4 CAPILLARY ELECTROCHROMATOGRAPHY A hybrid of chromatography and electrophoresis, capillary electrochromatog- raphy (CEC) employs the electrically driven electroosmotic flow (EOF) to pump a mobile phase through a packed capillary. The use of the EOF to gener- ate flow solves some of the instrumental problems of pumping at nL flow rates. Capillary electrochromatography employs small diameter capillaries filled with a stationary phase. Reversed-phase packings are most often used, although an application with a cation-exchange material has been reported (18). An amazing efficiency 8 million plates per meter was reported in that paper, though the mechanism and reproducibility of the effect are still unclear.
    • 1.6 Historical Perspective 11 Typically, 50 |im i.d. capillaries are used though larger diameter tubes can be employed at the expense of efficiency. Particle diameters of 3-5 |im porus mate- rial are most common, though it is possible to employ 1.5 |Lim pellicular pack- ing. Since there is no pressure drop with an electrically pumped system, relatively long capillaries can be employed to generate hundred of thousands of theoretical plates. The reduction of eddy diffusion also contributes to the enhanced efficiency (19). The mobile phase is pumped using the EOF generated by both the wall of the capillary and the chromatographic packing. Formulation of the mobile phase is similar to conventional reversed-phase chromatography, except that a dilute buffer—for example, 1-10 mM tris, borate, or phosphate—is added to ensure sufficient electrical conductivity The capillary is usually pressurized to a few atmospheres to suppress bubble formation. The least mature of the electrically driven techniques, CEC capillaries and second generation instruments are now available. One promise for this tech- nique is the ability to employ the vast existing chromatographic database to speed methods development. 1.5 MICROMACHINED ELECTROPHORETIC DEVICES Employing technology used in the fabrication of integrated circuits, it is now possible to create an electrophoretic apparatus on a chip (20-28). Designed for dedicated applications such as clinical analysis, genetic analysis, or DNA sequencing, chips can be manufactured at low cost in commercial quantities. These devices can form the basis of an automated laboratory, where the dispos- able chip serves as the separations device. A diagram of a simple micromachined HPCE chip is shown in Figure 1.6. The technological advantage of this device compared with a conventional capillary is its ability to perform extremely small injections (29). As a result, a shorter separation channel is required, again compared with the conventional capillary. Detection problems resulting from the small injection are solved through the use of laser-induced fluorescence (LIE). Micromachined electrophoretic devices are expected to have a huge impact in the DNA applications area. 1.6 HISTORICAL PERSPECTIVE A century of development in electrophoresis and instrumentation has provided the foundation for HPCE. Reviews describing the history of electrophoresis were published by Vesterberg (30) and Compton and Brownlee (31). The highlights in the development of HPCE are given in Table 1.2.
    • 12 Chapter 1 Introduction Background Electrolyte A B oil o- Sample o- Separation Channel Detector Window FIGURE 1.6 Layout of the channels in a planar glass substrate. Channels are referred to by num- ber and inlet points (reservoirs) as letters. Each channel is labeled with its content or its function. Overall dimensions are 14.8 cm x 3.9 cm x 1 cm thick. The location of one pair of platinum elec- trodes is shown; for clarity, the others are not. (A) BGE reservoir; (B) sample reservoir; (C) outlet reservoir. (1) BGE inlet; (2) sample inlet; (3) separation channel; (4) sample outlet. Injection is made where 4 crosses 3. Redrawn with permission from Anal. Chem., 64, 1926 (1992), copyright © Am. Chem. Soc. A direct forerunner of modem CZE was developed by Hjerten in 1967 (32). To reduce the detrimental effects of convection caused by heat production, the 3 mm i.d. capillaries were rotated. While heat dissipation was unchanged, the rotating action caused mixing to occur within the capillary, smoothing out the convective gradients. In the 1970s, techniques using smaller i.d. capillaries were successfully developed (34). Superior heat dissipation permitted the use of higher field strength without the need for capillary rotation. In 1981, Jorgenson and Lukacs (35) solved the perplexing problems of injection and detection with 75 |Lim i.d. capillaries. Their advances clearly defined the start of the era of HPCE. Fluorescence detection was required at that time to record the electropherogram. The 1980s proved ripe for invention. Adaptation of gel electrophoresis (36) and isoelectric focusing (38) to the capillary format was successful. In 1984, Terabe et al. (37) described a new form of electrophoresis called micellar elec- trokinetic capillary chromatography (MECC). Chromatographic separations of small molecules, whether charged or neutral, were obtained by employing the micelle as a "pseudo-stationary" phase. Great advances in detection occurred during the 1980s to overcome, in part, the serious limitation of the short pathlength defined by narrow i.d. capillaries
    • 1.6HistoricalPerspective13 u Pu PC o u u a ^ PI o u ^ 1 IBU C/5 r2 'PH c« CJ o U 2 o c_o (U Pi 15 b CC p. u O <^ Zfi uu o CIS D2 JOi :3 c^ o •rH 1ro _g W N UU W5 c/5 c« 'tob ^ so o in ci o(N •S wN U f^ m U w u D. c« u O c:3 f^ TJ so o fN .swN U ^•^ CD <U ^^ 7^ PH CC u T3 in h- ,P W N U vo ro W O U m U U P-) S II II ^in W) CT" UO < § ^JS ;=i U «,a •^ •.-!^->s vp (N ^-^a U TS <u fl ^o o _o < P <Tl ^-? SSJ II X ^h- ^ ^_^ ^in 1ON <! P (J J^ ON r-H 00 o m00 ON T^ 00 ON in 00 ON ^X ON J-~ X ON 00 X ON ON X ON O ON ON (N ON ON in ON ON X ON ON
    • 1 4 Chapter 1 Introduction (57, 58). One ofJorgenson's first papers in the field employed fluorescence (59). Gassmann et al. (39) employed LIF, improving detectability to the attomole range. Olivares et al (42) interfaced CZE to the mass spectrometer via the elec- trospray. The use of on-line mass spectrometry is significant because of the dif- ficulty of carrying out fraction collection. Wallingford and Ewing (43) developed electrochemical detection, sensitive enough to measure catecholamines in a sin- gle snail neuron. Kuhr and Yeung (44) employed indirect detection to measure solutes that neither absorbed nor fluoresced. More exotic detection techniques include electrochemical detection (43, 60) nuclear magnetic resonance (56), Raman (45), chemiluminescence (55) and radioactivity (61). The problem of protein adherence to the capillary wall was addressed from sev- eral fronts. The use of treated capillaries was described by Hjerten (40) in 1985. Around the same time, Lauer and McManigill (41) employed alkaline buffers above the pi of the protein to effect solute repulsion from the anionic capillary wall. Based on these and related developments, wall effects have been substantially reduced. The relative instability of crosslinked polyacrylamide gel-filled capillaries for protein and DNA separations was addressed by the first reports of polymer net- works (47, 48). This led to the commercial introduction of kits for separations of proteins, oligonucleotides, and DNA. DNA sequencing can now be performed using various low viscosity polymer solutions (62, 63) The first commercial instrument was introduced in 1988 by the late Bob Brownlee's company, Microphoretics. The following year, new instruments from Applied Biosystems, Beckman, and Bio-Rad were introduced. Later, Spectra- Physics, Isco, Europhor, Dionex, Waters Associates, Hewlett-Packard, and Uni- cam entered the fray. Modular systems from Lauer Labs, Groton Technologies, Jasco, and Europhor became available over the next few years. In the mid 1990s, the slow development of the HPCE generic marketplace caused an industry shakeout as a number of instruments were withdrawn from the marketplace. In 1990, the first report employing a multiple capil- lary system was published (54). The mid to late 1990s provided the first application specific instruments for performing serum protein analysis (Beck- man) and DNA sequencing (Beckman, PE Biosystems, Molecular Dynamics). Instruments from the latter two companies are sold with 96 capillary arrays. These instruments are designed for high throughput DNA sequencing as required by the Human Genome Project. It is expected that human identifi- cation, another area that requires high throughput, will be implemented on these instruments. In 1998, Covergant Bioscience Limited of Ontario, Canada, reported on a new dedicated instrument for capillary isoelectric focusing. The entire capillary is imaged using a charged coupled device camera. The advantage of whole cap- illary imaging is the elimination of the mobilization step. Electrochromatogra- phy has attracted intense interest in the late 1990s. The present state of the commercial offerings is given in Table 1.3.
    • 1.6HistoricalPerspective15 u X U4 > 31GO<U c3• '^'S'I! >-(C«C/5 >m^ to ^.-yP5^ -g rt 13 ^g 'So <u<u •H^P 3._ SS00 •ss QUo 03 u 0^ HH J ^ '^b c« DH OS u to c/5 03 1 o 1/5 .2H 'COS 03 u ON ^g1^^ C/5C/5 >^P^ C/5Crt i-t)-t OSOS oo S-5 o^ 03(U _>>'^ 1=3OS en o •^p^ 13 O o o o o C/5 O :3 p. 13 o o o o 1/5 u o _o J UH en O en O P. J3 13 o en ';-!<U en O O O in W U en O 3 13 o W) 'ej en < 2Q o o o (N a w u o g e-O O W) OS ;-!OS PH 'en <-2 u o o en O X w y en O PH 1^ P. 13 (U O Q PH < Pd < 2 P o o 1—1 w NU U 1 k u 1—1 en P^ @ 5 W) "0 en < 2Q o o o1—1 w u 03 W) a; en en < 2O o I—1 ro 1PH W) en < 2Q <u N 13 rt <;<2 Q o o W) g 1to < 2Q o o ON W u to en CD en (0 en ooo &^e^e^PH 13 O o o m •^ en ?3 PH 13 cu g O o o .;2en ^ P. g u (U PH to ;3 PH 13 CO <u o sen 'en ^O PH g <u PH to w NU U kU u o o PH en en 3 PH ^ O oo o in B OS oI ,k_, rtOS > o U (0 uPI _«u 'u en O S uOS CU cu Xss !-H OJ (U PH ^•^ <U o»-H a (U PHto ^en <U P a o <u H "^>-H
    • 16 Chapter 1 Introduction 1.7 GENERIC HPCE SYSTEMS While application specific DNA systems are becoming wildly successful, generic HPCE systems have not provided the returns expected by the scientific instru- ment manufacturers. The generic HPCE system is designed for the user to develop his or her own methods. In HPLC, this type of system forms the largest segment of this multibillion dollar market. There are numerous reasons, beyond the scientific, that this has not occurred with HPCE. 1. Liquid chromatography (HPLC) is the greatest analytical instrumenta- tion success story in history. With a 23 year head start over HPCE, most problems have been worked out. Methods development is straightfor- ward, chemists are trained, and troubleshooting is usually simple. 2. HPLC scales up for preparative work and scales down to the capillary format with relative ease. It is possible to have a single method for ana- lytical, preparative, and commercial scale separations. 3. Many chromatographers consider HPCE to be the separations technique of last resort. 4. It is far more difficult for an instrument company sales force to sell HPCE. With quotas high and bonuses tied to performance, the sales- person goes where the money is. Setting up a demo instrument in a users lab is prone to failure, since the chemist is probably not trained in cap- illary electrophoresis. Postsales customer support is also quite high. 5. Capillary electrophoresis is electrophoresis, not chromatography. Chro- matographers must first master the principles of electrophoresis in order to effectively develop and troubleshoot methods. The training require- ments are not trivial. Methods development can seem overwhelmingly complex to the new user. 6. Private industry is so downsized that scientists have no time to learn new techniques. Many purchased instruments sit idle because of initial fail- ures of methods development. Instrument companies are downsized as well and have cut back on customer applications efforts. When faced with a problem chemists retreat to the familiar, and that is frequently HPLC. 7. Capillary electrophoresis is not as rugged as HPLC. Changes in the cap- illary surface chemistry lead to variable electroosmotic flow This in turn causes changes in the solute migration time. 8. The sensitivity of HPCE is lower than HPLC. This has become less of an issue as stacking techniques coupled with extended pathlength capillar- ies come into play. The training issues prevail, as many chemists are unaware of the variety of stacking techniques that exist. 9. There are few official methods of analysis employing HPCE. However, much is now in the pipeline. A number of pharmaceutical companies have submitted new drug applications to the Food and Drug Adminis- tration citing HPCE methodology.
    • 1.8 Instrumentation 17 10. Since a single HPCE instrument can replace as many as ten liquid chro- matographs, the size of the market may become self-limiting. The prospects for HPCE are not so bleak since once the learning curve is scaled. Successful methods development and routine implementation has been accomplished in many organizations. 1.8 INSTRUMENTATION The instrumental configuration for HPCE is relatively simple. Before 1988, all work was done on simple homemade systems of a design similar to Jorgenson and Lukacs's original work (35, 59, 64). A schematic of a homemade system is shown in Figure 1.7. The system con- sists of a high voltage power supply, buffer reservoirs, an HPLC ultraviolet detec- tor, a capillary, and a Plexiglas cabinet. A safety interlock can be employed to prevent activation of high voltage when the cabinet is open. The capillary can be filled with buffer by a vacuum, generated using a syringe or handpump. Sam- ples are injected either by siphoning (elevating the capillary for a defined time at a specified height) or by electrokinetic injection. While these simple systems provide good separations, precision may be poor due to the lack of temperature control and system automation. Another common problem in homemade systems is excessive detector noise. The capillary is threaded through the detector and generally passes close to sensitive elec- tronics, where the high electric field frequently causes electrical disturbances due POWER SUPPLY CAPILLARY DETECTOR CATHOLYTE ELECTRODES ^ ^ Q ^ ^ T E (OUTLET) (INLET) FIGURE 1.7 Basic schematic of an HPCE Instrument.
    • 18 Chapter 1 Introduction to inadequate grounding and shielding. This problem has been solved in com- mercial instrumentation. The advantage of homemade systems is primarily in the area of detection. It is easy to interface HPCE to fluorescence detection and in particular laser- induced fluorescence. With the introduction of commercial modular systems, the advantages of homebuilt systems have all but disappeared excepting cost. The arrival of commercial instruments has facilitated substantial growth in the field. An illustration of the now obsolete Applied Biosystems 270A is shown in Figure 1.8. This instrument provides the following basic features: a high volt- age power supply that can provide up to 30 kV, an autosampler, electrodes, a separation capillary, an air-cooled capillary temperature controller, a UV detec- tor, a capillary filling apparatus, and microprocessor control. Newer instruments have random access where any vial can be designated as the inlet or outlet. Most of the newer instruments contain the capillary within a cartridge for efficient cooling with either air or fluids. Pressure is used rather than vacuum for filling the capillary; this is an advantage when using viscous polymers or interfacing to the mass spectrometer. Many instruments can also perform voltage programming and fraction collection, have alternative detec- tors such as fluorescence, photodiode array, or conductivity, and possess cooled T Microprocessor Reporting Integrator Regulated Vacuum Reservoirs Vent Solenoid Valves csfe zDetector 1 Thermostated Compartment Sample Buffer Reservoir Sample Vials Vacuum Buffer Reservoir Auto Sampler Carousel FIGURE 1.8 Schematic of the Apphed Biosystems 270A. Courtesy of Apphed Biosystems.
    • 1.9 Sources of Information on HPCE 1 9 autosamplers. Data systems that are specifically designed for HPCE are found on most units. Computers now provide for system control on all fully auto- mated units. 1.9 SOURCES OF INFORMATION ON HPCE Keeping up with the hterature in HPCE is no small task. Through 1998, about 7000 English language papers have appeared in the literature. The growth of the literature in the field is illustrated in Figure 1.9. Note the large increase that began in 1988, the year of commercial introduction of HPCE instrumentation. The conference proceedings of the International Symposia on High Perfor- mance Capillary Electrophoresis that have appeared in the Journal of Chro- matography, Vols. 480, 516,559,608, 652,680, 717, 744, 745, 781,817, and 853, contain an impressive concentration of state-of-the-art results. Other journals containing numerous papers on HPCE are Analytical Chemistry,Journal ofMicro- column Separations, Chromatographia,Journal ofHigh Resolution Chromatography, Electrophoresis, Journal of Liquid Chromatography and Related Techniques, and Journal of Capillary Electrophoresis. Many dedicated issues from some of these journals covering HPCE, notably Electrophoresis and Journal of Liquid Chro- matography, have been published as well. For a comprehensive review of the literature, the biannual editions of Analytical Chemistry entitled "Fundamental Reviews" should be consulted. For general information on the theory of electromigration techniques, see (65) for an excellent review. Two recent editions of Electrophoresis, Vol. 18 (1997) No. 12-13 and Vol. 19 (1998) No. 16-17, contain outstanding 1400 r -^ ^ - ^ ~ - - - ~- - ^ -^.-.--.- -; 123^ laooh 1000 h 800 j-- 600 400 200 1" 0 9 • i 3 HumbBf of P 1 6 4 apers il ^^ ^m 80 81 82 83 84 86 86 87 BB 89 90 91 92 93 94 95 96 97 FIGURE 1.9 The growth of the hterature of HPCE.
    • 20 Chapter 1 Introduction Table 1.4 Capillary Electrophoresis Books and Proceedings Grossman, ED., Colbum,J.C., eds. Capillary Electrophoresis: Theory and Practice. 1992, Acadenic Press. Vindevogel, J., Sandra, P Introduction to Micellar Electrokinetic Chromatography. 1992, Huthig. Guzman, N., ed. Capillary Electrophoresis Technology. 1993, Marcel Dekker. Weinberger, R. Practical Capillary Electrophoresis. 1993, Academic Press. Camilleri, P., ed. Capillary Electrophoresis: Theory and Practice. 1993, CRC Press. Foret, E, Krivankova, L., Bocek, P Capillary Zone Electrophoresis. 1993, VCH. Jandik, P, Bonn, G. Capillary Electrophoresis of Small Molecules and Ions. 1993, VCH. Baker, D. Capillary Electrophoresis. 1995, Wiley. Righetti, P G., ed. Capillary Electrophoresis in Analytical Biotechnology. 1995, CRC. Engelhardt, H., Beck, W, Schmitt, T. Capillary Electrophoresis: Methods and Potentials. 1996, Vieweg. Cohen, A. S., Terabe, S., Deyl, Z., eds. Capillary Electrophoretic Separation of Drugs. 1996, Elsevier. Altria, K.D., ed. Capillary Electrophoresis Guidebook: Principles, Operation, and Applications. 1996, Humana Press. Jackim, E., ed. Capillary Electrophoresis Procedures Manual. 1996, Elsevier. Lunte, S. M., Radzik, D. M., eds. Pharmaceutical and Biomedical Applications of Capillary Elec- trophoresis. 1996, Pergamon. Coleman, D., ed. Directory ofCapillary Electrophoresis: New Completely Revised Edition, 1996, Elsevier Chankvetadze, B. Capillary Electrophoresis in Chiral Analysis. 1997, John Wiley 62: Sons. Parvez, H., Caudy, P, Parvez, S., Roland-Gosselin, P, eds. Capillary Electrophoresis in Biotechnol- ogy and Environmental Analysis. 1997, VSP Shintani, H., Polonsky J., ed. Handbook of Capillary Electrophoresis Applications. 1997, Blackie. Weston, A., Brown, PR., HPLC and CE: Principle and Practice. 1997, Academic Press. Heller, C, ed. Analysis of Nucleic Acids by Capillary Electro phoresis. 1997, Vieweg. Khaledi, M.G., ed. High Performance Capillary Electrophoresis. Theory, Techniques, and Appli- cations. 1998, Wiley reviews of most aspects of HPCE. There have been numerous textbooks and conference proceedings in this field; a compilation is given in Table 1.4. 1.10 CAPILLARY ELECTROPHORESIS: A FAMILY OF TECHNIQUES Capillary electrophoresis comprises a family of related techniques with differ- ing mechanisms of separation. These techniques, which are covered in the fol- lowing chapters of this book, are: capillary zone electrophoresis (CZE) capillary isoelectric focusing (CIEF)
    • References 21 capillary gel electrophoresis (CGE)^ capillary isotachophoresis (CITP)-^ micellar electrokinetic capillary chromatography (MECC)^ capillary electroosmotic chromatography (CEC). ^CGE is now performed using replaceable polymer network reagents. 7CITP is considered here only for trace enrichment or sample stacking. ^MECC is the most significant application employing secondary equilibrium with CZE. REFERENCES 1. Westheimer, R., Electrophoresis in Practice: A Guide to Methods and Applications ofDNA and Pro- tein Separations, 2nd Ed. 1997, Wiley. l.Mosher, R. A., Saville, D. A., Thormann, W, The Dynamics of Electrophoresis. 1992, VCH. 3.Rickwood, D., Hames, B. D., Gel Electrophoresis of Nucleic Acids: A Practical Approach, 2nd Ed. 1990, IRL Press. 4. Rickwood, D., Hames, B. D., Gel Electrophoresis of Proteins: A Practical Approach, 2nd Ed. 1990, IRL Press. 5. Andrews, A. T., Electrophoresis: Theory, Techniques and Biochemical and Clinical Applications. 1981, Clarendon Press. 6. Righetti, P. G., Isoelectric Focusing: Theory, Methodology and Applications. Laboratory Techniques in Biochemistry and Molecular Biology, ed. T. S. Work and R. H. Burdon. 1983, Elsevier Bio- medical Press. 7. Chrambach, A., The Practice of Quantitative Gel Electrophoresis. 1985, VCH. S.Dunn, M. J., ed. Gel Electrophoresis of Proteins. 1986, Wright. 9.Jorgenson, J. W, Phillips, M., eds. New Directions in Electrophoretic Methods ACS Symposium Series 335. 1987. American Chemical Society. 10.Southern, E. M.J. Mol. Biol, 1975; 98:503. 1 I.Jennings, W, Analytical Gas Chromatography. 1987, Academic Press, p.5. 12.Novotny, M., Ishii, D., eds. Microcolumn Separations. 1985, Elsevier. 13.1shii, D., ed. Introduction to Microscale High Performance Liquid Chromatography. 1988, VCH. 14. Yang, E J., ed. Microbore Column Chromatography: A Unified Approach to Chromatography. 1989, Marcel Dekker. 15.Carrilho, E., Miller, A. W, Ruiz-Martinez, M. C, Kotler, L., Kesilman, J., Karger, B. L. Factors to Be Considered for Robust High-Throughput Automated DNA Sequencing Using a Multiple- Capillary Array Instrument. Proc. SPIE-Int. Soc. Opt. Eng., 1997; 2985 (Ultrasensitive Biochem- ical Diagnostics II):4. 16.Huang, X. C, Quesada, M. A., Mathies, R. A. Capillary Array Electrophoresis Using Laser- Excited Confocal Fluorescence Detection. Anal. Chem., 1992; 64:967. 17.Bienvenu, J., Graziani, M. S., Rpin, E A., Bernon, H., Blessum, C, Marchetti, C, Righetti, G., Somenzini, M., Verga, G., Aguzzi, E Multicenter Evaluation of the Paragon CZE 2000 Capillary Zone Electrophoresis for Serum Protein Electrophoresis and Monoclonal Component Typing. Clin. Chem., 1998; 44:599. 18. Smith, N. W, Evans, M. B. The Efficient Analysis of Neutral and Highly Polar Pharmaceutical Compounds Using Reversed-Phase and Ion-Exchange Electrochromatography. Chro- matographifl, 1995; 41:197. 19.Dittman, M. M., Wienand, K., Bek, E, Rozing, G. P. Theory and Practice of Capillary Elec- trochromatography LC-GC, 1995; 13:800.
    • 22 Chapter 1 Introduction 20.Manz, A., Harrison, D. J., Verpoorte, E. M. J., Fettinger, J. C, Ludi, H., Widmer, H. M. Minia- turization of Chemical Analysis Systems—A Look into Next Century's Technology or Just a Fashionable Craze. Chimia, 1991; 45:103. 21.Manz, A., Harrison, D. J., Verpoorte, E. M. J., Fettinger, J. C, Paulus, A., Ludi, H., Widmer, H. M. Planar Chips Technology for Miniaturization and Integration of Separation Techniques into Monitoring Systems. Capillary Electrophoresis on a Chip. J. Chromatogr., 1992; 593:253. 22.Woolley, A. T, Mathies, R. A. Ultra-High-Speed DNA Sequencing Using Capillary Elec- trophoresis Chips. Anal. Chem., 1995; 67:3676. 23. Chiem, N. H., Harrison, D. J. Microchip Systems for Immunoassay: An Integrated Immunoreactor with Electrophoretic Separation for Serum Theophylline Determination. Clin. Chem., 1998; 44:591. 24. Colyer, C. L., Tang, T, Chiem, N., Harrison, D.J. Clinical Potential of Microchip Capillary Elec- trophoresis. Electrophoresis, 1997; 18:1733. 25.Effenhausen, C. S., Manz, A. Miniaturizing a Whole Analytical Laboratory Down to Chip Size. Am.Lah., 1994; 26:15. 26.Harrison, D. J., Manz, A., Fan, Z., Ludi, H., Widmar, H. M. Capillary Electrophoresis and Sam- ple Injection Systems Integrated on a Planar Glass Chip. Anal. Chem., 1992; 64:1926. 27.Jacobson, S. C, Hergenroder, R., Koutny, L. B., Ramsey, M. J. High Speed Separations on a Microchip. Anal. Chem., 1994; 66:1114. 28.Jacobson, S. C, Hergenroder, R., Koutny, L. B., Ramsey, M.J. Open Channel Electrochro- matography on a Microchip. Anal. Chem., 1994; 66:2369. 29.Jacobson, S. C, Hergenroder, R., Koutny L. B., Warmack, R. J., Ramsey M. J. Effects of Injec- tion Schemes and Column Geometry on the Performance of Microchip Electrophoresis Devices. Anal. Chem., 1994; 66:1107. 30.Vesterberg, O. History of Electrophoretic Methods. J. Chromatogr, 1989; 480:3. 31. Compton, S. W, Brownlee, R. G. Capillary Electrophoresis. BioTechniques, 1988; 6:432. 32.Hjerten, S. Free Zone Electrophoresis. Chromatogr Rev., 1967; 9:122. 33.Pretorius, V, Hopkins, B. J., Schieke, J. D. A New Concept of High-Speed Liquid Chromatogra- phy J. Chromatogr, 1974; 99:23. 34.Mikkers, F E. R, Everaerts, F M., Verheggen, T P. E. M. High Performance Zone Electrophore- sis. J. Chromatogr, 1979; 169:11. 35.Jorgenson, J. W, Lukacs, K. D. Zone Electrophoresis in Open Tubular Glass Capillaries. Anal. Chem., 1981; 53:1298. 36.Hjerten, S. High-Performance Electrophoresis: The Electrophoretic Counterpart of High Per- formance Liquid Chromatography. J. Chromatogr, 1983; 270:1. 37.Terabe, S., Otsuka, K., Ichikawa, K., Tsuchiya, A., Ando, T. Electrokinetic Separations with Micellar Solutions and Open-Tubular Capillaries. Anal. Chem., 1984; 56:111. 38.Hjerten, S., Zhu, M.-D. Adaptation of the Equipment for High-Performance Electrophoresis to Isoelectric Focusing. J. Chromatogr, 1985; 346:265. 39.Gassmann, E., Kuo, J. E., Zare, R. N. Electrokinetic Separation of Chiral Compounds. Science, 1985; 230:813. 40.Hjerten, S. High-Performance Electrophoresis: Elimination of Electroendosmosis and Solute Adsorption. J. Chromatogr, 1985; 347:191. 41.Lauer, H. H., McManigill, D. Capillary Zone Electrophoresis of Proteins in Untreated Fused Sil- ica Tubing. Anal. Chem., 1986; 58:166. 42.01ivares, J. A., Nguyen, N. T, Yonker, C. R., Smith, R. D. On-Line Mass Spectrometric Detec- tion for Capillary Zone Electrophoresis. Anal. Chem., 1987; 59:1230. 43. Wallingford, R. A., Ewing, A. G. Capillary Zone Electrophoresis with Electrochemical Detec- tion. Anal. Chem., 1987; 59:1762. 44.Kuhr, W G., Yeung, E. S. Indirect Fluorescence Detection of Native Amino Acids in Capillary Zone Electrophoresis. Anal. Chem., 1988; 60:1832. 45. Chen, C. Y., Morris, M. D. Raman Spectroscopic Detection System for Capillary Zone Elec- trophoresis. Appl. Spectrosc, 1988; 42:515.
    • References 2 3 46. Guttman, A., Paulus, A., Cohen, A. S., Grinberg, N., Karger, B. L. Use of Complexing Agents for Selective Separation in High-Performance Capillary Electrophoresis: Chiral Resolution via Cyclodextrins Incorporated Within Polyacrylamide Gel Columns. J. Chromatogr., 1988; 448:41. 47.Hjerten, S., Valtcheva, L., Elenbring, K., Eaker, D. High-Performance Electrophoresis of Acidic and Basic Low-Molecular Weight Compounds and of Proteins in the Presence of Polymers and Neutral Surfactants. J. Liq. Chromatogr., 1989; 12:2471. 48.Zhu, M., Hansen, D. L., Burd, S., Gannon, F. Factors Affecting Free Zone Electrophoresis and Isoelectric Focusing in Capillary Electrophoresis. J. Chromatogr., 1989; 480:311. 49. Cohen, A. S., Najarian, D. R., Karger, B. L. Separation and Analysis of DNA Sequence Reaction Products by Capillary Gel Electrophoresis. J. Chromatogr, 1990; 516:49. 50.Drossman, H., Luckey J. A., Kostichka, A. J., D'Cunha, J., Smith, L. M. High-Speed Separations of DNA Sequencing Reactions by Capillary Electrophoresis. Anal. Chem., 1990; 62:900. 51.Luckey, J. A., Drossman, H., Kostichka, A. J., Mead, D. A., D'Cunha, J., Norris, T. B., Smith, L. M. High Speed DNA Sequencing by Capillary Electrophoresis. Nud. Acids Res., 1990; 18:4417. 52.Swerdlow, H., Gesteland, R. Capillary Gel Electrophoresis for Rapid, High Resolution DNA Sequencing. Nud. Adds Res., 1990; 18:1415. 53. Swerdlow, H., Wu, S., Harke, H., Dovichi, N. J. Capillary Gel Electrophoresis for DNA Sequencing: Laser-Induced Fluorescence Detection with the Sheath Flow Cuvette.J. Chromatogr, 1990; 516:61. 54.Zagursky, R. J., McCormick, R. M. DNA Sequencing Separations in Capillary Gels on a Modi- fied Commercial DNA Sequencing Instrument. BioTechniques, 1990; 9:74. 55.Dadoo, R., Colon, L. A., Zare, R. N. Chemiluminescence Detection in Capillary Electrophore- sis. HRC & CC, 1992; 15:133. 56. Wu, N., Peck, T. L., Webb, A. G., Magin, R. L., Sweedler, J. V Nanoliter Volume Sample Cells for ^H NMR: Application to Online Detection in Capillary Electrophoresis. J. Am. Chem. Soc, 1994; 116:7929. 57.Walbroehl, Y., Jorgenson, J. W On-Column UV Absorbance Detector for Open Tubular Capil- lary Zone Electrophoresis. J. Chromatogr, 1984; 315:135. 58. Green, J. S., Jorgenson, J. W Design of a Variable Wavelength UV Absorption Detector for On- Column Detection in Capillary Electrophoresis and Comparison of Its Performance to a Fixed Wavelength UV Absorption Detector. J. Liq. Chromatogr, 1989; 12:2527. 59.Jorgenson,J. W, Lukacs, K. D. Free-Zone Electrophoresis in Glass Capillaries. Clin. Chem., 1981; 27:1551. 60. Wallingford, R. A., Ewing, A. G. Capillary Zone Electrophoresis with Electrochemical Detec- tion in 12.7|Lim Diameter Columns. Anal. Chem., 1988; 60:1972. 61.Pentoney, S. L., Zare, R. N., Quint, J. F. On-Line Radioisotope Detection for Capillary Elec- trophoresis. Anal. Chem., 1989; 61:1642. 62.Salas-Solano, O., Carrilho, E., Kolter, L., Miller, A. W, Goetzinger, W, Sosic, Z., Karger, B. L. Routine DNA Sequencing of 1000 Bases in Less than One Hour by Capillary Electrophoresis with Replaceable Linear Polyacrylamide Solutions. Anal. Chem., 1998; 70:3996. 63. Kim, Y., Yeung, E. S. Separation of DNA Sequencing Fragments up to 1000 Bases by Using PolyCethylene Oxide)-Filled Capillaries. J. Chromatogr, A, 1997; 781:315. 64.Jorgenson, J. W, Lukacs, K. D. Zone Electrophoresis in Open-Tubular Glass Capillaries: Pre- liminary Data on Performance. HRC & CC, 1981; 4:230. 65.Kleparnik, K., Bocek, P Theoretical Background for Clinical and Biomedical Applications of Electromigration Techniques. J. Chromatogr, 1991; 569:3.
    • CHAPTER 2 Capillary Zone Electrophoresis Basic Concepts 2.1 Electrical Conduction in Fluid Solution 2.2 The Language of Electrophoresis 2.3 Electroendoosmosis 2.4 Efficiency 2.5 Resolution 2.6 Joule Heating 2.7 Optimizing the Voltage and Temperature 2.8 Capillary Diameter and Buffer Ionic Strength 2.9 Optimizing the Capillary Length 2.10 Buffers 2.11 Temperature Effects 2.12 Buffer Additives 2.13 Capillaries 2.14 Sources of Band Broadening References 2.1 ELECTRICAL CONDUCTION IN FLUID SOLUTION Several simple concepts are important for understanding the physical processes that occur upon passage of an electrical current through an ionic solution. ^ These processes are far more complex than the passage of current through a metal. In metals, uniform and v^eightless electrons carry all the current. In fluid ^See any basic text on physical chemistry for a thorough description of electrical conduction in fluid solution. 25
    • 26 Chapter 2 Capillary Zone Electrophoresis solution, the current is carried by cations and anions. The molecular weight of these charge bearing ions ranges from a simple proton to tens of thousands for large complex ions such as proteins and polynucleotides. Conduction in fluid solution is still described by Ohm's law, E = IR, (2.1) where E is the voltage or applied field, I is the current that passes through the solution, and R is the resistance of the fluid medium. The reciprocal of resistance is conductivity. Kohlrausch found that the con- ductivity of a solution resulted from the independent migration of ions. As illustrated in Figure 2.1, when a current passes through an ionic solution, anions migrate toward the anode (positive electrode) while cations migrate toward the cathode (negative electrode) in equal quantities. Despite the passage of current, electroneutrality of the solution is always maintained because of electrolysis at each electrode. This is important because electrolysis produces protons at the anode and hydroxide at the cathode (Figure 2.2). The resultant pH changes are due to the process known as buffer depletion (1-3). Since pH is the single most important experimental parameter in capillary electrophoresis, this effect must be mini- mized by 1. Using the appropriate buffers 2. Having sufficiently large buffer reservoirs 3. Replacing buffers frequently The introduction of a sample into the capillary changes the situation dra- matically (Figure 2.3). The Ohm's law equation changes as well to that for a series circuit: E = IR^ + IRj . (2.2) This process and the equation have important implications in HPCE. When low- conductivity samples (relative to the BGE) are injected, a process known as stacking (Section 8.6) occurs. This permits the use of large-volume injections CATHODE ANODE FIGURE 2.1 The independent migration of ions.
    • 2.1 Electrical Conduction in Fluid Solution 27 POWER SUPPLY CAPILLARY DETECTOR OH GENERATED AT CATHODE H GENERATED AT ANODE CATHOLYTE (OUTLET) ELECTRODES FIGURE 2.2 Buffer depletion. ANOLYTE (INLET) to be employed without excessive band broadening because zone compression occurs. On the other hand, if high-conductivity samples are injected relative to the BGE, antistacking or zone broadening will occur. The conductivity of a solution is determined by two factors: 1. The concentration of the ionic species. 2. The speed of movement or mobility of the ionic species in an electric field. In other words, highly mobile species are also highly conductive, and vice versa. IR IR, ©, FIGURE 2.3 Impact of the sample injection on the IR drops in a capillary.
    • 2 8 Chapter 2 Capillary Zone Electrophoresis The mobility of ions in fluid solution is governed by their charge to size ratio. The size of the molecule is based on the molecular weight, the three-dimensional structure, and the degree of solvation (usually hydration). Data given in Table 2.1 (4) for alkali metals illustrate several of these important points: 1. The orders for the mobilities of the metal ions are the reverse of what is expected based on the metal or crystal radii data. These smaller ions are more hydrated than their larger counterparts. 2. The current generated by 100 mM solutions of various acetate salts is proportional to the ionic mobility of the cation. This feature becomes important when selecting the appropriate counterion for preparing buffer solutions. The forces governing this behavior are expressed by Stoke's law, / = 67rrirv , (2.3) where 7] = viscosity, r = ionic radius, and v = ionic velocity. The competing forces of mobility (velocity) and viscosity are illustrated in Figure 2.4 for an ion of radius r. Ionic size modifies mobility because of a solute's exposure to fric- tional drag as it migrates through the supporting electrolyte. The frictional drag is directly proportional to viscosity, size, and electrophoretic velocity. An expres- sion for mobility that contains these terms is M—)=-5^^^^^ = ^ - , (2.4) Vs E(V/cm) 6nrir where q = the net charge and E = the electric field strength. Thus, mobility is considered a charge-to-size ratio. Since the units for velocity are centimeters per second and the field strength is expressed as volts per centimeter, the units of mobility are cm^A^s. 2.2 THE LANGUAGE OF ELECTROPHORESIS There are several distinguishing differences between the terminology of chro- matography and that of capillary electrophoresis. For example, a fundamental para- meter in chromatography is the retention time. In electrophoresis nothing should ever be retained (except for CEC), so a more descriptive term is migration time: the time it takes a solute to travel from the beginning of the capillary to the detec- tor window.
    • 2.2TheLanguageofElectrophoresis29 < I—I 2 o 1^ T1 <SJ t<U to 4:5 v^> »-l 3 0u fio 2»- OS,^ B X 0 TJ !U P^nd OH <;>> o< "rn 3 Tl rr! X^ II UPi Sf2 hs.in^in ^ONOrH ON ON O rn 00 d —1.-I(N su u =^0 ^r^ON 5o^j <-.
    • 30 Chapter 2 Capillary Zone Electrophoresis MOBILITY FRICTIONAL FORCES FIGURE 2.4 The competing forces of electrophoretic mobility and viscous drag. The use of a detection window in HPCE (on-capillary detection) as opposed to postcolumn detection must also be considered. In HPLC, the length of the chromatographic column must be included in all methods. Figure 2.5 is a draw- ing of a capillary. Both the total length of the capillary (L^ or L) and the length to the detector (L^ or I) must be described. The segment of capillary that occurs after the detector window is necessary to make electrical contact with the out- let or detector-side electrolyte reservoir. Ideally, L^ - L^ should be as short as practical. Otherwise, some system voltage (V) is wasted on maintaining field strength (E) over part of the capillary that lies beyond the detector window and hence does not participate in the separation. Lt DETECTION WINDOW FIGURE 2.5 Illustration of a capillary defining the total length (Lj) and the length to the detec- tor (Ld).
    • "ep Mep E .jjtrn 2.3 Electroendoosmosis 31 Expressions for some other fundamental terms are given in the following equations: (2.5) (2.6) The preceding include the electrophoretic mobility (^ep^ cm^A^s), the elec- trophoretic velocity (Vgp, cm/s), and the field strength (E, V/cm). These equa- tions define some fundamental features of HPCE: 1. Velocities are measured experimentally (Eq. 2.5). They are determined by dividing the length of capillary, from the injection side to the detec- tor window (Ld), by the migration time t^. 2. MobiUties are calculated by dividing the electrophoretic velocity v^p by the field strength (Eq. 2.6). The field strength is simply the voltage divided by the total capillary length (L^). The field strength is the important parameter governing electrophoretic migration. Field strength is changed when either the voltage or the capillary length is altered. Mobility is the fundamental parameter of capillary electrophoresis. This term is independent of voltage and capillary length. Equations (2.6) and (2.7) define only the relative mobility. To calculate the true mobility, a correction for a phenomenon known as electroendoosmotic flow (Section 2.3) must first be made. 2.3 ELECTROENDOOSMOSIS A. THE CAPILLARY SURFACE One of the fundamental processes that accompanies electrophoresis is electroos- mosis. One of the "pumping" mechanisms of HPCE, electroosmosis occurs because of the surface charge, known as the zeta potential, on the wall of the cap- illary. Fused silica is the most common material used to produce capillaries for HPCE. Technology developed for manufacturing capillary columns for GC read- ily transferred to HPCE. Fused silica is a highly crosslinked polymer of silicon dioxide with tremendous tensile strength (5), although it is quite brittle. With its polyimide coating, fused silica is quite durable, although some polyimide must
    • 32 Chapter 2 Capillary Zone Electrophoresis be removed to create a ultraviolet (UV) transparent optical window for detection. Other materials such as Teflon and quartz have been used (6), but performance and cost are less favorable. Before use, capillaries are usually conditioned with 1 N sodium hydroxide. The base ionizes free silanol groups and may cleave some silica epoxide linkages as well. An anionic charge on the capillary surface results in the formation of an electrical double layer. The resulting ionic distribution is shown in Figure 2.6 (7). Anions are repelled from the negatively charged wall region, whereas cations are attracted as counterions. Ions closest to the wall are tightly bound and immobile, even under the influence of an electric field. Further from the wall is a compact and mobile region with substantial cationic character. At a greater distance from the wall, the solution becomes electrically neutral as the zeta potential of the wall is no longer sensed. Expressions describing this phenomenon were derived by Gouy and Chapman in 1910 and 1913, respectively This diffuse outer region is known as the Gouy-Chapman layer. The rigid inner layer is called the Stem layer. When a voltage is applied, the mobile positive charges migrate in the direc- tion of the cathode or negative electrode. Since ions are solvated by water, the fluid in the buffer is mobilized as well and dragged along by the migrating charge. Although the double layer is perhaps 100 A thick, the electroendoos- motic flow (EOF) is transmitted throughout the diameter of the capillary, pre- sumably through hydrogen bonding of water molecules or van der Waals interactions between buffer constituents. The electroosmotic flow as defined by Smoluchowski in 1903 is given by Veo = ^ E , (2.8) where £ is the dielectric constant, 77 is the viscosity of the buffer, and f is the zeta potential of the liquid-solid interface. The equation is only valid for capil- laries sufficiently large that the double layers on opposite walls do not overlap each other (8). Practical use of this equation is not forthcoming, as the zeta potential is rarely measured and data for the dielectric constants of mixtures are not readily available. Like electrophoretic mobility, the EOF is inversely pro- portional to the viscosity of the BGE. B. MEASURING THE ELECTROOSMOTIC FLOW Since the migration time of a solute is influenced by the EOF, calculation of the actual mobility requires measurement of the EOF: Here jH^^ = the actual mobility, jU^pp = apparent (observed) mobility, and jLl^o = electroosmotic mobility. The use of mobility as the "migration parameter"
    • 2.3 Electroendoosmosis 33 inttrfaisa c . ^ g—: SI ®, '"^lA J Z*^^ /'""x x*i*' I • X - adsorbed compact diffuse layer layer layer B « 4N# 0 fit i interf8€0 1 i s 1 1 u r L <*• 1 1 ^ l ^ compact. dlffuM***" layer 1 ''yr ' ^ • HMliiiiiiliilnpi dislanai from lh# eolynin wail FIGURE 2.6 Representation of the electrical double layer versus distance from the capillary wall. Reprinted with permission from J. Chromatogr., 559, 69 (1991), copyright © 1991 Elsevier Science Publishers. will frequently yield greater precision compared to the use of migration time, since the impact of the EOF is factored out of the calculation (Section 10.6). Routine measurement of the EOF is also necessary to ensure the integrity of the separation. If the EOF is not reproducible, it is likely that the capillary wall is being affected by some component in the sample or an experimental para- meter is not being properly controlled (see Section 2.3F).
    • 34 Chapter 2 Capillary Zone Electrophoresis The simplest method for measuring the EOF is to inject a dilute solution con- taining a neutral solute and measure the time it takes to transit the detector (9-11). Since the capillary length is known, the velocity in centimeters per second is eas- ily calculated. Dividing that value by the field strength yields the electroosmotic mobility in units of cmWs. Neutral solutes such as methanol, acetone, benzyl alcohol, and mesityl oxide are frequently employed. When MECC is the mode of separation (Chapter 4), a further requirement that the marker solute not partition into the micelle is imposed. When the EOF is slow, the migration time can be quite long. To reduce the experimental time, it is useful to use the short end of the capillary to make the measurement. The short end is the section of capillary normally found between the detector window and capillary outlet. The injection can be made at the out- let side and the system operated using reversed polarity Now the EOF is mea- sured using a short capillary length of 6-10 cm depending on the brand of instrument. As will be shown later, the short end of the capillary can be very useful when performing screening runs during methods development. When the EOF is very slow, as in the case with certain coated capillaries, spe- cial techniques must be employed (12). It is seldom necessary to measure very weak EOF, since it does not notably affect mobility or experimental precision. C. EFFECT OF BUFFER P H The impact of pH on the EOF and the mobility is illustrated in Figure 2.7. At high pH the silanol groups are fully ionized, generating a strong zeta potential and dense electrical double layer. As a result, the EOF increases as the buffer pH is elevated (9, 13). A robust flow, typically around 2 mm/s at pH 9 in 20 mM borate buffer at 30 kV, 30°C is realized. For a 50 |Lim capillary, this translates to 235 nL/min. Since the total volume of a 50 cm x 50 jim i.d. capillary is only 980 nL, a neutral compound would reach the detector in 4.2 min. At pH 3, the EOF is much lower, about 30 nL/min. The EOF must be controlled or even suppressed to run certain modes of HPCE. On the other hand, the EOF makes possible the simultaneous separation of cations, anions, and neutral species in a single run. For example, a zwitterion like a peptide will be negatively charged at a pH above its pi. The solute will elec- tromigrate toward the positive electrode. However, the EOF is sufficiently strong that the solute's net migration is toward the negative electrode (Figure 2.7, top). At low pH, the zwitterion has a positive charge and will migrate as well toward the negative electrode (Figure 2.7, bottom). In untreated fused-silica capillar- ies, most solutes migrate toward the negative electrode unless buffer additives or capillary treatments are used to reduce or reverse the EOF (Section 3.3). The EOF is exquisitely sensitive to pH (9,14,15). Hysteresis effects have been reported (15) wherein the direction of approach to a particular pH value produces a different pH (Figure 2.8). When approaching from the acid side, the measured
    • 2.3 Electroendoosmosis HIGH pH 35 ++++•'•+•'•+++++++++++++++++++++++++"'•+•*'+''" M,0 / * ep 4 . 4 . ^ 4 . 4 , 4 » 4.4> 4. 4 . 4 . 4 . 4 . 4 . 4 . 4 . 4 * 4 . + + + + + 4* + 4- + + +^+ + -f + -I" + -f + FIGURE 2.7 Behavior of electroendoosmotic flow and electrophoretic migration of a zwitterion (pi = 7) at high and low pH. EOF is always lower, and vice versa. This means there is a kinetic parameter with regard to the estabUshment of a stable charge on the capillary wall. Longer equili- bration times would reduce hysteresis at the expense of increased total run time. Since the EOF will affect migration time precision, it is important to design experiments with these features in mind. The problems with EOF repro- ducibility are often most severe in the pH range 4-6 (15). D. EFFECT OF BUFFER CONCENTRATION The expression for the zeta potential is (16) c = 47r5e (2.10) where £ = the buffer's dielectric constant, e = total excess charge in solution per unit area, and 5 is the double-layer thickness or Debye ionic radius. The Debye radius is 5 = (3 x 10'')(Z)(Ci/^), where Z = number of valence electrons and C = the buffer concentration. As the ionic strength increases, the zeta potential and, similarly, the EOF decreases in proportion to the square root of the buffer concentration. This was
    • 36 Chapter 2 Capillary Zone Electrophoresis 10 9 + 8+ E o % 6 X u. o 5 4+ 3+ H 1 1 1 1—I 1 1 1 1 2 3 4 5 6 7 8 9 10 11 PH FIGURE 2.8 Effect of experimental design on the EOF. Key: • , high pH titrated to low pH; •, low pH titrated to high pH. Data from reference (15). confirmed experimentally (17) for a series of buffers where the EOF was found hnear to the natural logarithm^ of the buffer concentration. It was reported that equivalent EOF is found for different buffer types as long as the ionic strength is kept constant (17). The effect of buffer concentration and field strength is shown in Figure 2.9 (18). The electroosmotic mobility is plotted against field strength for phosphate buffer at three different concentrations using a 50-|Lim-i.d. capillary. As expected, the higher buffer concentrations showed lower EOF at all field strengths. Since ^The linear relationship of EOF with the buffer concentration is a square root relationship as indicated by Eq. (2.10).
    • 2.3 Electroendoosmosis 37 71 u. ^^ u z o Sliini UJ 50 100 150 200 E (V/cm) 250 FIGURE 2.9 Effect of buffer concentration and field strength (E, V/cm) on the electroosmotic flow in a 50-|xm-i.d. capillary. Buffer: phosphate at a concentration of (a) 10 mM; (b) 20 mM; (c) 50 mM. Redrawn with permission from J. Chromatogr., 516, 223 (1990), copyright © 1990 Elsevier Science Publishers. mobility was plotted, all three lines should be flat. Slight positive slopes were reported for all three concentrations, presumably due to heating effects (Sec- tion 2.6). The same data produced using a lOO-jiim-i.d. capillary will be exam- ined in that section. E. EFFECT OF ORGANIC SOLVENTS Organic solvents can modify the EOF because of their impact on buffer viscos- ity (17) and zeta potential (19). Linear alcohols such as methanol, ethanol, or isopropanol usually decrease the EOF because they increase the viscosity of the electrolyte. Acetonitrile either does not affect or may slightly increase the EOF (20). Organic solvents are often employed in HPCE to help solubilize the sam- ple. Selectivity can be affected as well in both CZE (20) and MECC (21). Because of the sensitivity of organic solvent concentration on selectivity, evaporation must
    • 3 8 Chapter 2 Capillary Zone Electrophoresis be carefully controlled. In this regard, wholly aqueous separations are often advantageous. F. CONTROLLING THE ELECTROOSMOTIC FLOW The EOF is a double-edged sword. It allows the separation of cations, anions, and neutral solutes in a single run. It is also the single most important contrib- utor to migration time variability on a run-to-run, day-to-day, and capillary-to- capillary basis. The EOF is affected by many parameters, including Buffer pH Buffer concentration Temperature Viscosity Capillary surface Field strength Organic modifiers Cellulose polymers Surfactants In this list, the only factor not under direct experimental control is the cap- illary surface. This single factor is often implicated as the cause for migration time variation in HPCE. It is important to ensure that the capillary surface is properly reconditioned after each run to maintain a reproducible surface. Coated capillaries that suppress the EOF are useful here, as long as the coating is sta- ble. Some new reagents^ that form a dynamic surface coating show great promise for stabilizing the capillary surface (Section 3.3). For some modes of HPCE, it is advantageous to suppress the FOE Capillary isoelectric focusing (CIEF) and capillary isotachophoresis (CITP) separations are usually performed under conditions of very low or carefully controlled EOF Additives such as 0.5% hydroxypropylmethyl cellulose are effective in sup- pressing the EOF, particularly in conjunction with a coated capillary (22). Cationic surfactants such as cetyltrimethylammonium bromide can actually reverse the direction of electroosmotic flow (14). This can be employed to pre- vent proteins from sticking to the capillary wall (23, 24). While complete sup- pression of the EOF is unnecessary for most applications, control is critical to obtain reproducible migration times and resolution. ^CElixir, Scientific Resources, Inc., Eatontown, NJ.
    • 2.4 Efficiency 3 9 2.4 EFFICIENCY The high efficiency of HPCE is a consequence of several unrelated factors: 1. A stationary phase is not required for HPCE. The primary cause of band broadening in LC is resistance to mass transfer between the stationary and mobile phases. This mass transfer problem is illustrated in Figure 2.10. When a solute is in the mobile phase, its linear velocity is determined by the linear velocity of the mobile phase. When attached to the stationary phase, the linear velocity becomes zero. The solute is not of a single velocity as it moves down the chro- matographic tube. Whenever differing velocities occur during a separation, band broadening will occur. Minimizing the particle size of the packing improves but does not eliminate this problem. Thus, the parameter that results in separation also causes band broadening. The greater the retention, the greater the prob- lem—as evidenced by broadened peaks as retention time increases. For most modes of HPCE (except CEC), this dispersion mechanism does not operate. Similarly, other HPLC dispersion mechanisms such as eddy diffusion and stag- nant mobile phase are unimportant in HPCE. 2. In pressure-driven systems such as LC, the frictional forces of the mobile phase interacting at the walls of the tubing result in radial velocity gradients throughout the tube. As a result, the fluid velocity is greatest at the middle of the tube and approaches zero near the walls (Figure 2.11). This is known as laminar or parabolic flow. These frictional forces, together with the chromato- graphic packing, result in a substantial pressure drop across the column. In electrically driven systems, the EOF is generated uniformly down the entire length of the capillary. There is no pressure drop in HPCE, and the radial flow profile is uniform across the capillary except very close to the walls, where the flow rate approaches zero (Figure 2.11). FIGURE 2.10 The mass transport problem in HPLC.
    • 40 Chapter 2 Capillary Zone Electrophoresis Jorgenson and Lukacs derived the efficiency of the electrophoretic system from basic principles (25-27) using the assumption that diffusion is the only source of band broadening. Other sources of dispersion—including Joule heat- ing (Section 2.6), capillary wall binding (Section 3.5), injection (Section 9.1), detection (Section 9.5), and electromigration dispersion (Section 2.13)—lead to fewer theoretical plates than the simple theory predicts. The migration velocity for a solute is V = luE = HV (2.11) where // = the mobility, E = field strength, V = voltage, and L = capillary length. The time t for a solute to migrate the length L of the capillary is V fiV (2.12) ELECTROOSMOTIC FLOW HYDRODYNAMIC FLOW FIGURE 2.11 Capillary flow profiles resulting from electroosmotic and hydrodynamic flow.
    • 2.5 Resolution 41 Diffusion in liquids that leads to broadening of an initially sharp band is described by the Einstein equation (yl = 2Dt = =^^, (2.13) where D = the diffusion coefficient of the individual solute. The number of the- oretical plates N is given by N = — . (2.14) Substituting Eq. (2.11) into Eq. (2.12) gives an expression for the number of theoretical plates: N = ^ . (2.15) 2D Some important generalizations can be made from this expression: 1. The use of high voltage gives the greatest number of theoretical plates, since the separation proceeds rapidly, minimizing the effect of diffusion. This holds true up to the point where heat dissipation is inadequate (Section 2.6). 2. Highly mobile solutes produce high plate counts, because their rapid velocity through the capillary minimizes the time for diffusion. 3. Solutes with low diffusion coefficients give high efficiency due to slow diffusional band broadening. Points 2 and 3 appear contradictory. This is clarified by Figure 2.12 and sup- plemented with some calculations in Table 2.2. Because of the indirect but inverse relationship between mobility and diffusion, high-efficiency separations occur across a wide range of molecular weights. HPCE can yield high-efficiency separations for both large and small mole- cules. The greatest number of theoretical plates is found in capillary gel elec- trophoresis (CGE). The use of an anticonvective gel matrix furthers the advantages of HPCE. The combination of HPCE in the gel or polymer network format (Chapter 6) can yield millions of theoretical plates. 2.5 RESOLUTION While high efficiency is important, resolution is the key for all forms of sepa- ration. In a high-efficiency system, inadequate resolution may result in a single very sharp peak.
    • 42 Chapter 2 Capillary Zone Electrophoresis DIFFUSION RAPID SLOW MOBILITY HIGH LOW SMALL MOLECULES LARGE MOLECULES FIGURE 2.12 Diffusion and mobihty of small and large molecules. The resolution (R) between two solutes is defined as R. = 1 AAI^PVN 4 Mep + Meo (2.16) where A^ is the difference in mobility between two solutes, /i^^ is the average mobility of the two solutes, and N is the number of theoretical plates. Substi- tuting the plate count equation (Eq. (2.15) and V = EL) yields (25) R, = O.UlAfl^ EL (/^ep + I^J^n (2.17) This expression suggests that increasing the voltage is not very effective in improving resolution, since that parameter falls inside of the square root of the resolution equation. A doubling of voltage results in only a 41% improvement in resolution. The production of heat quickly limits this Table 2.2 Calculated Theoretical Plates for a Small and Large Molecule Solute Horse heart myoglobin Quinine sulfate MW 13,900 747 Mobility (10-^ cmW-s) 0.65 4 Diffusion Coefficient (10-^cmVs) 1 7 N 975,000 857,000
    • 2.6 Joule Heating 43 approach. Another means of improving resolution as predicted by Eq. (2.17) is to adjust the EOF. Akhough this also falls under the square root sign of the resolution equation, this technique can be quite effective. There are three cat- egories in this regard: 1. Both electrophoresis and electroosmosis are in the same direction. This normally occurs when cations are being separated. In this case, decreas- ing the EOF will enhance resolution at the expense of run time. Dou- bling the run time produces a 41% improvement in resolution. 2. Electrophoresis and electroosmosis are in opposite directions. This occurs on bare silica capillaries when anions are separated. Decreasing the EOF will enhance run time at the expense of resolution, and vice versa. 3. Electrophoresis and electroosmosis are equal but in opposite directions. Here the resolution is infinite, but so is the separation time. However, this concept was used to generate ultrahigh theoretical plate numbers (28). It is clear that improvements in resolution are best addressed by adjustments to AjUgp, the difference in mobility between the two most closely eluting solutes in a separation. Since A/i^p falls outside of the square root sign of the resolution equation, the improvement in resolution is directly proportional to the change in mobilities. This subject forms the basis for many of the chapters in this book. 2.6 JOULE HEATING The conduction of electric current through an electrolytic solution generates heat via frictional collisions between migrating ions and buffer molecules. Since high field strengths are employed in HPCE, ohmic orJoule heating can be sub- stantial. There are two problems that can result from Joule heating: 1. Temperature changes due to ineffective heat dissipation 2. Development of thermal gradients across the capillary If heat is not dissipated at a rate equal to its production, the temperature inside the capillary will rise and eventually the buffer solution will outgas. Even a small bubble inside of the capillary disrupts the electrical circuit. At moder- ate field strengths, outgassing is not usually a problem, even for capillaries that are passively cooled. The rate of heat production inside the capillary can be estimated by ^ = - ^ , (2.18) dT LA where L = capillary length and A = the cross-sectional area. Rearranging this equation using J = V/R, where the resistance R = L/kA and k = the conductivity.
    • 44 Chapter 2 Capillary Zone Electrophoresis dT kV' (2.19) The amount of heat that must be removed is proportional to the conductivity of the buffer, as well as the square of the field strength. Lacking catastrophic failure (bubble formation), the problem of thermal gra- dients across the capillary can result in substantial band broadening (29-31). This problem is illustrated in Figure 2.13. The second law of thermodynamics states heat flows from warmer to cooler bodies. In HPCE, the center of the cap- illary is hotter than the periphery. Since the viscosity of most fluids decreases with increasing temperature, Eq. (2.4) and (2.8) predict that both mobility and EOF increase as the temperature rises. This situation becomes similar to laminar flow where the electrophoretic or electroosmotic velocity at the center of the capillary is greater than the velocity near the walls of the capillary. The temperature differential of the buffer between the middle and the wall of the capillary can be estimated from AT = 0.24 4K (2.20) where W = power, r = capillary radius, and K = thermal conductivity of the buffer, capillary wall, and polyimide cladding. A 2-mm-i.d. capillary filled with 20 mM CAPS buffer draws 18 rtiA of current at 30 ky giving a AT of 75°C. A 50-|lm-i.d. capillary filled with the same buffer draws only 12 |LIA of current, yielding a AT of 50 m°C. Since the thermal gradient is proportional to the square of the capillary radius, the use of narrow capillaries facilitates high resolution. On the other hand, the use of dilute buffers or isoelectric buffers (32) permits the use of wider bore capillaries, but the loading capacity of the separation is reduced. ep rAT FIGURE 2.13 Impact of the radial temperature gradient on electrophoretic and electroosmotic flow.
    • 2.6 Joule Heating 45 The requirement for narrow-bore capillaries comes with a price due to the short optical path length. If a solution is injected equivalent to 1% of the capil- lary volume of a 50 cm x 50 |im i.d. capillary, the injection size is 9.8 nL. This small-volume injection coupled to a 50-|im optical path length provides for con- centration limits of detection (CLOD) that are about 50 times poorer than by LC. Fortunately, through the use of stacking procedures (33) and extended path length capillaries (34), this gap has been narrowed considerably The compromise between sensitivity and resolution is illustrated in Figures 2.14 and 2.15. Note in particular the cluster of peaks centered at a migration time of 31 min (26 min in Figure 2.15) in Figure 2.14. With the 50-|im-i.d. cap- illary, none of these peaks are baseline-resolved, but there is virtually no noise in the electropherogram. Separation of the same sample in a 25-|im-i.d. capil- lary (Figure 2.15) presents a different picture. The peaks are nearly baseline- resolved, but there is substantial noise in the output. This presents one of several compromises that must be made in HPCE. In this case, sensitivity and resolu- tion are competing analytical goals. 0.300-! 0.262H 0.225H 0. I87H 0. 150H 0. uaH 0.075H 0.037H 0.00OH MJ WAAAJ L io —J— 15 20 —~r-—1—- 25 30 MINUTES 3S 40 " "1— 45 •'"••'" ! " " • " 50 '" 1 55 FIGURE 2.14 Separation of heroin impurities by MECC on a 50-|lm-i.d. capillary. Buffer: 85 mM SDS, 8.5 mM borate, 8.5 mM phosphate, 15% acetonitrile, pH 8.5; capillary: 50 cm (length to detec- tor) X 50 (Xm i.d.; voltage: 30 kV; temperature: 50°C; detection: UV, 210 nm. Reprinted with per- mission from Anal. Chem., 63, 823 (1991), copyright © 1991 Am. Chem. Soc.
    • 46 Chapter 2 Capillary Zone Electrophoresis Even these electropherograms must be carefully interpreted. In both cases, the injection time was kept constant at 1 s. This means that the amount of mate- rial injected in the 25-|Ltm-i.d. capillary was a factor of four lower relative to the 50-|Llm-i.d. tube (Section 8.1). This contributes to the decreased signal-to-noise ratio observed when using the 25-|lm-i.d. capillary. The problem of Joule heating depends on the capillary diameter, the field strength, and the buffer concentration. Recalling Figure 2.9 (50-|Lim-i.d. capillary), there was a slight increase in |Lieo as the field strength was increased. Figure 2.16 contains data from the same experiments, except a 100-|Lim-i.d. capillary is used. A marked departure from linearity is found at the higher buffer concentrations. Higher concentration buffers are more conductive, draw higher currents, and produce more heat than more dilute solutions. In the 100-|im-i.d. capillary, this heat is not properly dissipated. As a result, the internal temperature rises, reduc- ing the viscosity of the buffer. Since Eq. (2.8), the basic expression for elec- troosmotic velocity, contains a viscosity parameter in the denominator, Vgo increases with decreasing buffer viscosity. Because the buffer viscosity depends on temperature, the capillary heat removal system plays an important role in deciding the maximum field strength, buffer concentration, and capillary diam- 0.080-1 0.07CH 0.060H 0. 050H 0. 040-H 0.030H 0. 020H 0. oiCH 0. GOOH N'wWW ^IKJMM ] 12 I 16 1 1 20 24 MINUTES 1 28 1 32 1 36 1" 40 FIGURE 2.15 Separation of heroin impurities by MECC on a 25-fxm-i.d. Conditions as per Fig- ure 2.14 except for capillary diameter. Reprinted with permission from Anal. Chem., 63, 823 (1991), copyright © 1991 Am. Chem. Soc.
    • 2.7 Optimizing the Voltage and Temperature 11 5 9 u. ^ o E7 to ' o j>5 47 50 100 150 E (V/cm) 200 250 FIGURE 2.16 Effect of buffer concentration and field strength (E, V/cm) on the electroosmotic flow in a 100-|lm-i.d. capillary. Buffer: phosphate at a concentration of (a) 10 mM; (b) 20 mM; (c) 50 mM. Redrawn with permission from J. Chromatogr., 516, 223 (1990), copyright © 1990 Elsevier Science Publishers. eter that can be successfully employed. Insufficient heat removal begins a vicious cycle leading to viscosity reduction, greater current draw, and higher temperature, further reducing the viscosity. 2.7 OPTIMIZING THE VOLTAGE AND TEMPERATURE A. OHM'S LAW PLOTS A means of optimizing the voltage and/or the temperature despite the buffer concentration and capillary cooling system is very desirable. An Ohm's law plot provides this tool with very little experimental work (35, 36). Simply fill the capillary with buffer, set the temperature, vary the voltage, record the current, and plot the results.
    • 48 Chapter 2 Capillary Zone Electrophoresis Some Ohm's law plots are shown in Figures 2.17 and 2.18 for an air-cooled and water-cooled temperature control system, respectively. Whenever the graph shows a positive deviation from linearity, the heat removal capacity of the system is being exceeded. Operating on the linear portion of the curve will generally yield the high- est number of theoretical plates. As a rule of thumb, it is best to keep operating currents below 100 joA. Often, separations are run in the nonlinear section to opti- mize speed at the expense of plates, but it is not wise to push things too far. Lowering the temperature below ambient can be used to extend the linear range of the Ohm's law plot. This is useful when high-ionic-strength buffers are < UJ O 100 80 60 40 20 A ^ •BV • • • " • .c •V *>' ' XT ^ • ^ 0 V • ^ D X T . ^ D •^ 0 • = - • ^ ^ D V ^- u" ¥ ^ D I ^^o° 1 ^ ^t°^¥ ^0° ¥^^D l±lll 1 H _— 1- 10 20 VOLTAGE (kV) 30 FIGURE 2.17 Ohm's law plots for capillary temperature control by air circulation. (A) no con- trol; (B) 25°C; (C) 10°C; (D) 4°C. Redrawn with permission from J. High Res. Chromatogr., 14, 200 (1991), copyright © 1991 Dr. Alfred Heuthig Publishers.
    • 2.7 Optimizing the Voltage and Temperature 49 1 LU OL O 100 80 60 40 20 A ' 1 "V • • B • V • • • V • • ^ C A 0 ^ • ^ 0 • ^ 0 -^ A „ « • A ° X -6. a • -<^ 0 • ^ 0 • ^ 0 • ^ 0 ,^^t°• ^ a * i ^ a «ELf 1 1 I — 10 20 VOLTAGE (kV) 30 FIGURE 2.18 Ohm's law plots for capillary temperature control by water circulation. (A) no con- trol; (B) 25°C; (C) 10°C; (D) 4°C. Redrawn with permission from J. High Res. Chromatogr., 14, 200 (1991), copyright © 1991 Dr. Alfred Heuthig Publishers. necessary. These concentrated buffers are particularly useful in microprepara- tive CE (Section 9.10), increasing the linear dynamic range (Section 10.4) and suppressing wall effects (Section 3.3). Increasing the temperature can also be employed to speed the separation, since both v, due to the decreased viscosity of the buffer medium For various instruments the Ohm's law plot is an effective means of evaluat- ing the efficiency of their capillary cooling systems. Fluid-cooled systems are and Vep increase about 2%/K
    • 5 0 Chapter 2 Capillary Zone Electrophoresis generally more effective than air-cooled systems, since the heat capacity of most fluids exceeds that of air. B. CONSTANT VOLTAGE OR CONSTANT CURRENT? Power can be applied to the system in one of two ways. The voltage can be fixed, allowing the current to float based on the resistance of the buffer. Alternatively the current can be fixed. Most published work in HPCE is in the constant-voltage mode. There has been one report that found constant current more reproducible than constant voltage (37). Until this is better understood, both modes should be studied during methods development for CZE, MECC, and CGE separations. CITP is typically performed in the constant-current mode, or else separation time becomes long. CIEF may also benefit from the constant-current mode as well, although there is no evidence published to that effect. 2.8 CAPILLARY DIAMETER AND BUFFER IONIC STRENGTH Some very subtle effects due to Joule heating can occur when comparing sepa- rations run on capillaries with different inner diameters, or even the same cap- illaries run on various instruments with different capillary cooling systems. Some of these issues are illustrated in Figures 2.19 and 2.20. The ionic strength of the buffer influences not only the EOF and jil^^, but indirectly the viscosity of the medium. More concentrated buffers have greater conductivity and generate more heat when the voltage is applied. The viscos- ity depends on the temperature, and so there is also a dependence on the cap- illary diameter. This is shown for a series of runs in 50- and 75-|Llm-i.d. capillaries (38). With the 50-|lm capillary, the migration times lengthen as the buffer con- centration is increased. Ions in solution are always surrounded by a double layer of ions of the opposite charge. The migration of these counterions is in a direction opposite to that of the solute (Figure 2.21); hence, increasing the concentration of the buffer reduces the mobility of the solute, due to increased drag caused by countermigration of the more densely packed counterions. With the 75-|Lim capillary, the solute migration times first increase as expected, but then they decrease. This decrease is a consequence of the sig- nificant effects of Joule heating at higher buffer concentrations. Note as well the impact of buffer concentration on peak width. Sharper peak widths at the higher buffer concentrations are due to stacking (Section 8.6). The
    • 2.8 Capillary Diameter and Buffer Ionic Strength 51 .32 50nm Capillary 0200M ^'ULlJlJLJIjLii^ liujLi 0.075M 0.050M O.O^M 8 10 12 14 16 TIME Crnin,) FIGURE 2.19 Effect of buffer ionic strength on peptide separations in a 50-|im-i.d. capillary. Buffers: 0.025-0.200 M phosphate, pH 2.44; voltage: 30 kV; capillary: 50 cm to detector x 50 |Lim i.d.; key: (1) bradykinin; (2) angiotensin 11; (3) TRH; (4) LRHR; (5) bombesin; (6) leucine enkephalin; (7) methio- nine enkephalin; (8) oxytocin; (9) dynorphin. Reprinted with permission from Techniques in Protein Chemistry 11, 1991, Academic Press, 3-19, copyright © 1991 Academic Press. Stacking effect is more evident when the 75-|im-i.d. capillary is used. Injec- tion time was held constant for this comparison; thus, a larger injection was made on the latter capillary. Stacking is not very noticeable when small injections are made.
    • 52 Chapter 2 Capillary Zone Electrophoresis .45 7S[im Capillary 2B 0.125M .27 BS I 11 I I 11^ UuulJJLIL .18H lOOM JIU I . II I 0.075U ILJJIUL "ililiiL!050M 1 ? 3.4 6 * UMJC 02511 6 8 10 12 14 16 TIME (min.) FIGURE 2.20 Effect of buffer ionic strength on peptide separations in a 75-(Xm-i.d. capillary. Con- ditions as per Figure 2.19 except for capillary diameter. Reprinted with permission from Tech- niques in Protein Chemistry U, 1991, Academic Press, 3-19, copyright © 1991 Academic Press. 2.9 OPTIMIZING THE CAPILLARY LENGTH The efficiency of the separation (theoretical plates) is directly proportional to the capillary length (38), provided the field strength is kept constant. The
    • 2.9 Optimizing the Capillary Length 53 FIGURE 2.21 Countermigration of a solute against its ionic atmosphere. limitation here is available voltage. Most instruments produce a maximum of 30 kV. Once the capillary length reaches a certain point, the field strength must be reduced and no further gains in efficiency are realized (6). Based on Eq. (2.16), the electrophoretic resolution depends on the square root of the number of theoretical plates and, thus, on the square root of the capillary length (38). Increasing the capillary length beyond the limits imposed by the voltage maximum lengthens the separation time without any substantial ben- efits. These effects are illustrated in Figure 2.22, where the number of theo- retical plates is linear with the capillary length until 30 kV is reached. Note that the resolution increase is proportional to the square root of the number of theoretical plates. Most chemists overly rely on the length of the capillary to perform their separations. This results in lengthy separations. Since diffusion is time related, the sensitivity of the method declines as well. If more time is spent optimizing the separation chemistry, shorter capillaries can be employed, with obvious benefits.
    • 5 4 Chapter 2 Capillary Zone Electrophoresis A A A UUU 800 600 400 200 Theoretical Plates (1 Jf OOO's) - ^ x'^ ..4^'^'^'" ... i ^p^zzz ! . x:— 1 Resolution 4-„™ i ji * "i i , 1 1.5 0.6 20 30 40 50 60 70 80 90 100 Length to Detector (cm) FIGURE 2.22 Impact of capillary length on the number of theoretical plates and resolution. 2.10 BUFFERS A. THE ROLE OF THE BUFFER A wide variety of buffers (Table 2.3) can be employed in CZE. The buffer is fre- quently called the background or carrier electrolyte. These terms are used inter- changeably throughout this book. Other terms frequently employed are co-ion and counterion. A co-ion is a buffer ion of like charge compared with the solute, a counterion a buffer ion of opposite charge. The purpose of the buffer is to provide precise pH control of the carrier elec- trolyte. This is important, since both mobility and electroendoosmosis are sen- sitive to pH changes. The buffer may also provide the ionic strength necessary for electrical continuity. Usual buffer concentrations range from 10 to 100 mM, though there are many exceptions. Dilute buffers provide the fastest separations, but the sample loading capacity is reduced. Buffer solutions should resist pH change upon dilution and addition of small amounts of acids and bases. Concentrated buffer solutions do this well, but they
    • 2.10 Buffers 55 Table 2.3 Buffers for HPCE BUFFER ZWITTERIONIC BUFFERS Aspartate j3-Alanine )8-Alanine Histidine MES ACES MOPSO BES MOPS TES DIPSO HEPES TAPSO HEPPSO EPPS POPSO DEB Tricine Glygly Bicine TAPS CHES CAPS pKa L99 3.55 10.24 9.34 6.13 6.75 6.79 7.16 7.2 7.45 7.5 7.51 7.58 7.9 7.9 7.9 7.91 8.05 8.2 8.25 8.4 9.55 10.4 CONVENTIONAL (Nonzwitterionic) BUFFERS Citrate Formate Acetate Lactate Phosphate Borate Creatinine 3.12, 3.75 4.76 3.85 2.14, 9.14 4.89 4.76, 6.40 7.10, 13.3 MobiUty^ +31.6 +36.7 -30.8 +29.6 -26.8 -31.3 -23.8 -24.0 -24.4 -22.4 -21.8 -22.0 -26.2 -28.7 (low pKg value) -56.6 -42.4 -35.8 -35.1 (low pKg value) -40.0 (estimate) +33.1 Data from J. Chromatogr., 1991; 545:391. ^Effective mobility for fully ionized buffers at 25°C (10~^ cmWs). are often too conductive for use in HPCE. The buffering capacity of a weak acid or weak base is limited to ±1 pH unit of its pK^. Operation outside of that range requires frequent buffer replacement to avoid pH changes (39). The buffer
    • 56 Chapter 2 Capillary Zone Electrophoresis should have a low temperature coefficient and not absorb significantly in the UV region, where detection occurs. Table 2.4 presents some of these data for a few common buffers. B. BUFFER SELECTION The selection of the appropriate buffer need not be difficult. For acids, start with borate buffer, pH 9.3, and for bases, phosphate buffer pH 2.5. These two buffer systems along with the appropriate additives will work well for most applica- tions. If bases are not soluble in phosphate buffer, acetate buffer pH 4 may be more effective. Higher pH values may be required for basic proteins to avoid adherence to the capillary wall. Phosphate buffers are often used for low-pH protein separations (39-41). McCormick (41) proved that phosphate ions bind to the capillary wall, reduc- ing the impact of protein binding to anionic silanol groups. Prewashing the cap- illary with pH 2.5 phosphate buffer was reported to reduce protein binding as well (42). Capillaries aggressively pretreated with phosphate buffer have also been useful in this regard (43). Borate buffers are useful for separating carbohydrates (44-49) and cate- cholamines (50, 51) because of specific complexation chemistry. Unless such specific interactions are identified, buffer selection based on the desired pH is usually satisfactory. Borate buffers are used to control pH in the range 8.3-10.3. Phosphate and borate buffers have adequate buffer capacity over a wide pH range and are useful as general purpose buffers. They may not be useful for cer- Table 2.4 Characteristics of Some Buffer Solutions Buffer 50 mM KH2C6H5O7 (citrate) 25 mM KH2PO4, Na2HP04 8.7 mM KH2PO4+ 3.0 mM Na2HP04 10 mM Na2B407 (borate) 50 mM Tris-HCl; 16.7 mM Trls pH at 25°C 3.776 6.865 7.413 9.180 7.382 Dilution Value^ +0.02 +0.080 +0.07 +0.01 na Buffer Capacity^ 0.034 0.029 0.16 0.020 na Temperature Coefficient^^ -0.0022 -0.0028 -0.0028 -0.0082 -0.026 ^pH change upon 50% dilution. ^pH change upon mixing 1 L of buffer with 1 gram equivalent of strong acid or base. ^Change in pH per °C. Data from pH Measurements, 1978, Academic Press.
    • 2.10 Buffers 5 7 tain protein separations, particularly if biological activity must be maintained. These buffers also lack buffer capacity around pH 4, where acetate is quite good. The selection of the buffer cation also plays a role in buffer conductivity (4). The correlation of the atomic radii and mobility was discussed in Section 2.1. In this regard, lithium and sodium salts are best used, since they con- tribute least to buffer conductivity. Dual buffering systems with lower mobil- ity counterions (Tris-phosphate, Tris-borate, or Tris-Tricine) are used to reduce heating problems in the slab gel and can also be used in HPCE. Buffers used in the slab gel must be unreactive with Commassie or silver stain. This is not a guarantee that they will not absorb in the UV. The UV spectrum of a buffer should be checked prior to use to avoid detection problems. In capil- lary isoelectric focusing this problem is more acute, as ampholytes can absorb even at 280 nm. Aromatic buffer constituents such as phthalates should be avoided because of their strong UV absorption characteristics, unless indirect detection is planned (Section 3.6). Strongly absorbing components such as carrier ampholytes (Chapter 5) prevent the use of the low-UV region for detection. Zwitterionic buffers such as bicine, Tricine, CAPS, MES, and Tris are also used, particularly for protein and peptide separations. They are all amines, and some buffers such as Mes, Tricine, and glycylglycine bind calcium, manganese, copper, and magnesium ions. PIPES, HEPES, and Tris do not bind any of these metals, whereas BES binds only copper (52). Metal binding may be useful, or it may interfere with subsequent separations. The advantage of the zwitterionic buffer is low conductivity when the buffer is adjusted to its pi. There is little buffer capacity when pK^ and pi are separated by more than 2 pH units. When the pi and pK^ are close together, the buffer is known as an isoelectric buffer (32). The advantage here is low current draw and reduced Joule heating, allowing higher buffer concentrations to be used. However, isoelectric buffers are poor stacking buffers because of their extremely low conductivity. Table 2.3 provides data describing the mobility of the fully ionized buffer component. Mobility matching between the buffer and solute is used to improve the peak symmetry when the solute concentration is high relative to the buffer concentration (53). This problem, known as electromigration dispersion or sim- ply electrodispersion (Section 2.14), is particularly troublesome when indirect detection is employed, because the buffer concentration must be low. A soft- ware program (Buffer Workshop, Scientific Resources Inc., Eastontown, NJ) is useful to help calculate buffer mobilities at any pH. C. BUFFER PREPARATION Titration of a buffer to the appropriate pH has some operational subtleties. In the trivial but ideal case, equimolar solutions of two different salts of the iden- tical anion are blended to the appropriate pH. For example, to prepare a 50 mM,
    • 5 8 Chapter 2 Capillary Zone Electrophoresis pH 7 phosphate buffer, titrate a 50 mM disodium salt with 50 mM phosphoric acid. Under all possibilities, the final phosphate concentration must be 50 mM and the ionic strength must be consistent. For very critical separations, it is best to prepare buffers in large batches to reduce batch-to-batch variation. When this is done, pay attention to buffer stability and the potential for microbial growth. In other cases, the buffer is often titrated with acid or base to adjust the pH. Under these conditions, both pH and ionic strength are being adjusted (54). Unusual effects, such as the reduction of EOF with increasing pH, have been observed that are attributable to this problem. Selecting a buffer that requires no titration or only a minor titration will minimize these ionic strength effects. In any event, it is important to exactly specify the buffer preparation in method- ology. All buffers should be filtered before use through 0.21-|Llm filters. Prepared buffers are available from many instrument manufacturers and sup- pliers. These solutions are manufactured in large batches, prefiltered, and put through quality control. Common recipes containing phosphate and borate along with specialty preparations for application-based methods are readily available. For small laboratories without water purification systems, water for HPCE can be purchased as well. Since reagent usage in capillary electrophore- sis is minimal, the costs are low 2.11 TEMPERATURE EFFECTS The impact of temperature on a series of peptides is illustrated in Figure 2.23. As the temperature is increased, the migration time always decreases because of the reduced viscosity of the BGE. The current increases as well due to this effect. The viscosity is, of course, inversely proportional to the temperature. There are no significant changes in selectivity as the temperature is increased for these peptide separations. This will not always hold true, particularly when secondary equilibrium is employed. When proteins are being separated, tem- perature can have profound effects on the separation if unfolding occurs. This is illustrated in Figure 2.24 for a-lactoglobulin (55). At 20°C, a single peak is found at 4.5 min. As the temperature is increased, the band broadens until, finally, a sharp peak is found when the temperature reaches 50°C. The peak at 20°C represents the native form of the protein. At the intermediate temperature, multiple forms of the protein are found as unfolding begins. At 50°C, a peak representing the unfolded protein is found. Note that the migration times always decrease as the temperature is raised due to the aforementioned viscosity effects. Elevated temperatures are frequently used during methods development to speed separations without having to cut the capillary. When secondary equi- librium is employed, particularly for chiral separations, subambient tempera- tures are often used.
    • 59 -jL. Jl—LJuL....li I 15 25 35^ 45 55 Temperatiire (C) 4 6 8 10 n 14 " 15 25 35 45 55 Time ( Minutes ) Temperature (C) FIGURE 2.23 Effect of temperature on time, current, and viscosity. Buffer: 50 mM phosphate, pH 2.5; voltage: 20 kV; capillary: 50 cm x 75 )im i.d. Reprinted with permission from Techniques in Protein Chemistry U, 1991, Academic Press, 3-19, copyright © 1991 Academic Press. 2.12 BUFFER ADDITIVES Reagents are often added to the buffer solution for reasons other than control- hng pH. Known as buffer additives, these materials are used for several functions: 1. To modify mobility (secondary equilibrum) 2. To modify electroosmotic flow 3. To prevent solutes from adhering to the capillary wall 4. To maintain solubility Table 2.5 lists of some of the reagents used for these purposes. These will be discussed in further detail throughout this text.
    • 60 Chapter 2 Capillary Zone Electrophoresis 1129 mt W m ^ m m m 1 L L-}l ' ' ^•'•••^'f"*"'"'*"""'^''"'*'"^'"lB"''l''*'T"""*'^*^"*i'"T"t''T™"f¥'''^P'^*^ i^ , 1 0 t 2 ^ 3 . * 5 « Tmetmin) FIGURE 2.24 Influence of temperature on the electrophoretic behavior of cc-lactoglobulin. BGE: 100 mM borate, pH 8.3; voltage: 350 V/cm; capillary: 50 cm bare siUca. Reprinted with permis- sion from Anal. Chan., 63, 1346 (1991), copyright © 1991 Am. Chem. Soc. 2.13 CAPILLARIES A. FUSED SILICA Fused-silica, polyimide-coated capillaries, similar to those used in capillary gas chromatography, are the material of choice for HPCE (Figure 2.25). Internal diameters ranging from 25 to 100 |lm are usually employed. Capillaries cover- ing the range of 2- to 700 |Lim i.d. are commercially available.^ Between 10- and 75-|im i.d., the i.d. tolerance is 1 |Lim. Fused silica is a good (though not ideal) material due to its UV transparency, durability (when polyimide coated), and zeta potential. The variation of the surface charge along with solute-capillary wall interaction are the most important limitations of the material. Functional- ized capillaries and buffer additives are used to overcome this limitation. Gel- filled capillaries (Chapter 6) for CGE are also commercially available. Most instrument manufacturers employ a cartridge to contain the capillary This allows for more optimal integration with the capillary cooling system. The ^Polymicro Technologies, Phoenix, AZ 85017.
    • 2.13 Capillaries 61 Table 2.5 Buffer Additives Purpose Reagent Mechanism To modify mobility To modify EOF To reduce wall effects To maintain solubility Transition metals Cyclodextrins Surfactants Organic solvents Sulfonic acids Quaternary amines Borate Chelating agents Crown ethers Macrocyclic antibiotics Calixarenes Dendrimers Cationic surfactant Organic solvents Linear polymers Zwitterionic surfactant Cationic surfactant Polyamines Linear polymers Zwitterionic surfactant Organic solvents Urea Complex formation Inclusion comple Micelle interaction Solvation Ion-pair formation Ion-pair formation Complex with carbohydrates, diols Complex formation with metals Inclusion complex Inclusion complex Inclusion complex Inclusion complex Dynamic coating, EOF reversal Affects viscosity Dynamic coating Dynamic coating Dynamic coating, EOF reversal Covers silanols Dynamic coating Dynamic coating Hydrophobicity "Iceberg effect" alignment between the capillary detection window and the detector optics is simple when a cartridge is used. Capillaries can be purchased from the instrument manufacturers for $35-60 per capillary. The detection window is in place and the outlet side may be pre- measured for a particular instrument. Polyimide is removed at the inlet and out- let side to prevent shards of polyimide from clinging to the capillary opening. Alternatively, high-quality fused-silica capillaries can be purchased in bulk at a cost of $10-20 per meter depending on quantity. A new fused-silica capillary can be prepared and conditioned in half an hour with materials costs of under $5.00. At such a low cost, these home-cut capillaries are disposable items. Rather than attempt regeneration of a suspect capillary, it is wise to simply replace it. It is best to dedicate a capillary to a particular application.
    • 62 Chapter 2 Capillary Zone Electrophoresis SeOjttm Fused Silica Polyimide Coating 12/im 25-75/im FIGURE 2.25 Cross-sectional view of a fused-silica capillary. B. PREPARING A FUSED-SILICA CAPILLARY The procedure for preparing a bare silica capillary is given below. Only a ruler, a cutter (silicon wafer or ceramic cutter), a butane lighter, methanol, and a tis- sue are required. The method for introducing the detection window should not be used with gel-filled or surface-treated capillaries. L Nick the polyimide coating near the edge of the capillary as squarely as possible. Pull the capillary directly apart, making sure not to pull at too much of an angle. Measure from the cut end to the desired total length of the capillary (L^), and cut again. Observe the ends of the capillary under magnification to ensure that they are cut squarely. 2. Measure the separation length of the capillary (L^) and flame a length of about 2-3 mm with the butane lighter.^ Clean the burnt polyimide with a tissue moistened with methanol. The capillary can now be inserted into the instrument, taking care not to bend the now fragile 5Heat burns off the coating without making the glass brittle. Alternatively, concentrated sulfuric acid at 130°C will remove the coating in a few seconds. This method is required when gel-filled or functionalized capillaries are used.
    • 2.13 Capillaries 6 3 detection window.^ The ends of the capillary can be flamed as well to remove about 1 mm of coating. This prevents problems from shards of polyimide obstructing the inlet and outlet. Swelling of the polyimide due to interaction with BGE components is prevented as well. 3. Wash the capillary for 15 min each with 1 N sodium hydroxide, 0.1 N sodium hydroxide, and BGE. Change the detector-side reservoir to BGE. The system is ready to run. The base conditioning procedure is important to ensure the surface of the capillary is fully charged. For some methods, it is necessary to regenerate this surface with 0.1 N sodium hydroxide—in extreme cases, 1 N sodium hydrox- ide. This regeneration procedure is often necessary if migration times change on a regular basis. Regeneration may help if the zeta potential at the capillary wall is altered. Binding of solutes or sample matrix components may be the cause of this problem. When working at low pH, a wash with O.IN hydrochlo- ric acid is useful to reduce the EOF C. STORING A FUSED-SILICA CAPILLARY For overnight shutdown, simply leave BGE in the capillary and be sure that the capillary ends are immersed in BGE. For prolonged shutdown or when remov- ing the capillary from the system, all buffer materials must be removed from the capillary. Otherwise, the BGE will clog the capillary when evaporation occurs. 1. Rinse the capillary with water for several minutes. 2. Change both buffer reservoirs to distilled water. 3. Rinse for five minutes with distilled water. 4. Empty the appropriate buffer reservoir, and draw air through the capil- lary for five minutes. 5. Remove the capillary from the instrument. 6. For capillaries not part of a cartridge assembly, slide some 0.5- to 1-mm- i.d. Teflon tubing over the optical window and gently secure with tape or septa. Cleaning a capillary can be done offline using a simple 1-mL syringe and some polyethylene tubing. This is particularly advantageous during methods development, since instrument time is not wasted. Sleeve some tubing over the syringe needle and capillary. It is possible to flush water and then air through ^For those not wishing to prepare a detection window, a fluorocarbon-coated capillary (CElect- UVT) is available from Supelco, Bellefonte, PA. This capillary cannot be used in with liquid cool- ing systems containing fluorocarbons, since the coating will become brittle.
    • 6 4 Chapter 2 Capillary Zone Electrophoresis the capillary manually. A kit for conditioning CEC capillaries, available from Unimicro Technologies, can also be used on bare silica. D. COATED CAPILLARIES Coated capillaries are often used to prevent proteins from adhering to the cap- illary wall. They are also used to reduce the EOF if the application or mode of electrophoresis requires such a reduction. Hundreds of papers describing vari- ous coatings and coating procedures have appeared in the literature. As tradi- tional silane chemistry is used to prepare the coatings, most of these papers describe coatings that are not stable at alkaline pH. The advantage of the coated capillary for protein separations is that it is often possible to get a good separation without using additives to the background electrolyte. The disadvantages include cost and the aforementioned problems with capillary stability. Table 2.6 lists commercially available capillaries. The uses of some of these capillaries will be described in the appropriate sections of this book. When a capillary is purchased from a vendor, the polyamide at the point of detection is already removed. Should you need to remake a window, do not flame the capillary since that will destroy the inner coating. Instead, place a drop of concentrated sulfuric acid where the window is to be made. Then place the capillary a few inches above a butane lighter flame. The window will appear when the acid temperature reaches 130°C. Carefully rinse the acid off of the capillary and examine the window under magnification to determine clarity 2.14 SOURCES OF BAND BROADENING In Section 2.4, Jorgenson and Lukacs's model describing the efficiency of HPCE is described. This model assumes that diffusion is the only cause of band broad- ening. At low voltages, molecular diffusion is a leading cause of band broaden- ing. At higher voltages, the Joule heating problem causes parabolic flow. Adsorption of solutes at the wall also leads to dispersion, as does electromigra- tion dispersion (see below). Extracolumn processes such as injection and detec- tion can also lead to dispersion (Sections 8.1 and 9.5). The peak variance or dispersion can be expressed by ^ ' = ^ d i f f < j + < a l l + ^det + ^heat + ^ed > ( 2 - 2 1 ) where cTdiff, ofnj. ^ap. <^et> ^eat. ^^d (jJd are the respective variances due to diffusion, injection, capillary, detection. Joule heating, and electromigration
    • 2.14SourcesofBandBroadening65 O U ri f2 u CQ 00 «o u u s t3 > U^ O m Ut ,OLJ O O fi O 3X Cu m CO ^1—( O d 1 1 X p- 2 B o ^"^ ^-C 00 U-T ow to o u )-l t£i "B^ <u o O ON* X o ^ 32 ir5 h- o 3 S ^•5 60 t/^ W^ O<u #g r—1"^o>. dE CQ o o <en 71 00;3 u (S C Q> O Pu Wi 3 o C3 (/5 op 'o (/5 3 &4 <u CI. -S "w aPu to 3 H- <u ,g 'S> 2 p- c S 5 '>TT QJ 3 oQJ (/i 3 a. (U _C 'S o ei^ u u w 3'a < 13 a 'S o (1^ («c o CJ < Q 10 g "S 2 o^ (A) _c 'S 2 PM C 3 B I/) <zz PUeuJi <<< uuH Xo po << (7) CO 2< PQCQ c3 O u IS Z ooo ooo ^PL,^^^ >:wwww p.UUUU 'lO ;3 u .2 u u o o i-H1—1 CQCQ OQ X 1CQ Q •S 'S g fl. o o :3 E "S 2 <X) u o GH N U 'S o '2 'DO o PU M U to 3 'o s rt aCO o 3 3 o Cu CO W M U (/)3 3 a CS aCO <:CO 6o w u 7i w g Pu o o m w u (U 2 Pu pj- w u to w 2 PU X w u u u w (O <u 2PM (—1 P: w u (U g P- rM X w u w5--^ c:t3> <ZfS a f2u^ s3-2 -Tiu>> ci:£•u3i^op- U3.5^ t^IT!C 1—I^«5 •—tX>>1—t ^uo^ 00 C «^ o x:(U o 3"u CJ u 3 3 3 CO 00 u" u o XJ„ >>-002 XUUU CQ U X o^a. cSUXIPi CO
    • 66 Chapter 2 Capillary Zone Electrophoresis dispersion. Because of the additivity of the square of the variances, the greatest contributor to variance becomes the hmiting factor. The problem can best be articulated as follows. Since N = (2.22) a 1,000,000-plate separation on a 50-cm capillary gives G^ = 0.25 mm^. For a 100,000-plate separation, G^ = 2.5. Thus, it is reasonably simple to maintain the efficiency for a 100,000-plate separation, but quite difficult when the plate count approaches 1,000,000. Some of the key sources of dispersion along with their importance and rem- edy are given in Table 2.7. On-capillary dispersion comprises contributions from injection overload, hydrostatic flow (siphoning), diffusion, adsorption (wall effects), and Joule heating. Injection overload, electrodispersion, antistacking (high-ionic-strength sample), and hydrostatic flow (57) due to fluid imbalances are easily avoided. Siphoning is unimportant for small-diameter capillaries unless the height differential becomes extreme. The contribution from diffu- sion, expressed by Eq. (2.13), is directly proportional to the separation time. The faster the separation, the sharper the peak. The variance contribution from Joule heating has been extensively studied by Hjerten (58), Foret et al (59), Grushka et al (30), Knox (31), and Jones and Grushka (29). Grushka et al (30) concluded that temperature effects are neg- ligible in narrow-bore capillaries. Use of wide-bore capillaries is possible when Table 2.7 Sources of Band Broadening in HPCE Process Antistacking Adsorption on wall Detection window Diffusion Electrodispersion Injection size Joule heating Poorly cut capillary Siphoning Importance ++++ ++++ + +++ +++ +++++ ++ ++ + Solution Reduce injection size Increase buffer concentration Reduce ionic strength of sample Use coated capillary or buffer additive Reduce slit width if possible Reduce separation time Increase buffer concentration Reduce solute concentration Mobility match buffer to solute Reduce injection size Use stacking buffers Reduce voltage Ensure capillary is cut squarely Balance fluid level of reservoirs
    • 2.14 Sources of Band Broadening 67 low-conductivity buffers are used. The problem with low-conductivity buffers is decreased loading capacity and increased wall effects. Using Ohm's law plots (Section 2.7) helps ensure that Joule heating is not a significant cause of dis- persion. Operation at the voltage prescribed by the Ohms's law plot minimizes diffusion-related dispersion since the field strength is maximized as well. The mathematics for some of these sources of peak dispersion is covered in the individual sections along with more experimental detail. For a thorough review of this often complicated theory, the paper written by Gas et al. (60) should be consulted. Another form of band broadening is known as electromigration dispersion or simply electrodispersion. The appearance of triangular or saw-toothed peaks when the solute concentration is high is indicative of this phenomenon. This process, which is intrinsic to the electrophoretic process, may be observed whenever two conditions simultaneously occur: 1. The solute concentration approaches the concentration of the BGE co-ion. 2. The solute's mobility differs from the mobility of the BGE co-ion. To totally eliminate electrodispersion, the solute concentration must be at least be 50-fold lower than the BGE concentration or the mobilities of both solute and co-ion must closely match. In most cases, it is not possible to completely eliminate the effect; however, some electrodispersion is easily tolerable. Quan- titative analysis is not affected as long as sufficient resolution is designed into the separation, the integration parameters are properly set, and peak areas are employed. The dispersion problem only becomes excessive at the higher (rela- tive to BGE) solute concentrations (Section 10.4). Electrodispersion is usually observed when employing indirect detection for small ions. The nature of indirect detection (Section 3.6) limits the concentra- tion of the BGE. Furthermore, electrodispersion is diffusion mediated (see below), and small ions have very high diffusion coefficients. Other times, elec- trodispersion may appear at the higher end of a calibration curve (Section 10.4), during micropreparative separations, or on the major component of the sepa- ration when performing trace impurity determinations. If the major-component concentration is limited to 1 mg/mL and the buffer concentration is 50 mM, electrodispersion is seldom observed. Electrodispersion was originally reported by Mikkers et al. (61). The mech- anism for electrodispersion is described in Figure 2.26 for three conditions using cations as the solutes: (1) /LL^ > IX^GE^ 0-) Mc = MBGE. ^^^ O) Mc < MBGE. where /a is the symbol for mobility. We analyze the first case in detail. If a solute has a high mobility relative to the BGE, the electrical conductivity of the solute zone is relatively high. It follows that the resistance of the solute zone is low; therefore, the field strength expressed over the zone is low relative to the field over the BGE. As diffusion occurs over the left boundary, the field strength that the solute experiences increases. The resultant acceleration in migration velocity
    • 68 LOW FIELD Chapter 2 Capillary Zone Electrophoresis UNIFORM FIELD HIGH FIELD ®® ®® UNSTABLE BOUNDARY ®® DIFF. STABLE BOUNDARY STABLE BOUNDARY C<MBGE UNSTABLE BOUNDARY TIME FIGURE 2.26 Mechanism of electromigration dispersion. causes the ions in that portion of the zone to move ahead of the other solute ions. At the right-handed boundary, the same effect occurs, except the cations recombine or restack since they are migrating toward the cathode. In case 2, no such effects can occur—the field strengths are held constant over both the solute and the BGE, since their mobilities are equal. Similar arguments can be made for case 3. If the solute concentration is sufficiently low relative to the BGE, the impact of the solute on the field strength is negligible and symmetric peaks are obtained. Electrodispersion can be minimized by 1. Diluting the sample 2. Increasing the BGE concentration 3. Matching the mobility of the BGE co-ion to the solute Sample dilution is often not possible because of the concomitant loss of sen- sitivity It is possible to use dilution to reduce electrodispersion in conjunction with an extended path length flowcell. If there is sufficient sensitivity, sample dilution is the simplest means of reducing electrodispersion. Increasing the BGE concentration is not possible when employing indirect detection because of the reduction in sensitivity When direct detection is
    • References 69 employed, this technique works well up to the point at which Joule heating becomes a problem. In some cases, the capillary diameter can be reduced, thereby permitting the use of a highly concentrated BGE. Mobility matching is very effective when indirect detection is employed; however, it is not possible to mobility match the BGE to all solutes when simul- taneous separation of multiple ions is required. In this case, some of the peaks may be skewed while others are symmetric. Other advanced techniques have been proposed to simplify mobility matching (62, 63). Since electrodispersion is not usually a problem during the course of everyday HPCE, the reader should consult the references for more information. REFERENCES l.Macka, M., Andersson, P., Haddad, P. R. Changes in Electrolyte pH Due to Electrolysis during Capillary Zone Electrophoresis. Anal Chem., 1998; 70:743. 2. Zhu, T., Sun, Y., Zhang, C, Ling, D., Sun, Z. Variation of the pH of the Background Electrolyte as a Result of Electrolysis in Capillary Electrophoresis. J. High Res. Chromatogr., 1994; 17:563. 3.Bello, M. S. Electrolytic Modification of a Buffer during a Capillary Electrophoresis Run.J. Chro- matogr., A, 1996; 744:81. 4.Atamna, I. Z., Metral, C. J., Muschik, G. M., Issaq, H.J. Factors That Influence Mobility, Reso- lution and Selectivity in Capillary Zone Electrophoresis. II. The Role of the Buffer's Cation. J. Liq. Chromatogr, 1990; 13:2517. 5.Jennings, W, Analytical Gas Chromatography. 1987, Academic Press. 6.Lukacs, K. D., Jorgenson, J. W. Capillary Zone Electrophoresis: Effect of Physical Parameters on Separation Efficiency and Quantitation. HRC & CC, 1985; 8:407. 7.Saloman, K., Burgi, D. S., Helmer, J. C. Evaluation of Fundamental Properties of a Sihca Capil- lary Used for Capillary Electrophoresis. J. Chromatogr, 1991; 559:69. 8. van de Goor, T. A. A. M., Janssen, P S. L., van Nispen, J. W, van Zeeland, M.J. M., Everaerts, E M. Capillary Electrophoresis of Peptides. Analysis of Adrenocorticotropic Hormone-Related Fragments. J. Chromatogr, 1991; 545:379. 9.Tsuda, T., Nomura, K., Nakagawa, G. Separation of Organic and Metal Ions by High-Voltage Capillary Electrophoresis. J. Chromatogr, 1983; 264:385. lO.Lauer, H. H., McManigill, D. Capillary Zone Electrophoresis of Proteins in Untreated Fused Sil- ica Tubing. Anal. Chem., 1986; 58:166. 11. Walbroehl, Y.,Jorgenson, J. W. Capillary Zone Electrophoresis of Neutral Organic Molecules by Solvophobic Association with Tetraalkylammonium Ion. Anal. Chem., 1986; 58:479. 12.Ermakov, S. V, Capelli, L., Righetti, P. G. Method for Measuring Very Weak, Residual Elec- troosmotic Flow in Coated Capillaries. J. Chromatogr, A, 1996; 744:55. 13.Fujiwara, S., Honda, S. Determination of Cinnamic Acid and Its Analogues by Electrophoresis in a Fused Silica Capillary Tube. Anal. Chem., 1986; 58:1811. 14. Altria, K. D., Simpson, C. F. High Voltage Capillary Zone Electrophoresis: Operating Parameter Effects on Electroendosmotic Flows and Electrophoretic Mobilities. Chromatographia, 1987; 24:527. 15. Lambert, W. J., Middleton, D. L. pH Hystersis Effect with Silica Capillaries in Capillary Zone Electrophoresis. Anal. Chem., 1990; 62:1585. 16.Tsuda, T., Nomura, K., Nakagawa, G. Open-Tubular Microcapillary Liquid Chromatography with Electro-osmotic Flow Using a UV Detector. J. Chromatogr, 1982; 248:241. 17. VanOrman, B. B., Liversidge, G. G., Mclntire, G. L., Olefirowicz, T M., Ewing, A. G. Effects of Buffer Composition on Electroosmosis Flow in Capillary Electrophoresis.J. Microcolumn Sep., 1990; 2:176.
    • 7 0 Chapter 2 Capillary Zone Electrophoresis IS.Rasmussen, H. T., McNair, H. M. Influence of Buffer Concentration, Capillary Internal Diame- ter and Forced Convection on Resolution in Capillary Zone Electrophoresis. J. Chromatogr., 1990; 516:223. 19.Schwer, C, Kenndler, E. Electrophoresis in Fused-Silica Capillaries: The Influence of Organic Solvents on the Electroosmotic Velocity and the f Potential. Anal. Chem., 1991; 63:1801. 20.Fujiwara, S., Honda, S. Effect of Addition of Organic Solvent on the Separation of Positional Iso- mers in High-Voltage Capillary Zone Electrophoresis. Anal. Chem, 1987; 59:487. 21. Corse, J., Balchunas, A. T., Swaile, D. E, Sepaniak, M.J. Effects of Organic Mobile Phase Mod- ifiers in Micellar Electrokinetic Capillary Chromatography. J. High Resolut. Chromatogr., 1988; 11:554. 22.Hjerten, S. High-Performance Electrophoresis: Elimination of Electroendosmosis and Solute Adsorption. J. Chromatogr, 1985; 347:191. 23.Emmer, A., Jansson, M., Roeraade, J. A New Approach to Dynamic Deactivation in Capillary Zone Electrophoresis. HRC & CC, 1991; 14:738. 24.Wiktorowicz, J. E., Colburn, J. C. Separation of Cationic Proteins via Charge Reversal in Cap- illary Electrophoresis. Electrophoresis, 1990; 11:769. 25.Jorgenson, J. W, Lukacs, K. D. Zone Electrophoresis in Open Tubular Glass Capillaries. Anal. Chem., 1981; 53:1298. 26.Jorgenson, J. W, Lukacs, K. D. Free-Zone Electrophoresis in Glass Capillaries. Clin. Chem., 1981; 27:1551. 27.Jorgenson, J. W, Lukacs, K. D. Zone Electrophoresis in Open-Tubular Glass Capillaries: Pre- liminary Data on Performance. HRC & CC, 1981; 4:230. 28. Culbertson, C. T., Jorgenson, J. W. Flow Counterbalanced Capillary Electrophoresis. Anal. Chem., 1994; 66:955. 29.Jones, A. E., Grushka, E. Nature of Temperature Gradients in Capillary Zone Electrophoresis. J. Chromatogr, 1989; 466:219. 30. Grushka, E., McCormick, R. M., Kirkland, J. J. Effect of Temperature Gradients on the Efficiency of Capillary Zone Electrophoresis Separations. Anal. Chem., 1989; 61:241. 31. Knox, J. H. Thermal Effects and Band Spreading in Capillary Electro-separations. Chro- matographia, 1988; 26:329. 32. Stoyanov, A. V, Righetti, P G. Fundamental Properties of Isoelectric Buffers for Capillary Zone Electrophoresis. J. Chromatogr, A, 1997; 790:169. 33.Burgi, D., Chien, R.-L. Optimization in Sample Stacking for High-Performance Capillary Elec- trophoresis. Anal. Chem., 1991; 63:2042. 34.Moring, S., Reel, R. T., van Soest, R. E. J. Optical Improvements of a Z-Shaped Cell for High- Sensitivity UV Absorption Detection in Capillary Electrophoresis. Anal. Chem., 1993; 65:3454. 35. Nelson, R. J., Paulus, A., Cohen, A. S., Guttman, A., Karger, B, L. Use of Peltier Thermoelectric Devices to Control Column Temperature in High-Performance Capillary Electrophoresis.J. Chro- matogr, 1989; 480:111. 36.Kurosu, Y., Hibi, K., Sasaki, T, Saito, M. Influence of Temperature Control in Capillary Elec- trophoresis. HRC & CC, 1991; 14:200. 37.Kurosu, Y., Satou, Y, Shisa, Y, Iwata, T. Comparison of the Reproducibihty in Migration Times between a Constant-Current and a Constant-Voltage Mode of Operation in Capillary Zone Elec- trophoresis. J. Chromatogr, A, 1998; 802:391. 38. McLaughlin, G., Palmieri, R., Anderson, K., Benefits ojAutomation in the Separation ofBiomole- cules by High Performance Capillary Electrophoresis, in Techniques in Protein Chemistry II, J. J. Vil- lafranca, Ed. 1991, Academic Press: 3. 39.Tran, A. D., Park, S., Lisi, P J., Huynh, O. T, Ryall, R. R., Lane, P A. Separation of Carbohy- drate-Mediated Microheterogeneity of Recombinant Human Erythropoietin by Free Solution Capillary Electrophoresis. Effects of pH, Buffer Type and Organic Modifiers. J. Chromatogr, 1991; 542:459. 40. Strickland, M., Strickland, N. Free-Solution Capillary Electrophoresis Using Phosphate Buffer and Acidic pH. American Lab, 1990; November:60.
    • References 71 41.McCormick, R. M. Capillary Zone Electrophoretic Separation of Peptides and Proteins Using Low pH Buffers in Modified Silica Capillaries. Anal. Chem., 1988; 60:2322. 42. Zhu, M., Rodriguez, R., Hansen, D., Wehr, T. Capillary Electrophoresis of Proteins under Alka- line Conditions. J. Chromatogr., 1990; 516:123. 43.McNerney, T. M., Watson, S. K., Sim, J.-H., Bridenbaugh, R. L. Separation of Recombinant Human Growth Hormone from Escherichia coli Cell Pellet by Capillary Zone Electrophoresis. J. Chromatogr., A, 1996; 744:223. 44. Honda, S., Iwase, S., Makino, A., Fujiwara, S. Simultaneous Determination of Reducing Mono- saccharides by Capillary Zone Electrophoresis as the Borate Complexes of N-2-Pyridylgly- camines. Anal. Biochem., 1989; 176:72. 45.Hoffstetter-Kuhn, S., Paulus, A., Gassmann, E., Widmer, H. M. Influence of Borate Complexa- tion on the Electrophoretic Behavior of Carbohydrates in Capillary Electrophoresis. Anal. Chem., 1991; 63:1541. 46.Honda, S., Suzuki, S., Nose, A., Yamamoto, K., Kakehi, K. Capillary Zone Electrophoresis of Reducing Mono- and Oligo-saccharides as the Borate Complexes of Their 3-Methyl-l-phenyl- 2-pyrazolin-5-one Derivatives. Carbohydrate Research, 1991; 215:193. 47.Klockow, A., Amado, R., Widman, H. M., Paulus, A. The Influence of Buffer Composition on Separation Efficiency and Resolution in Capillary Electrophoresis of 8-Aminonaphthalene-1,3,6- trisulfonic Acid Labeled Monosaccharides and Complex Carbohydrates. Electrophoresis, 1996; 17:110. 48. Plocek, J., Chmelik, J. Separation of Disaccharides as Their Borate Complexes by Capillary Elec- trophoresis with Indirect Detection in the Visible Range. Electrophoresis, 1997; 18:1148. 49. Rydlund, A., Dahlman, O. Efficient Capillary Zone Electrophoretic Separation of Wood-Derived Neutral and Acidic Mono- and Oligosaccharides. J. Chromatogr, A, 1996; 738:129. 50.Tanaka, S., Kaneta, T., Yoshida, H. Separation of Catecholamines by Capillary Zone Elec- trophoresis Using Complexation with Boric Acid. Anal. Sciences, 1990; 6:467. 51. Kaneta, T., Tanaka, S., Yoshida, H. Improvement of Resolution in the Capillary Electrophoretic Separation of Catecholamines by Complex Formation with Boric Acid and Control of Elec- troosmosis with a Cationic Surfactant. J. Chromatogr, 1991; 538:385. 52.Westcott, C. C, pH Measurements. 1978, Academic Press. 53.Sustacek, V, Foret, F, Bocek, P. Selection of the Background Electrolyte Composition with Respect to Electromigration Dispersion and Detection of Weakly Absorbing Substances in Cap- illary Zone Electrophoresis. J. Chromatogr, 1991; 545:239. 54.Vindevogel, J., Sandra, P Simultaneous pH and Ionic Strength Effects and Buffer Selection in Capillary Electrophoretic Techniques. J. Chromatogr, 1991; 541:483. 55. Rush, R. S., Cohen, A. S., Karger, B. L. Influence of Column Temperature on the Electrophoretic Behavior of Myoglobin and a-Lactalbumin in High-Performance Capillary Electrophoresis. Anal. Chem., 1991; 63:1346. 56. Nashabeh, W, Rassi, Z. E. Capillary Zone Electrophoresis of Proteins with Hydrophilic Fused- Silica Capillaries. J. Chromatogr, 1991; 559:367. 57. Grushka, E. Effect of Hydrostatic Flow on the Efficiency in Capillary Electrophoresis. J. Chro- matogr, 1991; 559:81. 58.Hjerten, S. Free Zone Electrophoresis. Chromatogr Rev., 1967; 9:122. 59. Foret, F, Demi, M., Bocek, P Capillary Zone Electrophoresis: Quantitative Study of the Effects of Some Dispersive Processes on the Separation Efficiency. J. Chromatogr, 1988; 452:601. 60. Gas, B., Stedry, M., Kenndler, E. Peak Broadening in Capillary Zone Electrophoresis. Elec- trophoresis, 1997; 18:2123. 61.Mikkers, F E. P., Everaerts, F M., Verheggen, T. P E. M. Concentration Distributions in Free Zone Electrophoresis. J. Chromatogr, 1979; 169:1. 62. Williams, R. L., Vigh, G. N-(Polyethyleneglycol Monomethyl Ether)-N-Methylmorpholinium- Based Background Electrolytes in Capillary Electrophoresis. J. Chromatogr, A, 1997; 763:253. 63. Williams, R. L., Vigh, G. Polyethylene Glycol Monomethyl Ether Sulfate-Based Background Elec- trolytes in Capillary Electrophoresis. J. Chromatogr, A, 1996; 744:75.
    • CHAPTER 3 Capillary Zone Electrophoresis Methods Development 3.1 Introduction 3.2 Mobility 3.3 Solute-Wall Interactions 3.4 Separation Strategies 3.5 Secondary Equilibrium 3.6 Applications and Techniques References 3.1 INTRODUCTION Separations by CZE are performed in a homogeneous carrier electrolyte—the electrolyte in both reservoirs and the capillary are the same. Also known as free- solution capillary electrophoresis, CZE is further distinguished from other forms of HPCE by the absence of a gel or polymer network (Chapter 6), a pH gradi- ent (Chapter 5), or a heterogeneous electrolyte system (Section 8.6). The separation mechanism is illustrated in Figure 3.1. Ionic components are separated into discrete bands when each solute's individual mobility is suffi- ciently different from all others. Separations of small ions, small molecules, pep- tides, proteins, viruses, bacteria, and colloidal particles have been reported. Zwitterions such as peptides are easily separated, since the ionic charge can be fine-tuned by careful adjustment of the buffer pH. Four fundamental features are required for good separations by CZE: 1. The individual mobilities of each solute in the sample differ from one another. 2. The background electrolyte is homogeneous and the field strength dis- tribution is uniform throughout the length of the capillary. 73
    • 74 Chapter 3 Capillary Zone Electrophoresis DETECTOR •^WINDOW DIRECTION OF SEPARATION ^ : / * /*1 FIGURE 3.1 Schematic representation of a three-component separation by CZE at the moment of injection (top) and after separation (bottom). 3. Neither solutes nor sample matrix elements interact or bind to the cap- illary wall. 4. The conductivity of the BGE exceeds the total conductivity of the sam- ple components, unless very small injections are made. 3.2 MOBILITY The fundamental parameter governing CZE is electrophoretic mobility (Eq. 2.4). Since mobility depends on a solute's charge/size ratio, the buffer pH is the most important experimental variable. The impact of pH on mobility, corrected for EOF, is illustrated in Figure 3.2 (1). This illustration is known as a mobility plot. The starting point for separations is pH 2.5 phosphate buffer for bases and pH 9.3 borate buffer for acids, and the mobility plot can be used to fine-tune separations. More importantly, the mobility plot determines whether the opti- mal pH is selected to yield the most rugged and reproducible method. For exam-
    • 3.2 Mobility MOBIUTY i(r*cirfWs 6n 75 FIGURE 3.2 Effect of buffer pH on electrophoretic mobility. Reprinted with permission from J. Chromatogr., 480, 35 (1989), copyright © 1989 Elsevier Science Publishers. pie, at pH 4.5, glutamate and acetate will separate. It is clear from the mobility plot that pH 7 will yield a more rugged separation, since small variations in buffer pH will still permit the separation to occur. Among the solutes described in Figure 3.2 are acids, zwitterions, and an alkali metal, sodium. Within the pH range covered in the figure, the net charge on sodium is constant, as is the mobility. Acetate and glutamate are negatively charged and show electrophoretic mobility toward the positive electrode (neg- ative mobility). Zwitterions like amino acids, proteins, and peptides show charge reversal at their pi concurrent with shifts in the direction of elec- trophoretic mobility.
    • 7 6 Chapter 3 Capillary Zone Electrophoresis A mobility plot is an invaluable tool for methods development. At a glance, the optimal pH for separation is clear and problem areas exhibiting poor separation are obvious. When poor separations are noted at any pH, secondary equilibrium (Section 3.5 and Chapter 4) can be employed to improve the separation. The pJ or pK^ of a solute can frequently be estimated from the mobility plot, though careful control of ionic strength is required for accurate determinations (2, 3). The net charge on a solute at any pH can be calculated using the Henderson- Hasselbalch equation for bases, pH = pK, +log - ^ , (3.1) and for acids, pK, = pH + log ( 1 ^ , a - l . (3.2) where a = the fraction ionized. For monovalent ions, the calculation is straight- forward. For zwitterions such as amino acids, the contributions of the acidic and basic portions, and side chains if any, must be combined to calculate the net charge as shown in Table 3.1. In Figure 3.3, the Henderson-Hasselbalch equation is solved for bases between pH 2.5 and 11.0. By definition, a base is 90% charged when the pH is one unit below the pK^ and 10% charged when the pH is one unit above the pK^. When the pH is two or more units greater or less than the pK^, assume that the basic solute is neutral or fully charged, respec- tively. The opposite relations hold true for acidic substances. The net charge on small peptides or any polyvalent molecule is calculated by combining the net charge from all ionizable moieties. For peptides, the pK^ val- ues for the C and N terminus along with values for side chains must be used to determine the contribution to the charge. For proteins and large peptides, this simple model does not work because of charge suppression; more complex cal- culations are required (4, 5). Table 3.1 Calculation of net charge for Lysine at pH 7. H2N—CH— 1 1 1 NH2 COOH Functional Group Carboxylate a-Amino group £ -Amino group pKa 2.18 8.95 10.53 Net Charge Charge -1.000 +0.989 +1.000 +0.989
    • 3.2 Mobility Fraction Ionized 77 1 0.8 0.6 0.4 0.2 ^ PXaV ^ i L - ^ 4 1 1^ . 5 j!>"-r±r 6 ^rr™«Llrr"t:^ . 7 ^ ••r^r«-Il!::r:a- 8 ^ -rrrff^illrZa 9 ':s5s*«lll::zi±s»s^^ 3 4 5 6 7 8 9 10 11 pH FIGURE 3.3 Solution for the Henderson-Hasselbalch equation for bases of specified pK from pH 2.5 to 11. These calculations can be useful to correlate mobility with pH. Grossman et al. (6) developed an empirical relationship that linked mobility to a complex function, ln(q + l)/nO^^, where q is the charge and n is the number of amino acids. Deyl et al. (7, 8) and Rickard et al. (9) found a best fit correlation for mobility with q/M^'^, where M is the molecular weight. This is consistent with Offord's model, which describes mobility of large molecules. For small mole- cules, Ml/3 provides a better fit. Grossman's model (6) falls between these two values, as might be expected when separating peptides containing between 3 and 39 amino acids. The accuracy of the q/MW^/^ versus mobility model is illus- trated in Figure 3.4 (9); in the figure, data from a series of peptides from two separate digests separated by CZE at three different pH values are plotted. If the pKa and molecular weight of a substance are known, the use of mobil- ity calculations to select the initial experimental conditions can be a worthwhile undertaking. Although optimal separation conditions cannot be predicted using this model, the calculations are effective as a first approximation. The profound effect of pH on mobility is illustrated in Figure 3.5 for two pep- tides differing by one amino acid with sequences AFKAING and AFKADNG (10). At pH 2.5, the calculated charges on these two peptides are 1.41 and 1.36, respectively. At pH 4.0, the calculated charges become 1.02 and 0.46. It is expected and observed that greater resolution is found for the higher pH buffer.
    • 78 Chapter 3 Capillary Zone Electrophoresis o S o o n CL O w O UJ 3.000e-4' 1.000e-4' -1.000e-4 .!)noOA^- . ^ y^^CsL • * • 1 ' 'V' no a » 1 ^ o [ » a , » o o > « ^ a 1 ' '»' » " 1 " »' • 1 » ' '1 -0.04 -0.02 -0.00 0.02 0.04 o.oc FIGURE 3.4 Correlation of mobility and q/MW^^ for a human growth hormone digest (separated at pH 2.35, 8.0, and 8.15) insulin-like growth factor 11 digest (separated at pH 2.35 and 8.15). Reprinted with permission from Ana/. Biochem., 197,197 (1991), copyright © 1991, Academic Press. since the mobilities are better distinguished. While one would expect longer migration times as the pH is increased (the charge on the peptides is less posi- tive) , the increase in the EOF partially negates this effect. During the course of methods development, peak broadening and/or peak tailing may be noted. This may be due the adherence of the solute to the capil- lary wall. If this occurs, the wall effects must be eliminated before any mean- ingful methods development can be completed. 3.3 SOLUTE-WALL INTERACTIONS A. THE PROBLEM OF WALL EFFECTS A key advantage of HPCE compared with HPLC is the absence of the chro- matographic packing. The vast surface area of the packing material is responsi- ble in part for irreversible adsorption of solutes, particularly proteins. The composition of the capillary surface, though, still provides opportunities for protein adsorption. Binding of solutes to the capillary wall leads to band broad- ening, tailing, and irreproducibility of separations. If the kinetics of adsorp- tion/desorption are slow, broadened tailed peaks occur. Irreversible adsorption leads to modification of the capillary, altered EOF, and loss of resolution.
    • 3.3 Solute-Wall Interactions 79 ^ 10 TIME (min.) 10 FIGURE 3.5 Effect of buffer pH on the selectivity of peptide separations by CZE. Capillary length: 45 cm to detector (65 cm total) x 50 [im i.d.; BGE: citric acid, 20 mM, (A) pH 2.5, (B) pH 4.0; field strength: 277 V/cm; current: in A, 24 |lA, in B, 12 |lA; temperature: 30°C; detection: UV, 200 nm; peptides: (1) AFKAING, (2) AFKADNG. Reprinted with permission from Anal Chan., 61, 1186 (1989), copyright © 1989 Am. Chem. Soc. Figure 3.6 illustrates the electrostatic binding of a protein to the capillary wall. At most pH values, the capillary wall has a negative charge due to silanol ionization. Separation of a protein at a pH below its pJ produces a cationic solute that ion-pairs to the capillary wall. Hydrophobic binding may occur as well between the epoxide moiety of fused silica and a hydrophobic solute. Since most separations occur in aqueous media, hydrophobic solutes are not well solvated, further enhancing this potential binding mechanism.
    • 80 Chapter 3 Capillary Zone Electrophoresis •MUMUttUiiriiiiiUiuifaUriiyd^^ FIGURE 3.6 Illustration depicting the ion-pair formation between a positively charged protein and the negatively charged capillary wall. The problem of wall binding is most severe for large molecules. This is eas- ily understood from the illustration in Figure 3.7. A small molecule can have but a single point of attachment to the capillary wall. A large molecule can lie LARGE MOLECULE SMALL MOLECULE FIGURE 3.7 Ion-pair formation between large molecules results in multiple points of attachment with the capillary wall. This is not possible for small molecules.
    • 3.3 Solute-Wall Interactions 81 down on the wall and ion-pair in many places. It then becomes for difficult for the large molecule to dislodge from the wall, since all points of attachment must simultaneously be broken. For small molecules, wall effects usually result in Gaussian band broadening and the effect is slight. This has been studied for lan- thanide ions (11), where a coated capillary proved more efficient. Adsorption or retention in HPCE is determined by a solute's adsorption/des- orption kinetics with the capillary wall. A first approximation of the impact of wall effects can be understood using a random walk model from chromato- graphic theory (12). Random walk theory considers a solute moving down the capillary in discrete steps. The peak variance is expressed as ^s = 2 ( - ^ ) ^ v , p t , L , (3.3) 1 + fe where t^ = the time for adsorption. Retention occurs whenever t^, the time for desorption, is greater than t^, and by definition, t^ = tjk The time for adsorption, t^, is a function of the diffu- sion coefficient, the capillary diameter, and the probability of binding to the cap- illary wall. Table 3.2 contains data showing the molecular weight and the diffusion coefficient for various molecules. The kinetics of mass transport to the capillary wall are slower for large molecules, and this in part indicates wall effects are more severe as the molecule weight increases. When solutes adhere to the wall, peak tailing may be observed since a des- orbed solute does not return at once to the buffer solution. Retained solutes have a migration velocity of zero. Solutes in the buffer move at a rate determined by their migration velocity and, thus, move ahead of retained material. If we Table 3.2 Diffusion Coefficients of Large and Small Molecules Compound j3-alanine Phenol Citric acid Cytochrome c ^-Lactoglobulin Catalase Myosin Tobacco mosaic virus Molecular Weight 89 94 192 13,370 37,100 247,500 524,800 590,000 D(cmV X 105) 0.933^ 0.84^ 0.66P 0.114^ 0.075'^ 0.04F O.OIF 0.0046^ ^From Handbook of Physics and Chemistry, 46th ed., 1965, CRC, p. F46. ^From, B. L. Karger, L. R. Snyder and C. Horvath, An Introduction to Separation Science, 1973, John Wiley & Sons, p. 79. ''From A. L. Lehninger, Biochemistry, 1970, Worth Publishers, pp. 136-137.
    • 82 Chapter 3 Capillary Zone Electrophoresis solve Eq. (3.3) for the variance and plot the decrease in the number of theoret- ical plates versus k' (Figure 3.8), the dramatic impact of wall effects on efficiency is apparent. To achieve the theoretical efficiency of CZE, k' must approach zero. As the figure illustrates, even modest retention will lead to severe band broad- ening. In the worst case scenario, no elution occurs—the solute is completely bound to the capillary wall. This simple random walk model only estimates the impact of wall effects on efficiency. More sophisticated calculations have appeared in the hterature in 1995 (13, 14). In any event, the appropriate buffer additives or capillary coatings are required to minimize this form of band broad- ening. Using a clever experimental apparatus with multiple detectors, Towns and Regnier (15) were able to measure the binding of proteins to the capillary wall. Some of their data are reproduced in Table 3.3. Under their experimental con- ditions, all proteins showed some binding. As expected, the high-pl proteins bound most strongly, owing to their positive charge at pH 7. Wall effects on bare sihca have proved to be a difficult problem since the early days of HPCE (16). Since then, several solutions have been proposed including the use of 1. Extreme pH buffers 2. High-concentration buffers 3. Amine modifiers -J r a (fl -I O < -o — h- — UJ 5 FIGURE 3.8 Impact of wall retention on efficiency where Vep = 1 mm/s, L = 500 mm, and ta = 100 ms (0), 50 ms (+), 10 ms (D).
    • Lysozyme Cytochrome c Ribonuclease A Chymotrypsinogen Myoglobin Conalbumin Carbonic anhydrase /3-Lactoglobulin B j8-Lactoglobulin A Ovalbumin Pepsin 11.1 10.2 9.3 9.2 7.3 6.3 6.2 5.2 5.1 4.7 3.2 3.3 Solute-Wall Interactions 83 Table 3.3 Percent Recovery for Proteins of Varying pi on an Uncoated Capillary Protein pi Percent Recovery 0 0 0 0 63 66 72 74 76 81 90 Determined using two detectors 60 cm apart on a 75-|Xm-i.d. capillary. Conditions: 10 mM phos- phoric acid, pH 7; detection at 214 nm; 300 V/cm, 30 ^lA. Data from reference (15). 4. Dynamically coated capillaries 5. Treated or functionalized capillaries B. EXTREME P H BUFFERS In 1986, Lauer and McManigill (17) reasoned that anionic proteins should be repelled from the anionic capillary wall. Selecting a pH 1-2 units above the pJ of a protein produces separations free of wall effects. There are several limita- tions to this approach. 1. Hydrophobic binding is not eliminated. 2. Proteins with high pi vlaues, such as histones, do not form anions until pH 13 is reached. To reach that pH, 100 mM sodium hydroxide is required, a solution that is too conductive to be a useful electrolyte. 3. Alkaline pH values may not be optimal for the separation. Despite these limitations, this useful approach was the first to employ charge manipulation to reduce wall interactions. Two years later, McCormick (18) chose a different approach. At pH 1.5, the silanol groups at the capillary wall are not ionized. While the proteins are cationic at that pH, electrostatic interactions should be eliminated. McCormick
    • 84 Chapter 3 Capillary Zone Electrophoresis proposed that phosphate groups bind to the capillary wall, further decreasing the activity of the silanol groups. As with working at a high pH, low-pH sepa- rations may not be ideal. This is particularly important when separating simi- lar proteins where the charge to mass ratios are all similar at pH extremes. C. HIGH-CONCENTRATION BUFFERS Green and Jorgenson (19) found that buffers with high concentrations of salts decreased adsorption of proteins on the capillary wall. The added salts proba- bly occupy potential adsorption sites. Potassium sulfate was the additive of choice based on performance and UV absorption background. A buffer com- prising 100 mM CHES, pH 9, with 250 mM potassium sulfate and 1 mM EDTA produced 140,000 theoretical plates for trypsinogen. The approach was limited, because low field strengths and narrow-i.d. capillaries were necessary due to Joule heating problems. A combination of low field strength and low EOF yielded prolonged run times. Sensitivity was also problematic, because of back- ground UV absorption by the electrolyte. To address the limitations of high-ionic-strength buffers, Bushey and Jor- genson (20) substituted a zwitterionic species such as glycine, betaine, or sar- cosine for the ionic salt. When the buffer pH is adjusted to the pi of the zwitterion, its net charge, mobility, and conductivity approach zero. The best results were found using 40 mM phosphate/250 mM potassium sulfate, pH 7; 100 mM CHES/250 mM potassium sulfate, pH 9; and 40 mM phosphate/2 M betaine/100 mM potassium sulfate, pH 7.6. In principle, any zwitterionic buffer could be used at the appropriate pH provided the UV absorption is sufficiently low. Even modest increases in the ionic strength can have profound impact on the separation. Increasing the buffer concentration from 10 mM Tricine, pH 8.1, to 100 mM Tricine at the same pH gave dramatic improvements for the separa- tion of a human growth hormone tryptic digest (21). D. AMINE MODIFIERS Amine derivatives such as triethylamine have been used for years to suppress silanol effects in HPLC. Alkyldimethylamines have been shown to be most effec- tive (22). In 1986, Lauer and McManigill (17) added 5 mM putrescine (1,4- diaminobutane) to improve the resolution and peak shape of myoglobin. Since that time, many papers have appeared reporting the employment of polyamines as electrolyte additives to reduce both EOF and protein binding to the capillary wall (23-30). Used at concentrations as low as 1 mM or as high as 30-60 mM, 1,3-diaminopropane improves resolution of basic proteins such as lysozyme.
    • 3.3 Solute-Wall Interactions 85 cytochrome c, and ribonuclease. Monovalent amines such as triethylamine or n-propylamine were not as effective. The use of 1,3-diaminopropane allows sep- arations of basic proteins at pH values below their isoelectric points. Since the pH can be independently controlled over a wide range, a buffer can be optimized without considering wall effects. Separations are shown in Figure 3.9. The prob- lem with 1,3-diaminopropane is volatihty and toxicity As a result, 1,4- diaminobutane (27-29) or 1,5-diaminopentane (26) have been used in its place. A) pH 9.0 H 6 iLXl C) pH 7.0 H M l M V . •^w-^ 20 Time (min) 40 b) pH 6.2 j^jpKiijf 0* 20' 40 Time (min) 1 3 2 E) pH 4:7 IJUL 20 Time (min) 40 f ) pH 3.5 2 4 '^ 3 20' Time {min) 40 FIGURE 3.9 Separation of basic proteins on an untreated fused-silica capillary with diamino- propane as a buffer additive. Capillary: 75 cm (55 cm to detector) x 50 |Lim i.d.; BGE: pH values as noted in the figure with 30-60 mM diaminopropane as an additive; field strength: 200-240 V/cm; solutes: (1) lysozyme; (2) cytochrome c; (3) ribonuclease; (4) a-chymotrypsin; (5) trypsino- gen; (6) rhulL-4. Reprinted with permission from J. Microcolumn. Sep., 3, 241 (1991), copyright © 1991 Microseparations, Inc.
    • 86 Chapter 3 Capillary Zone Electrophoresis Another polyamine, N,N,N,N-tetramethyl-l,3-butanediamine, used between pH 4.0 and 6.5 has been effective for the separation of basic proteins (31). E. DYNAMICALLY COATED CAPILLARIES In 1990, Wiktorowicz and Colburn (32) reported on an approach that employs a cationic surfactant to reverse the charge on the capillary wall. Since then, numerous papers have appeared reporting on the use of that approach (33-40). The mechanism of charge reversal is illustrated in Figure 3.10. Ion-pair for- mation between the cationic head group of the surfactant and the anionic silanol group occurs. The hydrophobic surfactant tail extending into the bulk solution cannot be solvated by water. Its solvation need is satisfied by binding to the tail of another surfactant molecule. As a result, the cationic head group of the sec- ond surfactant molecule is in contact with the bulk solution. The capillary wall behaves with cationic character because of this treatment, and the EOF is directed toward the positive electrode. For most separations, it is necessary to operate the HPCE instrument with reverse (sample side negative) polarity. Using this approach, a buffer pH is selected that is below the pi of the target protein. The cationic protein is now repelled from the cationic wall. In the Wiktorowicz approach, the cationic surfactant is not present in the run buffer. The capillary is coated before the separation step. Excess surfactant is flushed from the capillary and replaced with run buffer. This coating is stable for many runs, after which the capillary is simply recoated. The coating is sufficiently stable to permit CE/MS of proteins without detection of the surfactant (39). CAPILLARY WALL / ( r'V( (I w ^s )i k ® « ® ^ EOF FIGURE 3.10 Pictorial representation of cationic-surfactant-mediated charge reversal at the cap- illary wall with concomitant reversal of the electroosmotic flow.
    • 3.3 Solute-Wall Interactions 87 In Emmer's method, a fluorinated surfactant^ is added to the run buffer at a concentration of 100 jig/mL. A value of more than 300,000 theoretical plates was reported for lysozyme, a protein with a pi of 11. This approach, along with Wiktorowicz's, does not require a covalently treated capillary, extreme pH, amine additives, nor high-ionic-strength buffers. Also of note is the use of 1 mM hexamethonium bromide or 300 |im decamethonium bromide as a dynamic coating for the resolution of protein gly- coforms (41). At such low concentrations, the charge on the capillary wall is not reversed, and so normal polarity voltage is used. A new series of reagents^ have been shown to dramatically stabilize the EOF, resulting in highly reproducible migration times. Figure 3.11 illustrates the mechanism for this dynamic coating. First, the capillary is treated as usual with 0.1 N sodium hydroxide followed by a rinse with a polycation solution. Then, a second layer consisting of a polyanion in a buffer of the desired pH is flushed through the capillary. Figure 3.12 shows four replicate runs for a chiral separa- tion of epinephrine. The runs are virtually superimposible, showing repro- ducibility seldom found in HPCE. Since the polyanion coating provides a high EOF at pH 2.5, the capillary length must be longer that for bare silica when sep- arating bases. The reagents have been shown to work for bases at a pH below the pKg. Other applications have not been verified as ofJanuary 1999. F. FUNCTIONALIZED CAPILLARIES There is no shortage of publications covering the use of coated capillaries, as this sampling of references indicates (33, 34, 42-81). Unfortunately, the quest for the ideal surface for HPCE remains elusive. The preparation of capillaries with traditional silane chemistry renders the coating labile to alkaline hydroly- sis. The ideal surface would be hydrophilic, stable, and exhibit no EOF or at ipluorad FC 134 from 3M Company, St. Paul, MN. ^CElixir, Scientific Resources, Inc., Eatontown, NJ. CAPILLARY WALL POLYCATION LAYER POLYANION LAYER FIGURE 3.11 Illustration of the coating process using a polycation and polyanion to stabilize the charge on the capillary wall.
    • 88 Chapter 3 Capillary Zone Electrophoresis 3 5" FIGURE 3.12 Four overlaid runs of the chiral separation of epinephrine using CElixir. Capillary: 72 cm X 50 |lm i.d. BF3; voltage: 30 kV; BGE: CElixir, pH 2.5, with 20 mM dimethyl-j3-cyclodex- trin; injection: 100 mbs; temperature: 20°C; detection, UV, 200 nm; epinephrine: 1 mg/mL in water. least have controllable EOF. The goal is to prepare a stable and inert surface that provides no retention. Even a minor amount of retention will dramatically reduce efficiency due to mass transfer effects. An ideal surface is very hydrophilic, or a buffer additive can used to main- tain hydrophilic character. Since HPCE is performed in aqueous media, any hydrophobic character in the surface treatment will result in undesirable reten- tion. Jorgenson and Lukacs (82) prepared a silylated capillary to reduce the EOF and improve the resolution of dansyl amino acids. In 1985, Hjerten produced treated capillaries using polyacrylamide or methylcellulose as the coating (42). Solute adsorption was reduced, but the polyacrylamide coating was not very stable, particularly at high buffer pH. Very little data have been published on most of these coatings. Polyacry- lamide-treated capillaries have received the most attention because of their his- tory of use in slab-gel electrophoresis. These surface-treated capillaries have been commercially available for some time.^ The coating has a limited lifetime, particularly in alkaline buffers, although a stabilized version has been available for some time.'^ Other commercially available capillaries are noted in Table 2.6. ^Bio-Rad, Richmond, CA. 4jUSIL-FC,J&W Scientific, Folsom, CA.
    • 3.3 Solute-Wall Interactions 89 A fluorocarbon-polymer-coated capillary is used in conjunction with small amounts of either cationic, anionic, or neutral fluorinated surfactants. The charge on the capillary wall and thus the EOF can be controlled by the selection of sur- factant and surfactant concentration. The capillary is more tolerant of alkaline pH, presumably because the added surfactant can "repair" the capillary surface. A capillary with a permanent positive charge^ is useful for separating positively charged proteins, since they are repelled from the capillary surface. Since the EOF is now directed toward the anode, this capillary is used in the reversed-polarity mode. A polyvinyl-alcohol-coated capillary^ for use between pH 2.5 and 9.5 has been shown useful for many protein separations. Phosphate, Tris, and 2-amino-2- methyl-l,3-propandiol are the recommended buffers. Borate should be avoided with this capillary because of surface swelling. Lowering of the EOF occurs in most coated capillaries. Under these circum- stances, it may be necessary to reverse the voltage polarity when anions are sep- arated. Towns and Regnier found a surface coating of 30 A is required to suppress the underlying silanol effects. The dependence of EOF on buffer pH can also be reduced (83). The use of hydrophobic coatings with surfactant additives can produce a well- coated hydrophilic surface (83). Nonionic surfactants such as Brij-35 or Tween- 20 at levels of 0.01% in the buffer yield good separations of acidic (Figure 3.13a) or basic (Figure 3.13b) proteins. Approximately 240,000 theoretical plates have been obtained for myoglobin. G. GC CAPILLARIES Capillaries manufactured for gas chromatography (GC) can probably be substi- tuted for coated capillaries for a very low cost per capillary. DB-1 (dimethylpolysiloxane), DB-17 (50% methyl/50% phenylpolysiloxane), DB-Wax, and others are available precut with detection windows included.-^ These capil- laries can also be purchased in bulk as GC capillaries, but detection windows must be cut using either hot sulfuric or nitric acid. The use of GC capillaries pur- chased in bulk has not been extensively studied with HPCE, although a refer- ence appeared in the literature in 1996 (84). H. COATED CAPILLARIES VERSUS BUFFER ADDITIVES Good separations of proteins are possible using either buffer additives or coated capillaries. It is impossible to predict if one method will predominate over the 5eCAP amine, Beckman Instruments, Fullerton, CA. 6PVA capillary, Hewlett-Packard, Little Falls, DE. TJ&W Scientific, Folsom, CA.
    • 90 Chapter 3 Capillary Zone Electrophoresis T .002 AU i nv^-'^ I^JU IK-W** 8 12 Time (min) 16 20 FIGURE 3.13A Electropherogram of basic proteins in an alkylsilane-treated capillary with a non- ionic surfactant buffer additive. Capillary: 50 cm x 75 im i.d. alkylsilane-treated capillary; BGE: 10 mM phosphate, pH 7 with 0.01% Brij-35; field strength: 300 V/cm; detection: 200 nm; solutes: (1) lysozyme; (2) cytochrome c; (3) ribonuclease A; (4) a-chymotrypsinogen; (5) myoglobin. Other. From the standpoint of cost, buffer additives are clearly preferable since bare fused-silica capillaries are disposable items. On the other hand, buffer designs are more complex using additives, and the additives may interfere with mass spec- trometry. For micropreparative work, removal of the additive may also be neces- sary. When separating small molecules, coated capillaries are seldom necessary. 3.4 SEPARATION STRATEGIES Much of the work reported for CZE deals with proteins, peptides, and small molecules. For many of these applications, methods development is required, since each solute is unique. The approaches toward methods development for these classes of compounds are given in this section. Methodology for applica- tions areas such as carbohydrates, small ions, peptide mapping, and others will be covered in the applications sections.
    • 3.4 Separation Strategies 91 Time (mln) FIGURE 3.13B Electropherogram of acidic proteins in an alkylsilane-treated capillary with a non- ionic surfactant buffer additive. Capillary: 30 cm X 75 |Lim i.d. alkylsilane-treated capillary; condi- tions as per part a; solutes: (1) myoglobin; (2) conalbumin; (3) transferrin; (4) p-lactoglobulin B; (5) P-lactoglobulin A; (6) ovalbumin. Reprinted with permission from Anal Chem., 63, 1126 (1991), copyright © 1991 Am. Chem. Soc. A. SOLUBILITY Ensure the solute is soluble in the BGE prior to the run. Even a hint of cloudi- ness may mean hydrophobic material is not in solution. Spikes and/or broad peaks that may not have reproducible migration times may appear in the elec- tropherogram. It is possible that no peaks will appear at all. Though organic sol- vents can be used to provide solubility, do not neglect 7 M urea as an additive. Its ability to get material in solution should not be underestimated. Adding 7 M urea to 200 mM borate buffer, pH 9.2 can be used to solubilize hydrophobic membrane proteins (85). If basic compounds are insoluble in low-pH phosphate buffer, acetate buffer may be a better choice. B. PROTEINS AND LARGE PEPTIDES There is no single solution to developing conditions useful for separating all proteins. Given in the following is a series of practical experiments for quickly screening a variety of conditions. Detection is best at 200 nm, though 220 or 280 nm are used for some applications if the BGE absorbs in the low UV.
    • 9 2 Chapter 3 Capillary Zone Electrophoresis 1. Start with 20-50 mM borate buffer, pH 9.3, or select a pH at least 2 pH units above the protein's pJ. The borate concentration can be increased to 150 mM, though a 25-|lm-i.d. capillary may be required. See Section 3.6E for a discussion of serum protein separations. 2. For basic proteins, use a coated capillary with 20-50 mM phosphate buffer, pH 2.5 or 7. 3. Prepare a BGE identical to the matrix in which the protein is dissolved, provided the matrix does not absorb in the low UV A 25-|Lim-i.d. capil- lary can be used for conductive electrolytes. 4. Add a cationic surfactant to the BGE. 5. Add a polyamine to the BGE. 6. Use surfactants such as SDS above the critical micelle concentration. 7. Work with high-ionic-strength buffers such as 150 mM borate buffer, using 25-|im-i.d. capillaries to minimize heating. 8. For insoluble solutes such as membrane proteins, add 4-7 M urea to the BGE. 9. Try ethylene glycol as an additive (86). Table 3.4 contains capillary and electrolyte data for a variety of real applica- tions including separating posttranslational modifications of recombinant pro- teins, separation of glycoforms, clinical analysis, and quality control. C. SMALL MOLECULES AND SMALL PEPTIDES 1. Determine the wavelength for detection. If a charged solute does not absorb in the UV region, then indirect detection must be employed. If the solute is neutral and does not absorb, it is not a candidate for HPCE unless derviatization is employed. 2. Determine if the solute is soluble in water or one of the common buffers usually employed. If insoluble, organic solvents may be used—but cau- tion should be exercised if micelles or cyclodextrins are in the BGE, since peak splitting may occur. Addition of 7 M urea to the sample and/or BGE will get most materials in solution, but this precludes the use of wave- lengths below 250 nm for detection. If the solute is highly water-insol- uble, then consider nonaqueous capillary electrophoresis (NACE). 3. For acids, start with 20-50 mM, pH 2.5 phosphate buffer. The more dilute buffer will give faster separations, though at the expense of loading capac- ity and, occasionally, resolution. For bases, start with 20-50 mM, pH 9.3 tetraborate buffer. Bare silica capillaries are usually fine until the mole- cule becomes sufficiently large that there can be multiple points of attach- ment to the capillary wall. 4. If resolution is inadequate, a mobility plot should be performed across the average of the pK^ values of the solutes.
    • 3.4SeparationStrategies93 2 p-l N U to 3 P3 3 f2 1^ 00 00 00 Xo^o 00^ o o r-H(Nm^ 0^ONON0> in ON r—1 ^ vo ON N- ON 00 ON ON ON in 00 Uo^ 1^ CI. o SS ex o s.a 00^ 00 reex ^''i-i O B 13 fl s ^ o m ,e 3 u u JB o ON P: Xc« ^I oS O exo .OS inin XX PHCX Tt-,-H(N(N sO oin invo CX^ ^ex O(/) ,i1O exx! exex OO PHex as ex ex ex y^ O ex ^LOLOLO 1>(U -dn3 saasOS "o"oPHfX W o ,13 fX !zj a 1 o^ s < c/) a <5 o (A) OS el •go < S W) piS 'o U 'bb g "S-o ^o O y _o 'C o U CD ,g•^ .2 O •32 o e3 o f5 0 X 2 o Xi X ex 1 ex o in"^ ex ex^ o ex 1 (NrH(N-—II—I O PH •5IS n3 O B §p. X o s o I 3 rP "So I—Ito X ;§^ex 3rtjO
    • 94Chapter3CapillaryZoneElectrophoresis I(-hi o u N U u St2 3 PQ r-H(Nro p^^^—'V^^^^wl^-^^wll—1 PC <u o o in 00CIH 3:^ .r-^ in c« i-iOCD O-CO XiCUXi ss ss ssoo•"^1—1oin TO in X J: O a. :s so o1—I 1—1 to < U S B o o•—I ^o C3 00 2' C3 >-i ,^H ^ON X D. oX^ o m M ^d. s B in O Xi (U 'B O 2 'B o (U S -a o ^2sS o o>—1 so o"-H ^ P: u c« s soO 1—1 ON 3: 2 ojD S B o ot-H o PC a (J O X oro O X o ^sS oin i-H o X D- O X o m in ^X a; w s .2 o B oin 3 en B 5 •^ o so m 00 PC a. o ^S S o o bb LO<CL, o:;So:7:::3TT: Cuty-)PLH^(y)LOu^cA)LOtn 'C 2 p^ s o 'u 13 S .2'5C OS > < Ij ^Z ^ w « XO 2- 3 O TJ ;3 2 1/5 B o u c Xi c^ >o s-2 O^- B ^3
    • 3.5 Secondary Equilibrium 95 5. If the separation is still inadequate, then secondary equilibria should be utilized. This topic will be described in detail in Section 3.5 and Chap- ter 4. MECC is the most common form of secondary equilibrium. Table 3.5 contains a listing of applications and buffer recipes for a variety of solutes. 3.5 SECONDARY EQUILIBRIUM The use of secondary equilibrium in HPCE entails the transient interaction of solutes with an added reagent. Let us assume that two cationic solutes, A and B, are inseparable at any pH but that a reagent has been identified that may inter- act with the solutes. Then the following equilibrium expressions can be written: A-^ + R ^ A^R, (3.4) B+ + R ^ = ^ B^R. (3.5) If the equilibrium is pushed too far to the left, no separation can occur, since A+ and B+ are inseparable. When the reagent interacts with the solute, the mobility decreases since the neutral reagent contributes mass without charge. However, if the equilibrium is pushed too far to the right, no separation occurs, since A+R and B+R are usually inseparable. Separation only occurs when two conditions are met: 1. Kg does not equal Kb. 2. The equilibrium is not pushed to either extreme. Wren and Rowe developed a model that they applied to chiral recognition (137-139); their model, though, is applicable to virtually all forms of sec- ondary equilibrium: A^ = [C](M.-A^.XK,-K,) ^3 ^^ l + [C](Ki + K^) + K.K.IC? Here [C] is the concentration of the complexation reagent, K^ and Kj are the respective equilibrium constants, ^^ is the mobility of the free species, and ^2 is the mobility of the complexed species. The equation is solved and the results are plotted in Figure 3.14. Three types of behaviors are illustrated: 1. Weak binding 2. Moderate binding 3. Strong binding
    • 96Chapter3CapillaryZoneElectrophoresis ^ rHfNrnm (N^(N in (N vo (N r- (N^fN o o w N U X u [JH t-J o in irT 'o N 03 -rs 1 :ieo I—< w srl ON H w ^D. (A o rC Cu sB in j^ in C5 J2 D- tf) O 42 Ci, 2 B o o 00 <u 03 ^o X3 g oo rsi X p- s ON ai" 'S ^O- Vi O ^D^ S so ro in X w" tc ^O- (A) O M D- S so in .2 (/)o p- S o in (J rt -C D- V) O ^D- S B o VO OS (J .£ 'C >> "^ ^ g o rN vO d p- !/5 P- C« U S g o 00 Os P., „ W W o -p sg o CM 00 PH oT c« X P- (/5 o X & sg o in 00 ri X00 w'3:; wP- Xi- 0.^ 'fi.«0jil; ^0 P.^ gg 00 001—1i-H 1—1 ro P. <u 'SJ3 P< (/5 0 ^Pk X p- (LT c« rC P- Crt 0 ^p- sg 0 "—I in 00 06 0 X p- 2i" C8 ^p. ir> 0 Xi P- S g 0 m 00 X p- 'o C8 g 0 (U «M 0 Xi g 0 in rM 00 3: p- <U C3 0 X> g 0 0 <N X iu" «ri:3 P- in 0 ^P- S g 0 '—' in ni E Pi -cu in "0 S g 0 r^l CO ;!<!<<< .g^•>> ^B-^ •<<:cQ0 PQ •13O PU p- <u p- 0 x: p- 0 p- c 'S U 1 g -0 g U 0 g U 0 in in 2 t3 PQ 0 0 1—1 g T3 3 'a .g 13 x: p. w 03 P. 0 xi p. <U 0 P. 0 w 0 OS PU g {/J 0 n., 7) •g P. B 0 li c/) 0 > 0 (^^^ss
    • 3.5SecondaryEquilibrium97 oo o 00 o sd (S '^'C o ;3 o <S O P4 s2 o i-H r-H o PH o 42 s 4:3 p^ 0 S e0 m fM OX) B 0 (N -d^ a '0 S s0 c« '0 0 § C3 S sv£) <—< 0 1—I pH 0 42 s s0 in "S 0 0 fN '^ s0 0 "S MPH I/) 0 p. 0 0 P^ 0 0 r—1 1^ X p^ <w H #in SE s0 in U ^in h- oi X P. <J" p^ CD P- S 0 in !U OS 3N n:3 1 5S 0 (N 'xs b 0 '0 0 C/3 ^en 0 p. 'S in 0 In 3'u w u 'B « 0 a i0 4- c« 1C/5 '0 1 0 [A PH n3 g u 0 ,n 7^ 0 3 a0 10 <u 3 0 0 C/3 in CX) PS Pi .2 u •T3 03^^^ 00rp s1
    • 98 Chapter 3 Capillary Zone Electrophoresis Mobility Difference 0.01 0.02 0.03 0.04 0.06 0.06 0.07 0.08 0.09 Concentration (M) 0.1 FIGURE 3.14 Effect of reagent concentration on the mobility differences between two solutes when secondary equilibrium is employed. The equation is solved for strong binding (•), moderate bonding (+), and weak binding (*). A AK of 10% is used in all cases. Note that the mobihty difference between two solutes is a function of the reagent concentration and the equihbrium constant. When the equihbrium is pushed to the right, the reagent concentration must be kept low; when the equi- librium is pushed to the left, the reagent concentration must be kept high. Since the equilibrium constants are not known in advance, the reagent concentration must always be carefully studied in order to optimize the method. The next feature to consider is the charge of the reagent and solute. To sep- arate charged solutes, the reagent can be charged or neutral. When the solute is neutral, the reagent must be charged. This holds for all reagents, whether micelles, cyclodextrins, or anything else. Micelles and cyclodextrins are the most common reagents employed for secondary equilibrium. More than 1000 papers have appeared in the litera- ture reporting on the use of these reagents, and Chapter 4 will be devoted to their usage, along with related reagents. The theory developed around micelles is based on chromatographic theory as opposed to the equilibrium model described above. The chromatographic theory will be presented in the next chapter. Chelating agents, ion-pair reagents, and transition metals are frequently used to enhance separations. Metal ions such as Cu(II), Zn(II), Ca(II), and Fe(II)
    • 3.6 Applications and Techniques 99 often coordinate to nitrogen, oxygen and sulfur. Mosher (140) separated histi- dine-containing dipeptides with Zn(ll) and Cu(ll) additives in 100 mM phos- phate buffer, pH 2.5. Addition of 20-30 mM ZnS04 gave basehne resolution of DL-His-DL-His diastereomers. Other groups that can interact with metal ions include thiol, indoyl, N-terminal amino, imidazole, and j8-carboxyglutamate. Phosphorylated proteins interact with Mg(ll) and Mn(ll). Separations of cal- cium-binding proteins such as calmodulin, parvalbumin, and thermolysin along with zinc-binding proteins like carbonic anhydrase and thermolysin have been reported (141,142) using the respective metal ion. A 2 mM addition of calcium yielded a 15-min shift in the migration time of carbonic anhydrase. Silver ion is useful in separating alkenes (143). Figure 3.15 shows a separa- tion of cis and trans isomers of a proprietary compound. A small amount of SDS was added to the BGE to keep the silver from binding to the capillary wall. With- out the added SDS, peak tailing was observed due to a wall effect. Another example using secondary equilibrium coupled with adjustment of the EOF in a short capillary to give a subminute separation of nucleosides is shown in Figure 3.16(131). The EOF of the bare silica capillary is reversed with 0.2% hexadimethrin bromide in order that it is directed, like that of the anionic solutes, toward the positive electrode. To adjust selectivity, a 20 mM solution of Mg2+ is added to the BGE. Using the 7-cm short end of the capillary for the sep- aration produces a run time of 50 s. Chelating reagents such as hydroxyisobutyric acid can be used to modify the mobility of lanthanides and transition metals. Borate buffer is used to form com- plexes with carbohydrates (144-147). Hydrophobic interaction between peptides or proteins and alkyl sulfonic acids increases the net negative charge of the solute (148). Solutes with differ- ing affinity for the sulfonic acid are differentiated. The alkylsulfonic acid's tail binds to a hydrophobic site on the analyte, with the anionic head group extend- ing out into the bulk solution. Increasing the negative charge is helpful in reduc- ing wall effects. Selectivity can be altered by selecting the length of the alkyl chain; pentanesulfonic through decanesulfonic acids are good choices. Increas- ing the sulfonic acid concentration generally improves selectivity at the expense of Joule heating; 50 mM is sufficient for many separations. 3.6 APPLICATIONS AND TECHNIQUES A. CAPILLARY ION ELECTROPHORESIS Separation of small ions is traditionally performed by ion-exchange chromatog- raphy using suppressed conductivity detection. This technique, known as ion chromatography (IC), has been successfully employed for more than 20 years. The technology, though, is not without limitations. Expensive and sometimes
    • 100 Chapter 3 Capillary Zone Electrophoresis 13.03 1.39 acslonv '^'^^'Mmitm. 3.35 L•^^H ••am "wi" *" FIGURE 3.15 Separation of cis/trans isomers of an alkene using silver ion. Capillary: 26 cm (20 cm to detector) x 50 jLim i.d.; BGE: 32.5 mM borate, pH 9, 2.5 mM silver nitrate, 5.0 mM SDS; volt- age: 30 kV; injection: 5 s (Beckman); temperature: 40°C, detection: UV, 213 nm. short-lived columns are required, and the mobile phase is usually strong acid or base. Pumping systems may require frequent maintenance for peak performance. Matrix effects are commonplace, and extensive sample preparation may be required. The cost per analysis may be high. Separation and detection of small ions such as Na"^, K"^, Cl~, Br", N02~, tran- sition metal ions, and lanthanide ions by CZE present unique problems. Many of these species are completely ionized between pH 2 and 12. Other ions such as borate and carbonate have pK^ values of 9.24 and 10.25, respectively; ammo- nia has a pKb of 4.75. Their mobilities are substantially affected by pH. Metal ions such as Li+, Na^, and K+ are fully ionized and easily separated, but many transition metal and lanthanide ions prove challenging. Since many of these solutes do not absorb light, indirect or conductivity detection must be employed. The subject was reviewed in 1991 byJandik et al. (149), tracing the history of the technique back to 1967, when Hjerten separated bismuth and copper in a 3-mm-i.d. rotating capillary
    • 3.6 Applications and Techniques 101 0.025 T 0.015 t 0.005 t -0.005 30 40 50 migration time (s) FIGURE 3.16 High-speed separation of nucleoside 5'-triphosphates with magnesium ion. Capil- lary: 47 cm (7 cm to detector) x 50 iLim i.d.; BGE: 16 mM ammonium citrate, 10 mM citric acid, pH 5, 20 mM Mg^+; voltage: +25 kV (actually reversed polarity, but voltage is positive since the short end of the capillary is utilized); temperature: 25°C; injection: electrokinetic, 5 kV for 1 s; detection: UV, 254 nm; nucleotide concentration: 5 mg/L. Capillary conditioned with 0.2% hexadimethrin bro- mide, 0.5 min prior to each run. Reprinted with permission from J. Liq. Chromatogr. Related Tech- nol, 22, 2389 (1999), copyright © 1999 Marcel Dekker. A comparison between IC and CZE for a series of anions is illustrated in Fig- ure 3.17. The peak shape and time of analysis is superior by CZE. However, the sensitivity of suppressed conductivity detection is much greater than indirect photometric detection, the technique usually employed for measuring small non-UV-absorbing ions. A series of recipes for separating anions or cations is given in Table 3.6. From this table, it appears that there many types of electrolyte systems usable for a given application.
    • 102 Chapter 3 Capillary Zone Electrophoresis 2 4 L2/^ a.i ' ' Vi 6.0 8.6 10.6 , 12.6 14.6 Retention Time Minutes) FIGURE 3.17 Separation of an anion standard by (A) ion chromatography and (B) capillary zone electrophoresis. In A, column: Vydac 302IC4.6; eluent: isophthahc acid, 250 jXg/mL, pH 4.6; flow rate: 2.5 mlVmin; injection size: 25 fiL; detection: 280 nm. In B, capillary: 65 cm x 75 |Xm i.d.; BGE: 2 mM borate, 40 mM boric acid, 1.8 mM chromate titrated to pH 7.8 with diethylenetetramine; volt- age: 20 ky reverse polarity; detection: indirect UV, 280 nm. Key: (1) chloride; (2) nitrate; (3) chlo- rate; (4) nitrate; (5) sulfate; (6) thiocyanate; (7) perchlorate; (8) bromide. Reprinted with permission from J. Chromatogr, 602, 241 (1992), copyright © 1992 Elsevier Science Publishers. 1. Control of the Electroosmotic Flow The direct of migration of cations and anions is illustrated in Figure 3.18. For cations, the electrophoretic mobility and the EOF are both directed toward the cathode. Regardless of the mobility of the small cation, the direction of migra- tion does not change (Figure 3.18, top). The case is different for anions. Highly mobile anions such as chloride or sulfate will migrate toward the anode despite the strong EOF (Figure 3.18, middle). Less mobile anions such as hexane sul- fonate are swept toward the cathode by the EOF To determine all anions in a single run, the EOF must be reversed (Figure 3.18, bottom) with a cationic sur- factant such as cetyltrimethylammonium hydroxide or a protonated polyamine such as diethylenetriamine (DETA). Once the EOF is directed toward the anode, all anions migrate in that direction. The type of cationic surfactant and even mixtures of surfactants can be used to modify the selectivity of anion separa- tions (150).
    • 3.6 Applications and Techniques 103 Table 3.6 Buffer recipes for indirect detection Analyte Electrolyte Reference Anions Amino acids Carbohydrates Creatinine Lanthanides Metal cations Organic acids Pentosane Phosphates, polyphosphates Phosphonic acids, alkyl Phospholipids Phytate Potassium as drug counterion Short chain fatty acids Sodium dodecyl sulfate Sulfates, alkyl 5 mM chromate, 0.01 mM TTAB 5 mM chromate, 0.2 mM TTAB, pH 8.2 20 mM p-aminobenzoate, 0.07 mM TTAH, pH 9.6 2.25 mM pyromellitic acid, 6.5 mM NaOH, 0.75 mM hexamethonium hydroxide, 1.6 mM triethanolamine, pH 7.7 10 mM p-amino salicyclic acid, 0.05 mM CTAB, pH 11 10 mM p-amino salicyclic acid, 20 mM a-CD, pH 11 6 mM sorbate, pH 12.2 63 mM sodium hydroxide, 12 mM riboflavin 5 mM pyridine, 3.6 mM tartaric acid, 2 mM 18C6, pH 4 10 mM creatinine-acetate, pH 4, 2 mM HIBA 8 mM nicotinamide, pH 3.2, 12% MeOH, 0.95mM 18C6 5 mM imidazole, 6.75 mM HIBA, pH 4 5 mM pyridine, 3.6 mM tartaric acid, 2 mM 18C6, pH 4 10 mM methylbenzylamine, 15 mM lactate, pH 4.3 5 mM benzimidazole, tartaric acid, pH 5.2, 0.1%HEC,40mM18C6 10 mM p-aminopyridine, acetic acid, pH 4.5, 5 mM 18C6 or 10 mM HIBA 8 mM 4-methylbenzylamine, 15 mM lactate, 5% methanol, pH 4.25 5 mM phthalate, 0.25 mM CTAB, pH 7 8.7 mM benzene-1,2,4-trocarboxylate, pH 4.9 5 mM ATP, 0.02 mM CTAB, pH 3.6 5 mM phthalate, 0.5 mM DTAB, pH 4.2 10 mM phenylphosphonic acid, 200 mM borate, pH 6 5 mM AMP, 100 mM boric acid, 10% water, 80% methanol, 10% acetonitrile 50 mM benzoate to pH 6.2 with L-His, coated capillary 6 mM imidazole, 4 mM formic acid 80 mM Tris, 10 mM benzoic acid 5 mM dihydroxybenzoic acid, 5% methanol, pH 8.1 12 mM 5,5-diethylbarbituric acid, pH 8.6 151 152 153 154 155 156 157 158 159 160 161 162 159 163 164 165 161 166 167 168 169 170 171 172 173 174 175 176
    • 104 Chapter 3 Capillary Zone Electrophoresis C6SO3 CI EOF ++++++++^•++•l"»•+++•••++++++^.^.++++^'+++•|.+++++-»•+++•f+++++++++++•»• EOF"+++++++++++++-i-+++-i-+++++++++++++++-i-++++++++++++++++++'f+++ FIGURE 3.18 Illustration of the direction of migration of small ions for a bare silica capillary and a charge-reversed capillary Top and middle: bare silica; bottom: charge-reversed capillary 2. Indirect Detection The principle of indirect detection is illustrated in Figure 3.19. A UV-absorbing reagent of the same charge (a co-ion) as the solutes serves as an additive to the BGE. This reagent elevates the baseline. When solute ions are present, they dis- place the additive as required by principle of electroneutrahty As the separated ions migrate past the detector window, they are measured as negative peaks rel- ative to the high baseline. The criterion for selection of the indirect reagent is as follows: 1. The molar absorptivity of the reagent should be maximized. This means selecting a reagent with a high molar absorptivity and monitoring at the wavelength of maximum absorbance. Selection of a wavelength where the solute does not absorb is equally important. If for some reason a reagent with a modest molar absorptivity must be used, then extended path length capillaries may prove useful (176). 2. The reagent must be ionized at the appropriate pH. Both the reagent and solute must be ionized in order for displacement to occur. 3. The mobility of the reagent should match that of the solutes as closely as possible. Since the reagent concentration must be kept low for sensi-
    • 3.6 Applications and Techniques 105 JNDIRECT ABSORPTION DARK BUFFER ZONE BRIGHT SAMPLE ZONE DARK BUFFER ZONE ABS V / / / / / / / / TIME FIGURE 3.19 The principle of indirect absorption detection. tivity, the problem of electrodispersion is likely to appear. This problem is especially severe since small ions with large diffusion coefficients are being separated. The diagram given in Figure 3.20 permits intelligent |S203^- ' 1 804^^] LSL B J 1 4 NoT) r j i.., L',„„._, J, Solutes HCO3- j acetate* u. 1 botyrak'" 1 i|propkmate''| ..1 : 1 etham sulfonate* ] |bmanestitfo.nate'J 1 [propane sulfonati;' | 1 1 S 1 pentane soifonate' i 1 EELATIVE i Cr042- (5.5.103) i t 1 pyrom«lHtate^-' 1 q.t^io^) J t j trimdUtate-^- j (7.1.103) t1 phthalate^- (1.4103) benzoate- (0.8,103) 2000 MIGRATION k kk 'k TIMES Probes p-phcnolsulfonatc- <0.8.103) p-toluenesulfonate" (0.3.103) ip-hydrasybtiijtoatr |(I0.0,103) FIGURE 3.20 Selection of the indirect reagent based on mobility matching. The relative migra- tion times (chromate = 1) of indirect reagents and solutes (anions) at pH 8 are shown. The num- bers in brackets are the molar absorptivities at 254 nm. Reprinted with permission from Trends Anal. Chem., 13, 313 (1994), copyright © 1994 Elsevier Science Publishers.
    • 106 Chapter 3 Capillary Zone Electrophoresis Table 3.7 Selection of the Indirect Reagent Anionic Reagents Chromate^ Phthalate*' p-Hydroxybenzoate'^ Naphthalene sulfonate^ Pyromellatic acid"^ Cationic Reagents Creatinine Imidazole Ephedrine I -Naphthylamine Molar Absorbtivity - 13,000 - - 7,800 Molar Absorbti 9,200 5,000^ 7,000^ 50,000^ ivity Mobility High Medium Low Low High Mobility (cm^/kV- s) .38 .44 .25 .12 PK - - - - 5.6^ PK, - 6.9 9.9 3.9 Reference 41 13,41 41 42 11 Reference 19 26 26 26 ^Use for common inorganic ions, e.g., chloride. ^Use for carboxylic acids. '^Use for alkyl sulfates or sulfonates. '^At low pH, this material serves as a low-mobility reagent. "Highest ipK^. ^At 214 nm. selection of the indirect reagent (177). For example, the highly mobile ions such as chloride, sulfate, nitrate, and mitrite are best detected with either high-mobility chromate or pyromellitate. Organic acids are best detected with either phthalate or benzoate, whereas alkyl sulfonates are best detected with p-toluenesulfonate or even low-mobility naphthalene sulfonate (178). The figures of merit for some indirect reagents are included in Table 3.7. Normally, no co-ions other than the indirect reagent are present in the BGE; otherwise, sensitivity may be compromised, since displacement of the nonab- sorbing buffer competes with displacement of the indirect reagent. In the sep- aration of alkyl phosphonic acids, 200 mM boric acid is included in the BGE along with the indirect reagent, 10 mM phenylphosphonate. Boric acid is neu- tral at that pH, and so it does not interfere with detection. The reagent is likely used for secondary equilibrium via complexation with the —OH groups attached to the phosphorus. The sensitivity of indirect detection is given by (179)
    • 3.6 Applications and Techniques 107 CLOD = ^ , (3.7) (DR)(TR) where the CLOD is the concentration hmit of detection, CR is the concentration of the reagent, DR is the dynamic reserve, and TR is the transfer ratio. Thus, the lowest CLOD occurs when the reagent concentration is minimal. Ma and Zhang (180) calculated a theoretical CLOD of 2 x 10~^ M for indirect detection using the following equation: CLOD = ABGE£BGE'^(DR)(TR), (3.8) Here b is the capillary path length (5 x 10"^ cm), ABGE is the noise of the sys- tem (5 X 10-4 AU), £BGE is the molar absorptivity of the reagent (10,000 IVmolcm), the dynamic reserve is 10,000, and the transfer ratio is 1. It becomes possible for the limit of detection of indirect detection to exceed direct detec- tion, at least theoretically, under optimal conditions. The dynamic reserve is the ratio of the absorbance of the reagent to the noise of the system. The transfer ratio is related to the ratio of the charge on the solute relative to the reagent. For example, chloride should displace a single benzoate ion, but a transfer ratio of only 0.184 has been reported (177). Benzoate is not a good choice for measuring chloride. The best or most sensitive indirect reagents are indicated by the product of the transfer ratio and the molar absorp- tivity (177). In this regard, chromate, pyromellitate, and trimellitate are the best choices for small anions. Reagent kits for anions and cations are available from Waters and Hewlett- Packard. These kits are convenient, particularly for scientists new to these tech- niques. Manufacturers' protocols and support are available with these kits. 3. Secondary Equilibrium The ionic equivalent conductance (lEC) is useful for predicting separation, since this parameter correlates with mobility (181, 182). As seen in Figure 3.21, ions such as lithium, sodium, and potassium are easily separated. Other metal ions, including transition metals and lanthanides, may have similar lECs, so that com- plexing reagents are required. Since indirect detection is required, the complex- ing reagent must be anionic to avoid interference. Reagents such as a-hydroxyisobutyric acid (HIBA) (181), citrate (181), lactate (183), glycolate (162), and tartaric acid (159) have been used. Lin et a. (184), reported on 10 different complexing reagents and found the optimal pH was equal to the ^K^ of the complexing acid. Lactate, succinate, hydroxyisobutyrate, and malonate gave the best performance. Shi and Fritz (161) separated 27 metal cations using 15 mM lactate and 8 mM 4-methylben2ylamine,
    • 108 Chapter 3 Capillary Zone Electrophoresis Equivalent Ionic Conductance 3 4 4 5 6 7 8 9 10 11 Metals Placed in Ascending EIC FIGURE 3.21 Plot of the equivalent ionic conductance for the alkah metals, alkaU earth metals, transition metals, and lanthanides. Data from reference (181). 5% methanol in 6 min. Crown ethers can be employed as well in cation separa- tions (185-189). Resolution of potassium/ammonia and calcium/strontium is readily accomplished with 18-crown-6. Methanol can also be used to lower the EOF to improve resolution (183). Lowering the pH for cation separations is also effective in lowering the EOF to improve resolution. A number of these features are employed in the separation of some metal ions, as shown in Figure 3.22. In this case, Cu^"^ is used as the indirect reagent. The mobility of Cu^^^ better matches the mobility of the later eluters such as magnesium, strontium, lithium, and bar- ium, as evidenced by the symmetrical peaks. Most anions have sufficiently differing lECs so that separations are possible without special additives. The EOF, along with the resolution, can be adjusted by altering the concentration and type of added cationic surfactant. Increasing the indirect reagent concentration tends to improve resolution at the expense of sensitivity A typical anion standard mixture is shown in Figure 3.23. In this case, the indirect reagent is chromate. The mobility of chromate better matches the mobility of the more mobile anions, as shown by the symmetrical peaks. Elec- trodispersion is a normal effect in electrophoresis. Quantitative results are still maintained as long as peak areas are used and sufficient resolution is designed into the separation.
    • 3.6 Applications and Techniques 109 2 3 Minutes FIGURE 3.22 Separation of cations using Cu^"^ as the indirect reagent. Capillary: 50 cm x 50 lam i.d.; BGE: 4.0 mM copper sulfate, 4.0 mM formic acid, 4.0 mM 18-crown-6; injection: gravity, 10 cm for 10 s; voltage: 20 kV; detection: indirect UV, 215 nm. Key: (1) ammonium, 3.6 ppm; (2) potas- sium, 7.8 ppm; (3) sodium, 4.6 ppm; (4) calcium, 4.0 ppm; (5) magnesium, 2.4 ppm; (6) strontium, 15 ppm; (7) lithium, 0.69 ppm; (8) barium, 27 ppm. Courtesy of Dionix Corporation. 4. Stacking Stacking will be covered in detail in Section 8.6. To optimize sensitivity, stacking coupled with electrokinetic injection may be required. The advantages and pitfalls of electrokinetic injection will be covered in Section 8.3. In Figure 3.24, sub-ppm limits of detection are obtained by the use of a 45-s electrokinetic injection at 5 kV This technique works only when the ionic strength of the sample is very low An advanced technique called transient isotachophoresis, covered in Section 8.6, can be used to further lower the limit of detection (190). In this case, 7 mM chromate, 0.5 mM TTAB, and 1 mM monosodium carbonate was employed as the BGE. The difference in this protocol is the addition of octane sulfonate to the sample to serve as the terminating electrolyte. Under the correct conditions
    • no Chapter 3 Capillary Zone Electrophoresis mV 3.0 2.8-j 2.6-] 2.4 H 2.2 i 2.0 1.8 1.6 j 1.4-1 1.2 1.0-1 0.8-j 0.6 i 3.00 3.50 4.00 4.50 Minutes 5.00 5.50 FIGURE 3.23 Separation of anions using chromate as the indirect reagent. Capillary: 60 cm X 75 |Lim i.d.; BGE: 4 mM chromate with 0.3 mM OFM Anion BT; voltage: -15 kV; injection: gravity, 10 cm for 30 s; detection: indirect UV, 254 nm. Key: (1) bromide, 4 ppm; (2) chloride, 2 ppm; (3) sulfate, 4 ppm; (4) nitrite, 4 ppm; (5) nitrate, 5 ppm; (6) fluoride, 1 ppm; (7) phos- phate, 4 ppm. Courtesy of Waters Chromatography. and when the sample is sandwiched between a leading electrolyte and a termi- nator, a 500-1000 fold trace enrichment can occur. An extended path length capillary (bubble factor 3)^ was shown useful here as well. 5. Direct Detection of Small Ions A number of ions absorb in the UV region and thus are appropriate for direct injection (129, 191-196). Because of their importance in biological and envi- ronmental samples, nitrate and nitrite are the subject of most of these references. Phosphate buffer, pH 3 with detection at 214 nm is a typical operating condi- tion. A coated capillary or charge-reversing cationic surfactant is usually nec- essary for high-speed separations. An MECC (Chapter 4) separation of bromide, bromate, iodide, iodate, nitrate, and nitrite using DTAB as the surfactant is note- worthy (197). Using an extended path length capillary, a ninefold improvement ^Hewlett-Packard. See Section 9.6 for details.
    • 3.6 Applications and Techniques -1.0- 111 mAU 3 4 i W^MS/V«*^ 2 Minutes FIGURE 3.24 Separation of trace anions in power plant boiler water using a stacking electroki- netic injection. Capillary: 50 cm x 50 /im i.d.; BGE: 2.25 mM pyromellatic acid, 6.5 mM NaOH, 1.6 mM triethanolamine, 0.75 mM hexamethonium hydroxide; injection: 5 kV for 45 s; voltage: 30 kV; detection: indirect UV, 250 nm. Key: (1) chloride, 15.8 ppb; (2) sulfate, 11 ppb; (3) nitrite, 1.7 ppb; (4) azide; (5) fluoride, 13.3 ppb; (6) formate. Courtesy of Dionix Corporation. in sensitivity was observed. Molybdate(VI), vanadate(V), and chromate(VI) could be detected at 254 nm in a 0.15 mM CTAB charge-reversed capillary using 6 mM phosphate, 2 mM citrate with detection at 254 nm (198). Metal complexes formed either precapillary or on-capillary can be detected directly (199-204). Separations are by CZE or MECC. Typical reagents include 4-(pyridylazo)resorcinol (PAR) (205), and CLODs of 10-^ to lO'^M have been reported. Other reagents such as 8-hydroxyquinoline-5-sulfonic acid (206), 1,2- cyclohexanediamine-N,N,N',N'-tetraacetic acid (CyDTA) (207), and EDTA (208) have also been reported. 6. Indirect Fluorescence Detection Indirect fluorescence detection (209-212) is less frequently used than indirect absorption detection, since few commercial instruments have that capability High-sensitivity analyses are possible in this mode, because it is possible to reduce the concentration of the indirect reagent to very low levels and thus decrease the CLOD predicted by Eq. (3.7). Using 100-|im fluorescein, a mass limit of detec- tion of 20 aM was reported for lactate and pyruvate in single red blood cells (212). Fluorescein is a good additive because is absorbs at 488 nm, the emission wave- length of the argon-ion laser. Electrodispersion is unimportant here since the
    • 112 Chapter 3 Capillary Zone Electrophoresis solute concentration is so low. At higher solute concentrations, the system will be less useful because of electrodispersion. Of course, the concentration of the indirect reagent could be increased, but then indirect absorption detection becomes applicable. 7. Conductivity Detection The first reports of conductivity detection for HPCE appeared in the literature in 1987 (213). Seven years later, the first commercial conductivity detector became available.^ A capillary with a fiber-optic type connector and an outlet capillary with the detection sensors are connected to the detection cell assem- bly. A narrow 24-|Lim spacing is maintained between the two capillaries to min- imize band broadening and provide consistent capillary-to-capillary results. This design isolates the cell from the high-voltage circuit (214). A conductivity detector measures the differences in conductivity between the BGE and each solute. Since high-mobility ions have high conductivity, the use of a low-conductivity BGE provides for sensitive measurements. A typical low- conductivity electrolyte for anions is 50 mM CHES, 20 mM lithium hydroxide, and 0.03% Triton X-100. The charge on the capillary wall is reversed by flush- ing the capillary with 1 mM CTAB prior to each analysis in order to reverse the EOE The CTAB is often left absent from the BGE to minimize its conductivity. For cations, the BGE is 30 mM histidine, 30 mM MES, and 1 mM 18-crown-6. The limits of detection for the early eluting, high-mobility solutes are 10 times lower than for indirect detection. For later eluting ions the advantages begin to disappear. This is illustrated in Figure 3.25, where the later eluting ions have a lower response despite solute concentrations that are 5 to 10 times as high as the high-mobility ions. For high-mobility ions, in conjunction with tlTP, sub-ppb limits of detection have been reported (215). For the determination of low-mobility ions such as alkyl sulfonates or qua- ternary amines, indirect conductivity is employed to maximize sensitivity (216). In this example, a high-conductivity electrolyte containing 30 mM sodium flu- oride and 1 mM triethanolamine is used. Though both cationic and anionic sur- factants could be measured in a single run, the LODs were not as good as with indirect detection. To improve the LOD, a higher conductivity BGE would be required, but heating problems would quickly ensue. B. PEPTIDE MAPPING Tryptic digests are often employed to determine if changes to a complex pro- tein, such as posttranslational modifications, have occurred. There are many ^Crystal 1000 CE conductivity detector, ATI Unicam (now Thermoquest), Santa Fe, NM.
    • 3.6 Applications and Techniques 113 7.0 Minutes 9.0 11.0 FIGURE 3.25 Separation of anions with conductivity detection. Capillary: 60 cm x 50 |Lim i.d. (ConCap, ThermoQuest); BGE: 50 mM Ches, 20 mM lithium hydroxide, 0.03% Triton X-100; injec- tion: 300 mbs. The capillary is preconditioned with 1 mM CTAB prior to each run. Reprinted with permission from Amer Lah., 28, 25 (1996), copyright © 1996 Int. Sci. Commun. examples using this technique in the hterature. A series of electrolyte recipes is given in Table 3.8. Capillary zone electrophoresis is complementary to HPLC for peptide map- ping studies (21, 223). Microheterogeneity not detected by HPLC can be resolved by CZE, even for glycoprotein fragments (224). Tryptic digests are usually run by gradient elution reverse-phase liquid chromatography (Figure 3.26a). Run times of several hours are commonplace. By CZE, a run can be completed in 12 min (Figure 3.26b) with modest resolution (225). Lengthening the run time to 60 min further improves the resolution (data not shown). Speed is again the com- pelling advantage. This feature is conducive to screening large numbers of sam- ples searching for variants, decomposition products, or posttranslational modifications. The CZE mechanism of separation bears no relationship to that of reversed-phase LC. A scatter plot comparing LC retention time with CZE migration time (not shown) for the individual peaks in Figures 3.26a and b yields a random distribution. CZE has some significant disadvantages compared with HPLC for tryptic mapping: 1. The overall peak capacity of CZE can be lower than gradient elution LC. 2. The difficulty of fraction collection (Section 9.10) means that peak iden- tification through protein sequencing can be a problem. 3. The reproducibility of CZE is not as robust as gradient elution LC.
    • 1 1 4 Chapter 3 Capillary Zone Electrophoresis Table 3.8 Buffer Recipes for Peptide Mapping Analyte Anti-Rh(D) monoclonal antibody Cytochrome c Erythropoietin Globin, from hemoglobin Human growth hormone j3-Lactoglobulin Peptides Porcine pro-growth hormone releasing hormone Electrolyte 30 mM phosphate, pH 2.5 25 mM citrate, pH 4 40 mM phosphate, pH 2.5, 100 mM heptanesulfonic acid 80 mM phosphate, pH 2.5 100 mM tricine, 30 mM morpholine 5% formic acid, 0.02% Tween 20 100 mM hexane sulfonate, 30 mM phosphate, pH 2.5 100 mM phosphate, pH 3.3 Reference 217 218 219 220 21 221 148 222 Nielsen and Rickard (21) reported an empirical method for optimizing a complex separation of human growth hormone (hGH) tryptic digest frag- ments. This complex sample contains fragments ranging in size from 1 to 32 amino acid residues. Fragments 6-16 and 20-21 consist of two chains con- nected by a disulfide bond. Fragments 1 and 3 are basic peptides likely to exhibit wall interactions. Both hydrophobic peptides (fragments 4, 6-16, 9, and 10) and hydrophilic peptides (fragments 3, 5, 7, 14, and 17) are present in the sample. First, it is necessary to ensure adequate buffer ionic strength. Separations in 10 and 100 mM Tricine, pH 8.1, are shown in Figure 3.27. Since pH 8.1 is close to the pi of Tricine, the higher buffer concentration did not draw a very high current. The impact of buffer concentration is substantial due to loading effects, reduction of wall effects, and reduction of the EOF Adding sodium chloride to further increase the ionic strength was not useful. Four different buffer pH values (2.4, 6.1, 8.1, and 10.4) were initially stud- ied. The best separations were found at pH 2.4 (data not shown) and 8.1, though in both cases a number of fragments were found to overlap. The separation at pH 8.1 was 2.5 as time fast as that at pH 2.4, and so the higher pH was consid- ered a better choice. Addition of an amine modifier—in this case, morpholine—further improved the resolution (Figure 3.28, p.118), presumably by reducing wall interactions between the peptide fragments and free silanol groups. Before a separation can be fine-tuned, freedom from wall effects and suffi- cient buffer capacity are prerequisites. It makes little sense to proceed without these features accounted for. The insufficient resolution at the beginning of the separation calls for more experimental work. Perhaps with the addition of
    • 3.6 Applications and Techniques 115 9S2.659 0.000 SO' 100 Time (mln) FIGURE 3.26A Reversed-phase HPLC of peptide fragments of a tryptic digest of rhGH. Tryptic fragments are numbered sequentially from the N terminus of the protein and the suffix "c" indi- cates a peptide fragment resulting from a chymotrypsin-like cleavage. Column: 150 x 4.6 mm i.d. Nucleosil Cis; temperature: 35°C; Mobile phase: A = 0.1% TFA in water; B = 100% acetonitrile; gradient: 100% A, hold 5 min, linear ramp to 37% B over 120 min, linear ramp to 57% B over 10 min; flow rate: 1 mlVmin; detection: UV, 214 nm; injection size: 200 /iL. Reprinted with permis- sion from J. Chromatogr., 480, 379 (1989), copyright ©1989 Elsevier Science Publishers. cyclodextrins, surfactants, metal ions, or sulfonic acids, complete resolution in a single run may possible. It should be noted that no single set of conditions resolved all of the tryptic fragments. The same was true for gradient elution LC, even with a 2-h gradient run. At pH 2.4, overlapping fragments 1, 13, 14, and 17 are all resolved.
    • 116 Chapter 3 Capillary Zone Electrophoresis M I- 9.172 6' "S' 10^ Time (min) 12 FIGURE 3.26B CZE of peptide fragments of a tryptic digest of rhGH. Capillary: polyacrylamide- coated fused silica, 20 cm x 25 ^im i.d.; buffer: phosphate buffer, pH 2.5; injection: 5 s at 8 kV; detection: UV 200 nm. Peaks were identified by injection individual fractions from the HPLC sep- aration. Reprinted with permission from J. Chromatogr., 480, 379 (1989), copyright © 1989 Else- vier Science Publishers. C. HIGH-PERCENTAGE ORGANIC AND NONAQUEOUS ELECTROPHORESIS Electrophoresis is a process primarily designed for the separation of water-sol- uble biomolecules. The aqueous systems used in HPCE are advantageous par- ticularly with regard to toxicity and safety Water is not the only solvent that can be used in electrophoresis. Nonaqueous systems may be considered when
    • 3.6 Applications and Techniques 117 I < Mj 100 150 200 250 300 350 400 4S0 500 550 600 Time (s) 300 350 400 450 500 550 Time (s) 600 650 700 750 800 FIGURE 3.27 CZE of hGH tryptic digest in pH 8.1 tricine buffer. (A) 10 mM and (B) 100 mM. Capillary: 100 cm (80 cm to detector) X 50 jXm i.d.; voltage: 30 kV; temperature: 30°C; detec- tion: UV, 200 nm; injection: 3 s vacuum (10 nL); sample concentration: 90 mM for each fragment (2 mg/mL). Reprinted with permission from J. Chromatogr., 516, 99 (1990), copyright © 1990 Elsevier Science Publishers. 1. The solute is insoluble in water or surfactant-containing solutions, or it forms aggregates. 2. Mass spectroscopy is used, since surfactant-containing electrolytes can be avoided and advantage can be taken of the more efficient nebuliza- tion of organic solvents due to their low surface tension and volatility.
    • 118 Chapter 3 Capillary Zone Electrophoresis 8 o < — I — 725 — I — 775 — I — 825 — I 875375 425 475 525 575 625 Time (s) — I — 675 FIGURE 3.28 CZE of hGH tryptic digest in pH 8.1 Tricine with 30 mM morpholine. Other con- ditions as per Figure 3.27. The peaks marked with a * are degradation products. Reprinted with permission from J. Chromatogr, 516, 99 (1990), copyright © 1990 Elsevier Science Publishers. 3. Micropreparative separations are performed, since the low conductivity of the organic solvent permits wide-bore capillaries to be used without experiencing heating problems. For example, a BGE consisting of ethanol: acetonitrile: acetic acid (49:50:1) with 20 mM ammonium acetate allows 200-|lm-i.d. capillaries to be used (226). The loading capacity is 16 times as great as with a 50-|Lim-i.d. capillary. The characteristics of a good nonaqueous solvent include the ability to dis- solve salts (for some conductivity), water solubility (since samples may contain some water), and little absorbance in the UV region of the spectrum (so detec- tion is not limited). While solvents such as formamide may be optimal with regard to electrophoresis, problems with UV absorption and hydrolysis (227) preclude that material from general use. The physical properties of some poten- tial solvents are given in Table 3.9. An expression for mobility is Mep 2£C 377 (3.9) where e is the dielectric constant, ^ is the zeta potential, and rj is the viscosity. For a given ion, the highest speed separations can occur when e/^ is greatest (228). This points to solvents such as N-methylformamide and acetonitrile.
    • 3.6 Applications and Techniques 119 Table 3,9 Characteristics of Solvents for Nonaqueous Electrophoresis Solvent Water Formamide N-Methylformamide N,N-Dimethylacetamide Acetonitrile Acetic acid Methanol bp (°C) 100 210 182 166 82 118 65 Viscosity (cp) 0.89 3.3 1.65 0.78 0.34 1.1 0.54 Polarity 10.2 9.6 6.0 6.5 5.8 6.0 5.1 Dielectric 80 111 182 37.8 37.5 6.2 32.7 £lr 89.9 33.6 110.3 48.5 110.3 60.6 Data are from reference (227), except e/r values, which are from (228). Since acetonitrile does not absorb in the low UV, it is a solvent worth trying when nonaqueous solvents are called for. N-Methylformamide also has a high e/C, ratio, but the solvent absorbs strongly in the low UV. Table 3.10 lists some applications that use either a high percentage of organic solvents or totally nonaqueous systems. It becomes easy to question why organic solvents are needed for some of these separations, in particular small inorganic ions such as chloride, nitrate, or fluoride. However, it may become necessary to measure the species in materials such as fuels, solvents, and lubricating oils (229). It has also been reported that the selectivity of sep- arations may be altered by nonaqueous solvents, but the effects cannot be predicted in advance (230). D. CARBOHYDRATES Carbohydrate separations fall into several broad categories, including simple sugars, oligosaccharides, and polysaccharides. Glycoproteins may be separated as intact molecules, or the sugars may be released prior to separation. Complex carbohydrates such as glycosoaminoglycans (GAGs) are usually broken down with enzymes to disaccharides prior to separation. The analytical problems to be solved involve both separation and detection. Carbohydrates absorb poorly in the UV, and so indirect detection and derivatization are important techniques. It is useful to determine if more complex detection schemes are required, since high sensitivity may not be an issue for many applications. Buffer recipes for a variety of carbohydrate samples and detection techniques are given in Table 3.11. Note that several applications employ MECC as the mode of separation. A primer on carbohydrate separations by HPCE (243), a detailed review (244), and a volume of the journal Electrophoresis devoted this subject (245) have appeared since 1994.
    • 120Chapter3CapillaryZoneElectrophoresis rNfNfSfN(N(N(N(N(NrN(N(N<N(N(N(N Q U [IS X <v u 2 o ^M 5 o c« aJ C o o o 3 C H >-i o G. O a,o U »0n•r"^n W ^ TS C 3S -^3 s ^ 2 o^ £-5 9-^-3-^-^ -13 ^6S .-Hin^ ^>> 2 ^Xi (0 B o D- S B o o 1"o </) o a 2 B oin .y§ SS SS ooino X fN c«S w'2 ii 6I 2'>>222 SS n4I—•,—((N(N OS 2 in S 2 oin S 2 o(N S 2in rs S 2in fN S 2 oX o I—I rn 32 3 -^3 <u OJO 3 QQ 00 ^3 g3^^ 22 E5SZ TS 3 ^3 o
    • 3.6 Applications and Techniques 121 Simple sugars can be separated in complexing borate electrolytes with direct detection at 195 nm. In the absence of borate, the molar absorptivities are too low to be useful. A 50 mM borate BGE in a bare silica capillary maintained at 60°C provides the best results (145). The limits of detection (LOD) are esti- mated to be around 0.5 mM, which is not very sensitive. Carbohydrates with an unsaturated uronic acid residue absorb more strongly at 232 nm (244). In the absence of borate, high pH is required to partially ionize the sugars, since the pK^ of most simple sugars is between 12 and 13. An exception is found for sulfated disaccharides, which can be separated under acidic conditions (244). Other complexation chemistries can be employed to improve detection. For GAGs such as heparin, the addition of 5 mM Cu(II) to the BGE (20 mM phos- phate, pH 3.5, 240 nm detection) dramatically improves the detection of the extremely microheterogeneous intact heparin molecules (246). Large polysac- charides such as starches are easily detected at 560 nm as the starch-iodine com- plex (247). Indirect detection can yield superior sensitivity compared with direct detection. At very high pH, the predominance of hydroxide obscures indirect detection (248). At pH 12.2, the optimal compromise is found. An LOD of 50 |LlM was reported (158) using 25-|Lim-i.d. capillaries with 12 mM riboflavin as the indirect reagent and 63 mM lithium hydroxide to adjust pH. The nar- row-bore capillary was required to overcome the heating effects from the high-pH electrolyte. A separation is shown in Figure 3.29. Indirect fluores- cence detection (249, 250) using lasers further lowers the LOD, since the concentration of the indirect reagent can be kept very low. Derivatization techniques improve detection by the addition of a good chro- mophore or fluorophore. This is particularly important when determining the carbohydrate profiles of glycoproteins. Simultaneously, electrophoresis can be improved as well, since negative charges can accompany the derivatizing reagent. Figure 3.30 compares the separation of a dextran standard with three different derivatizing reagents: 2-aminopyridine, 5-aminonaphthalene-2-sul- fonate, and 8-aminonaphthalene-l,3,6-trisulfonate, otherwise known as ANTS (251). The highly mobile ANTS derivatives are advantageous from the stand- point of short analysis time and reduction or elimination of wall effects. Aminopyridine is neutral at the separation pH, whereas the monosulfonate naphthalene derivative contains only one negative charge. Another reagent, 8- aminopyrene-l,3,6-trisulfonate (APTS) proved simpler to use, since the deriv- ative absorbed at the wavelength of the argon-ion laser. In addition, the molar absorptivity and fluorescence quantum yield of the reagent was superior to that of ANTS (252). A helium-cadmium laser was required for excitation of ANTS, and that laser is not part of a commercial system. For those with a UV detector, 4-aminobenzoic acid ethyl ester reacts with many sugars (253). Separations are performed with 200 mM boric acid titrated
    • 122Chapter3CapillaryZoneElectrophoresis U ^ pa s2< ^1—linoinooorNr^h-oooNO-—ic^(Nm (N(NfNfN1—If—ifS(N(Nr-i(N(N(NfN(NfN(N fcJ o orvj >' D sc(N o" o (N >' P in a^ •—' ecr-- b •^ £ S ^ £ S c o ^fN >' D scvO in u >-< ^ ^ U 00 S o^o Oin Or9 B oI—I X SS Xa II 8a P3 to es in.—I>—Ir-H(N u aPQ u J.H 2 < (/5 <u 3"C c« (/5 <u -Td •crs CJ C3 u CT5 C/) CTJ )-l aj i-> T^ C -T;-^-7^ <QOE -fi-f,^ SS o 5l oo K D. B o O O u^ O ^y^ S B u '2 i§ 3CO ^ aTS^ 1SS oSS ininI—I ON X ^ S o o T!-^ D. (N 2 c/~ <u 3'C u ]3 _c ;/"<u 3'C g 4J c/~ <u -TS •c uS H < c/f <u 3"C OPH TO OS i'^ r^ 'o PH O Of) O _o 'st7^ o _bjD o o '2Co fN
    • 3.6 Applications and Techniques 123 WMI*M»*'iiiy[|^^ii^»***%m)^ FIGURE 3.29 Indirect detection of sugars. Capillary: 78 cm x 25 |im i.d.; BGE: 12 mM riboflavin, 63 mM lithium hydroxide; injection: 10 s (ABI270A); voltage: 10 kV; detection: indirect Uy 267 nm; Key: 1 mM solutions of (1) sucrose; (2) maltose; (3) glucose; (4) fructose. Reprinted with permission from J. ChromatogK, A, 716, 231 (1995), copyright © 1995 Elsevier Science Publishers. to pH 10.5, with detection at 305 nm. The CLOD is an order of magnitude improved compared with that for indirect detection. E. SERUM PROTEINS Serum proteins are traditionally separated in the clinical lab by agarose-gel elec- trophoresis. The patterns obtained are diagnostic for various disease states. Use of an alkaline, high-ionic-strength buffer produces high-speed separations of impor- tant serum proteins in an untreated fused-silica capillary (108, 264). A 20 cm x 25 |im i.d. capillary is employed to reduce the heating effects of the high field strength in conjunction with 150 mM borate buffer,io pH 10. The separations (Figure 3.31, top) are reproducible and are similar to the agarose-gel patterns. The run time can be as short as 90 s. Increasing the buffer's ionic strength lowers the EOF and improves the resolution (Figure 3.31, bottom). Multicenter studies evaluating this buffer system on the commercial clinical analyzer have been reported (265, 266). i^The exact buffer composition was not disclosed.
    • 124 Chapter 3 Capillary Zone Electrophoresis -J%MM1^ iJi^W ^^w 100 iiV 2S}iV 10 SO flain FIGURE 330 Influence of the fluorescent tag on the separation of a dextran standard with an aver- age molecular weight of 18,300. The reagents used were (A) 2-aminopyridine, (B) 5-aminonaph- thalene-2-sulfonate, and (C) 8-aminonaphthalene-l,3,6-trisulfonate. Capillary: 35 cm x 50 jxm i.d. polyacrylamide-coated; BGE: 100 mM Tris-borate, pH 8.65; field strength: -500 V/cm; detection: LIF, He-Cd at 325 nm excitation, emission at 375 for A, 475 nm for B, and 514 nm for C. Reprinted with permission from Anal. Chem., 66, 1134 (1994), copyright €> 1994 Am. Chem. Soc.
    • 3.6 Applications and Techniques 125 60 70 time (seconds) 1 1 11 /'''^^l In / |9 1 1 1 ... ,..7^**~"'''^''i8^^ 150 2OT tjRic (seconds) FIGURE 3.31 CZE protein profile of a normal control serum. Capillary: 25 cm X 25 ^im i.d.; volt- age: 20 kV; (top) buffer: (proprietary, pH 10.0, probably 150 mM borate); (bottom) higher ionic strength, pH 10; temperature: 22°C; detection: UV, 200 nm. Key: (1) DMF; (2) /-globulin; (20 com- plements; (3) transferrin; (4) ^-lipoproteins; (5) haptoglobin; (6) a2-"^^croglobuhn; (7) Ofi-anti- trypsin; (8) ai-lipoproteins; (9) albumin; (10) prealbumin. Reprinted with permission from J. Chromatogr., 559, 445 (1991), copyright © 1991 Elsevier Science Publishers.
    • 126 Chapter 3 Capillary Zone Electrophoresis REFERENCES 1. Roberts, G. O., Rhodes, R H., Snyder, R. S. Dispersion Effects in Capillary Zone Elec- trophoresis. J. Chromatogr., 1989; 480:35. 2. Cleveland, J. A., Jr., Benko, M. H., Cluck, S. J., Walbroehl, Y. M. Automated pK^ Determina- tion at Low Solute Concentrations by Capillary Electrophoresis. J. Chromatogr, 1993; 652:301. 3. Cluck, S. J., Cleveland, J. A., Jr Capillary Zone Electrophoresis for the Determination of Dis- sociation Constants. J. Chromatogr, A, 1994; 680:43. 4. Compton, B. J., O'Grady E. A. Role of Charge Suppression and Ionic Strength in Free Zone Electrophoresis of Proteins. Anal. Chem., 1991; 63:2597. 5. Compton, B. J. Electrophoretic Mobility Modeling of Proteins in Free Zone Capillary Elec- trophoresis and Its Application to Monoclonal Antibody Microheterogeneity Analysis.J. Chro- matogr, 1991; 559:357. 6. Grossman, R, D., Colburn, J. C, Lauer, H. H. A Semiempirical Model for the Electrophoretic Mobilities of Peptides in Free-Solution Capillary Electrophoresis. Anal. Biochem., 1989; 179:28. 7. Deyl, Z., Rohlicek, V, Struzinsky R. Some Rules Apphcable to Capillary Zone Electrophore- sis of Peptides and Proteins. J. Liq. Chromatogr, 1989; 12/13:2515. 8. Deyl, Z., Rohlicek, V, Adam, M. Separation of Collagens by Capillary Zone Electrophoresis. J. Chromatogr, 1989; 480:371. 9. Rickard, E. C, Strohl, M. M., Nielsen, R. G. Correlation of Electrophoretic Mobilities from Capillary Electrophoresis with Physiochemical Properties of Proteins and Peptides. Anal. Biochem., 1991; 197:197. 10. Grossman, P. D., Colburn, J. C, Lauer, H. H., Nielsen, R. G., Riggin, R. M., Sittampalam, G. S., Rickard, E. C. Application of Free-Solution Capillary Electrophoresis to the Analytical Scale Separation of Peptides and Proteins. Anal. Chem., 1989; 61:1186. 11. Chen, M., Cassidy, R. M. Bonded-Phase Capillaries and the Separation of Inorganic Ions By High-Voltage Capillary Electrophoresis. J. Chromatogr, 1992; 602:227. 12. Karger, B. L., Snyder, L. R., Horvath, C. An Introduction to Separation Science. 1973, Wiley: 586. 13. Ermakov, S. V, Zhukov, M. Y., Capelli, L., Righetti, R G. Wall Adsorption in Capillary Elec- trophoresis. Experimental Study and Computer Simulation.J. Chromatogr, A, 1995; 669:297. 14. Gas, B., Stedry, M., Rizzi, A., Kenndler, E. Dynamics of Peak Dispersion in Capillary Zone Electrophoresis Including Wall Adsorption I. Theoretical Model and Results of Simulation. Electrophoresis, 1995; 16:958. 15. Towns, J. K., Regnier, F E. Impact of Polycation Adsorption on Efficiency and Electroosmot- ically Driven Transport in Capillary Electrophoresis. Anal. Chem., 1992; 64:2473. 16. Jorgenson, J. W, Lukacs, K. D. Capillary Zone Electrophoresis. Science, 1983; 222:266. 17. Lauer, H. H., McManigill, D. Capillary Zone Electrophoresis of Proteins in Untreated Fused Silica Tubing. Anal. Chem., 1986; 58:166. 18. McCormick, R. M. Capillary Zone Electrophoretic Separation of Peptides and Proteins Using Low pH Buffers in Modified Silica Capillaries. Anal. Chem., 1988; 60:2322. 19. Green, J. S., Jorgenson, J. W Minimizing Adsorption of Proteins on Fused Silica in Capillary Zone Electrophoresis by the Addition of Alkah Metal Salts to the Buffers. J. Chromatogr, 1989; 478:63. 20. Bushey, M. M., Jorgenson, J. W Capillary Electrophoresis of Proteins in Buffers Containing High Concentrations of Zwitterionic Salts. J. Chromatogr, 1989; 480:301. 21. Nielsen, R. G., Rickard, E. C. Method Optimization in Capillary Zone Electrophoresis Analy- sis of hGH Tryptic Digest Fragments. J. Chromatogr, 1990; 516:99. 22. Dolan, J. W, Snyder, L. S., Troubleshooting LC Systems. 1989, Humana Press. 23. Landers, J. P, Oda, R. R, Madden, B. J., Spelsberg, T. C. High-Performance Capillary Elec- trophoresis of Glycoproteins: The Use of Modifiers of Electroosmotic Flow for Analysis of Microheterogeneity. Anal. Biochem., 1992; 205:115.
    • References 127 24. Stover, F. S., Haymore, B. L., McBeath, R. J. Capillary Zone Electrophoresis of Histidine-Con- taining Compounds. J. Chromatogr., 1989; 470:241. 25. Bullock, J. A., Yuan, L.-C. Free-Solution Capillary Electrophoresis of Basic Proteins in Uncoated Fused Silica Capillary Tubing. J. Microcolumn Sep., 1991; 3:241. 26. Hermentin, P., Doenges, R., Witzel, R., Hokke, C. H., Vliegenthart, J. F G., Kamerling, J. P, Conradt, H. S., Nimtz, M., Brazel, D. A Strategy for the Mapping of N-Glycans by High-Per- formance Capillary Electrophoresis. Anal. Biochem., 1994; 221:29. 27. Klausen, N. K., Kornfelt, T. Analysis of the Glycoforms of Human Recombinant Factor Vila by Capillary Electrophoresis and High-Performance Liquid Chromatography. J. Chromatogr., A, 1995; 718:195. 28. Watson, E., Yao, E Capillary Electrophoretic Separation of Human Recombinant Erythropoi- etin (r-HuEPO) Glycoforms. Anal. Biochem., 1993; 210:389. 29. Girard, M., Bielot, H. P, Cyr, T. D. Characterization of Human Serum Albumin Heterogene- ity by Capillary Zone Electrophoresis and Electrospray Mass Ionization Spectrometry. J. Chro- matogr, A, 1997; 772:235. 30. Oda, R. P, Landers, J. P Effect of Cationic Buffer Additives on the Capillary Electrophoretic Separation of Serum Transferrin from Different Species. Electrophoresis, 1996; 17:431. 31. Corradini, D., Cannarsa, G. N,N,N',N'-Tetramethyl-l,3-butanediamine as Effective Running Electrolyte Additive for Efficient Electrophoretic Separation of Basic Proteins in Bare Fused- Silica Capillaries. Electrophoresis, 1995; 16:630. 32. Wiktorowicz, J. E., Colbum, J. C. Separation of Cationic Proteins via Charge Reversal in Cap- illary Electrophoresis. Electrophoresis, 1990; 11:769. 33. Cunico, R. L., Gruhn, V, Kresin, L., Nitecki, D. E., Wiktorowicz, J. E. Characterization of Polyethylene Glycol Modified Proteins Using Charge-Reversed Capillary Electrophoresis. J. Chromatogr, 1991; 559:467. 34. Tsuji, K., Little, R. J. Charge-Reversed, Polymer-Coated Capillary Column for the Analysis of a Recombinant Chimeric Glycoprotein. J. Chromatogr, 1992; 594:317. 35. Emmer, A., Jansson, M., Roeraade, J. Improved Capillary Zone Electrophoretic Separation of Basic Proteins Using a Fluorosurfactant Buffer Additive. J. Chromatogr, 1991; 547:544. 36. Emmer, A., Jansson, M., Roeraade, J. A New Approach to Dynamic Deactivation in Capillary Zone Electrophoresis. HRC & CC, 1991; 14:738. 37. Emmer, A., Roeraade, J. Performance of Zwitterionic and Cationic Fluorosurfactants as Buffer Additives for Capillary Electrophoresis of Proteins. J. Liq. Chromatogr, 1994; 17:3831. 38. Kelly, J. E, Locke, S. J., Ramaley L., Thibault, P. Development of Electrophoretic Conditions for the Characterization of Protein Glycoforms by Capillary Electrophoresis-Electrospray Mass Spectrometry. J. Chromatogr, A, 1996; 720:409. 39. Thibault, P., Paris, C, Pleasance, S. Analysis of Peptides and Proteins by Capillary Elec- trophoresis/Mass Spectrometry Using Acidic Buffers and Coated Capillaries. Rapid Commun. Mass Spectrom., 1991; 5:484. 40. Werner, WE., Wiktorowicz, J. E., Kasarda, D. D. Wheat Varietal Identification by Capillary Electrophoresis. Am. Lab., 1994; 26:32. 41. Oda, R. P, Madden, B. J., Spelsberg, T. C, Landers, J. P a,0)-Bis-Quaternary Ammonium Alka- nes as Effective Buffer Additives for Enhanced Capillary Electrophoretic Separation of Gly- coproteins. J. Chromatogr, A, 1994; 680:85. 42. Hjerten, S. High-Performance Electrophoresis: Elimination of Electroendosmosis and Solute Adsorption. J. Chromatogr, 1985; 347:191. 43. Bayer, H., Engelhardt, H. Capillary Electrophoresis in Organic Polymer Capillaries. J. Micro- column Sep., 1996; 8:479. 44. Bedia, E. F, Cifuentes, A., Poppe, H., Kraak,J. C. Performance of a Physically Absorbed High- Molecular-Mass Polyethylenimine Layer as a Coating for the Separation of Basic Proteins and Peptides by Capillary Electrophoresis. J. Chromatogr, A, 1995; 708:356. 45. Bentrop, D., Kohr, J., Engelhardt, H. Poly(methylglutamate)-Coated Surfaces in HPLC and CE. Chromatographia, 1991; 32:171.
    • 1 2 8 Chapter 3 Capillary Zone Electrophoresis 46. Bruin, G. J. M., Huisden, R., Kraak, J. C, Poppe, H. Performance of Carbohydrate-Modified Fused-Silica Capillaries for the Separation of Proteins by Zone Electrophoresis.J. Chromatogr., 1989; 480:339. 47. Burns, N. L., Harris, J. M., Van Alstine, J. M. Electrokinetic Characteristics of Polysaccharide and Related Coatings. Front. Biomed. Biotechnol, 1993; 1 (Carbohydrates and Carbohydrate Polymers):298. 48. Burt, H., Lewis, D. M., Tapley, K. N. Resin Coating for Capillaries Giving a Net Positive Charge and Great Potential for Customized Modification of Surface Properties. J. Chromatogr., A, 1996; 739:367. 49. Busch, M. H. A., Kraak, J. C, Poppe, H. Cellulose Acetate-Coated Fused-Silica Capillaries for the Separation of Proteins by Capillary Zone Electrophoresis.J. Chromatogr, A, 1995; 695:278. 50. Chiari, M., Dell'Orto, N., Gelain, A. Synthesis and Characterization of Capillary Columns Coated with Glycoside-Bearing Polymer. Anal. Chem., 1996; 68:2731. 51. Chiu, R. W, Jimenez, J. C, Monnig, C. A. High Molecular Weight Polyarginine as a Capillary Coating for Separation of Cationic Proteins by Capillary Electrophoresis. Anal. Chim. Acta, 1995; 307:193. 52. Dolnik, V, Xu, D., Yadav, A., Bashkin, J., Marsh, M., Tu, O., Mansfield, E., Vainer, M., Mad- abhushi, R., Barker, D., Harris, D. Wall Coating for DNA Sequencing and Fragment Analysis by Capillary Electrophoresis. J. Microcolumn Sep., 1998; 10:175. 53. Dougherty A. M., Woolley C. L., Williams, D. L., Swaile, D. E, Cole, R. O., Sepaniak, M. J. Stable Phases for Capillary Electrophoresis. J. Liq. Chromatogr, 1991; 14:907. 54. Emoto, K., Harris, J. M., Van Alstine, J. M. Grafting Poly(ethylene glycol) Epoxide to Amino- Derivatized Quartz: Effect of Temperature and pH on Grafting Density. Anal. Chem., 1996; 68:3751. 55. Emoto, K., Van Alstine, J. M., Harris, J. M. Stabihty of Poly(ethylene glycol) Graft Coatings. Langmuir, 1998; 14:2722. 56. Englehardt, H., Cunat-Walter, M. A. Preparation and Stability Tests for Polyacrylamide-Coated Capillaries for Capillary Electrophoresis. J. Chromatogr, A, 1995; 716:27. 57. Fang, X. H., Huang, A. J., Sun, Y. L. Preparation and Evaluation of Polyethylene Glycol Acry- late Coated Capillary Zone Electrophoresis Column. Chin. Chem. Lett, 1996; 7:1109. 58. Fridstroem, A., Lundell, N., Nyholm, L., Markides, K. E. Polymethacryloxypropylhy- drosiloxane Deactivation as a Pretreatment of Polymer-Coated Fused Silica Columns for Cap- illary Electrophoresis. J. Microcolumn Sep., 1997; 9:73. 59. Hayes, J. D., Malik, A. Sol-Gel Chemistry-Based Ucon-Coated Columns for Capillary Elec- trophoresis. J. Chromatogr, B: Biomed. Appl, 1997; 695:3. 60. Hjerten, S., Kubo, K. A New Type of pH- and Detergent-Stable Coating of Elimination of Elec- troendoosmosis and Adsorption in (Capillary) Electrophoresis. Electrophoresis, 1993; 14:390. 61. Huang, M., Vorkink, W P., Lee, M. L. High Efficiency Cross-Linked Polyacrylamide Coating for Capillary Electrophoresis of Proteins. J. Microcolumn Sep., 1992; 4:233. 62. Huang, M., Lee, M. L. Hydrogel Polymer Coatings for Capillary Electrophoretic Separation of Proteins. J. Microcolumn Sep., 1993; 4:491. 63. Huang, T.-L., Shieh, P C. H., Koh, E. V, Cooke, N. Evaluation of a Neutral Hydrophilic Coated Capillary for Capillary Zone Electrophoretic Separation of Proteins. J. Chromatogr, A, 1994; 685:313. 64. Huang, M., Plocek, J., Novotny M. V Hydrolytically Stable Cellulose-Derivative Coatings for Capillary Electrophoresis of Peptides, Proteins and Glycoconjugates. Electrophoresis, 1995; 16:396. 65. Iki, N., Yeung, E. S. Non-bonded Poly(ethylene oxide) Polymer Coated Column for Protein Separation by Capillary Electrophoresis. J. Chromatogr, A, 1996; 731:273. 66. Katayama, H., Ishihama, Y, Asakawa, N. Stable Capillary Coating with Successive Multiple Ionic Polymer Layers. Anal. Chem., 1998; 70:2254. 67. Liao, J.-L., Abramson, J., Hjerten, S. A Highly Stable Methyl Cellulose Coating for Capillary Electrophoresis. J. Cap. Electrophor, 1995; 2:191.
    • References 129 68. Liu, Y., Fu, R., Gu, J. Epoxy Resin Coatings for Capillary Zone Electrophoretic Separation of Basic Proteins. J. Chromatogr., A, 1996; 723:157. 69. Lux,J. A., Yin, H., Schomburg, G. Influence of Polymer Coating of Capillary Surfaces on Migra- tion Behavior in Micellar Electrokinetic Capillary Chromatography. HRC & CC, 1990; 13:145. 70. Mizuna, M., Tochigi, K., Taki, M. Polyethylene Glycol Coated Capillary for Capillary Elec- trophoresis. Bunseki Kagaku, 1992; 41:485. 71. Mizuno, M., Tochigi, K., Taki, M. Separation Characteristics of Polyethylene Glycol-Coated Capillary for Capillary Electrophoresis. Bunseki Kagaku, 1993; 42:7. 72. Nakatani, M., Shibukawa, A., Nakagawa, T. Chemical Stability of Polyacrylamide-Coating on Fused Silica Capillary. Electrophoresis, 1995; 16:1451. 73. Ren, X., Shen, Y., Lee, M. L. Poly(ethylene-propylene glycol)-Modified Fused-Silica Columns for Capillary Electrophoresis Using Epoxy Resin as Intermediate Coating. J. Chromatogr., A, 1996; 741:115. 74. Richards, M. P Application of a Polyamine-Coated Capillary to the Separation of Metalloth- ionein Isoforms by Capillary Zone Electrophoresis. J. Chromatogr, B: Biomed. Appl, 1994; 657:345. 75. Schmalzing, D., Piggee, C. A., Foret, E, Carrilho, E., Karger, B. L. Characterization and Per- formance of a Neutral Hydrophilic Coating for the Capillary Electrophoretic Separation of Biopolymers. J. Chromatogr, 1993; 652:149. 76. Schomberg, G. Polymer Coating of Surfaces in Column Liquid Chromatography and Capil- lary Electrophoresis. TRAC, 1991; 10:163. 77. Srinivasan, K., Pohl, C, Avdalovic, N. Cross-Linked Polymer Coatings for Capillary Elec- trophoresis and Application to Analysis of Basic Proteins, Acidic Proteins, and Inorganic Ions. Anal Chem., 1997; 69:2798. 78. Towns, J. K., Regnier, F. E. Polyethyleneimine-Bonded Phases in the Separation of Proteins by Capillary Electrophoresis. J. Chromatogr, 1990; 516:69. 79. Towns, J. K., Bao, J., Regnier, F. E. Synthesis and Evaluation of Epoxy Polymer Coatings for the Analysis of Proteins by Capillary Zone Electrophoresis. J. Chromatogr, 1992; 599:227. 80. Yao, X.-W., Regnier, F. E. Polymer- and Surfactant-Coated Capillaries for Isoelectric Focusing. J. Chromatogr, 1993; 632:185. 81. Zhao, Z., Malik, M., Lee, M. L. Solute Adsorption on Polymer-Coated Fused-Silica Capillary Electrophoresis Columns Using Selected Protein and Peptide Standards. Anal Chem., 1993; 65:2747. 82. Jorgenson, J. W., Lukacs, K. D. Zone Electrophoresis in Open Tubular Glass Capillaries. Anal Chem., 1981; 53:1298. 83. Towns, J. K., Regnier, E E. Capillary Electrophoretic Separations of Proteins Using Nonionic Surfactant Coatings. Anal Chem., 1991; 63:1126. 84. Bonfichi, R. Capillary Electrophoresis of Glycosylated Proteins Performed on a Conventional Capillary Gas Chromatography Column. J. Chromatogr, A, 1996; 741:139. 85. Josic, D., Zeilinger, K., Reutter, W, Bottcher, A., Schmitz, G. High-Performance Capillary Elec- trophoresis of Hydrophobic Membrane Proteins. J. Chromatogr, 1990; 516:89. 86. Gordon, M. J., Lee, K. J., Arias, A. A., Zare, R. N. Protocol for Resolving Protein Mixtures in Capillary Zone Electrophoresis. Anal Chem., 1991; 63:69. 87. Reif, O. W, Freitag, R. Control of the Cultivation Process of Antithrombin 111 and Its Char- acterization by Capillary Electrophoresis. J. Chromatogr, A, 1994; 680:383. 88. Pedrosa, M. M., Legaz, M. E. Separation of Arginase Isoforms by Capillary Zone Elec- trophoresis and Isoelectric Focusing in Density Gradient Column. Electrophoresis, 1995; 16:659. 89. Morbeck, D. E., Madden, B. J., McCormick, D. J. Analysis of the Microheterogeneity of the Glycoprotein Chorionic Ganadotropin with High-Performance Electrophoresis.J. Chromatogr, A, 1994; 680:217. 90. Watson, E., Yao, E Capillary Electrophoretic Separation of Recombinant Granulocyte-Colony- Stimulating Factor Glycoforms. J. Chromatogr, 1993; 630:442.
    • 130 Chapter 3 Capillary Zone Electrophoresis 91. Lindner, H., Helliger, W., Dirschlmayer, A., Jaquemar, M., Puschendorf, B. High-Performance Capillary Electrophoresis of Core Histones and Their Acetylated Modified Derivatives. Biochem.J., 1992; 283:467. 92. Lindner, H., Helliger, W., Sarg, B., Meraner, C. Effect of Buffer Composition on the Migration Order and Separation of Histone HI Subtypes. Electrophoresis, 1995; 16:604. 93. Gurley L. R., London, J. E., Valdez, J. G. High-Performance Capillary Electrophoresis of His- tones. J. Chromatogr, 1991; 559:431. 94. Yim, K., Abrams, J., Hsu, A. Capillary Zone Electrophoretic Resolution of Recombinant Human Bone Morphogenetic Protein 2 Glycoforms. An Investigation into Separation Mech- anisms for an Exquisite Separation. J. Chromatogr, A, 1995; 716:401. 95. McNerney T. M., Watson, S. K., Sim, J.-H., Bridenbaugh, R. L. Separation of Recombinant Human Growth Hormone from Escherichia coli Cell Pellet by Capillary Zone Electrophore- sis. J. Chromatogr, A, 1996; 744:223. 96. Jorgensen, T. K., Bagger, L. H., Christiansen, J.,Johnsen, G. H., Faarbaek,J. R., Jorgenson, L. W, B. S. Quantifying Biosynthetic Human Growth Hormone in Escherichia coli v^th Capillary Elec- trophoresis Under Hydrophobic Conditions. J. Chromatogr, A, 1998; 817:205. 97. Vincentelh, R., Bihoreau, N. Characterization of Each Isoform of a FCabOi by Capillary Elec- trophoresis. J. Chromatogr, 1993; 641:383. 98. Knuver-Hopf, J., Mohr, H. Differences between Natural and Recombinant Interleukin-2 Revealed by Gel Electrophoresis and Capillary Electrophoresis. J, Chromatogr, A, 1995; 717:71. 99. Hu, A. Z., Cruzado, 1. D., Hill, J. W., McNeal, C. J., Macfarlane, R. D. Characterization of Lipoprotein A by Capillary Zone Electrophoresis. J. Chromatogr, A, 1995; 717:33. 100. Richards, M. R, Aagaard, P J. Separation of Metallothionein Isoforms by Free-Solution Cap- illary Electrophoresis in Uncoated and Surface-Modified Capillaries. J. Capillary Electrophor, 1994; 1:90. 101. Vallejo-Cordoba, B. Rapid Separation and Quantification of Major Caseins and Whey Proteins of Bovine Milk by Capillary Electrophoresis. J. Capillary Electrophor, 1997; 4:219. 102. Reevino, M. G., Tavema, M., Boureau, H., Bourlioux, P, Ferrier, D. Contribution of Capillary Zone Electrophoresis to the Analysis of Cecal Mucins. J. Capillary Electrophor, 1996; 3:287. 103. Kalman, E, Ma, S., Hodel, A., Fox, R. O., Horvath, C. Charge and Size Effects in the Capillary Zone Electrophoresis of Nuclease A and Its Variants. Electrophoresis, 1995; 16:595. 104. Heo, Y. J., Kim, S. Y, Kim, E., Lee, K.-J. Quaternary Structural Analysis of Nucleoside Diphos- phate Kinases Using Capillary Electrophoresis. J. Chromatogr, A, 1997; 781:251. 105. Nedelkov, D., Bieber, A. L. Detection of Isoforms and Isomers of Rattlesnake Myotoxins by Capillary Electrophoresis and Matrix-Assisted Laser Desorption Time-of-Flight Mass Spec- trometry J. Chromatogr, A, 1997; 781:429. 106. Tagliaro, F, Crivellente, F, Manetto, G., Puppi, I., Deyl, Z., Marigo, M. Optimized Determi- nation of Carbohydrate-Deficient Transferrin Isoforms in Serum by Capillary Zone Elec- trophoresis. Electrophoresis, 1998; 19:3033. 107. Liebich, H. M., Lehmann, R., Weiler, A. E., Grubler, G., Voelter, W Capillary Electrophore- sis, A Rapid and Sensitive Method for Routine Analysis of Apolipoprotein A-I in Chnical Sam- ple.;. Chromatogr, A, 1995; 717:25. 108. Chen, F.-T. A. Rapid Protein Analysis by Capillary Electrophoresis. J. Chromatogr, 1991; 559:445. 109. Yao, Y J., Loh, K. C, Chung, M. C. M., Li, S. E Y Analysis of Recombinant Human Tumor Necrosis Factor Beta by Capillary Electrophoresis. Electrophoresis, 1995; 16:647. 110. Recio, L, Molina, E., Ramos, M., de Frutos, M. Quantitative Analysis of Major Whey Proteins by Capillary Electrophoresis Using Uncoated Capillaries. Electrophoresis, 1995; 16:654. 111. Ackermans, M. T, Everaerts, F M., Beckers, J. L. Determination of Aminoglycoside Antibi- otics in Pharmaceuticals by Capillary Zone Electrophoresis with Indirect UV Detection Cou- pled with Micellar Electrokinetic Capillary Chromatography. J. Chromatogr, 1992; 606:229.
    • References 131 112. Ramseier, A., Caslavska, J., Thormann, W. Screening for Urinary Amphetamine and Analogs by Capillary Electrophoretic Immunoassays and Confirmation by Capillary Electrophoresis with On-Column Multiwavelength Absorbance Detection. Electrophoresis, 1998; 19:2956. 113. Hemple, G., Schulze-Westhoff, P., Flege, S., Laubrock, N., Boos, J. Therapeutic Drug Moni- toring of Doxorubicin in Paediatric Oncology Using Capillary Electrophoresis. Electrophore- sis, 1998; 19:2939. 114. Choi, O.-K., Jo, J.-S. Determination of L-Ascorbic Acid in Foods by Capillary Zone Elec- trophoresis. J. Chromatogr, A, 1997; 781:435. 115. Pesek,J. J., Matyska, M. T. Determination of Aspartame by High-Performance Capillary Elec- trophoresis. J. Chromatogr, A, 1997; 781:423. 116. Ridge, S., Hettiarachchi, K. Peptide Purity and Counterion Determination of Bradykinin by High-Performance Liquid Chromatography and Capillary Electrophoresis. J. Chromatogr, A, 1998; 817:215. 117. Watzig, H., Dengenhardt, M. Characterization of Buserelin Acetate by Capillary Elec- trophoresis. J. Chromatogr, A, 1998; 817:239. 118. Walker, J. C, Zaugg, S. E., Walker, E. B. Analysis of Beverages by Capillary Electrophoresis. J. Chromatogr, A, 1997; 781:481. 119. Wiedmer, S. K., Siren, H., Riekkola, M.-L., Jumppanen, J. H. Comparison of Capillary Elec- trophoresis Systems for the Reliable Identification of Some Carboxylic Acids Using the Marker Technique. J. Chromatogr, A, 1997; 781:239. 120. Adamson, N. J., Reynolds, E. C. High Performance Capillary Electrophoresis of Casein Phos- phopeptides Containing 2-5 Phosphoseryl Residues: Relationship Between Absolute Elec- trophoretic Mobility and Peptide Charge and Size. Electrophoresis, 1995; 16:525. 121. Honda, S., Taga, A., Kakehi, K., Koda, S., Okamoto, Y. Determination of Cefixime and Its Metabolites by High-Performance Capillary Electrophoresis. J. Chromatogr, 1992; 590:364. 122. Hudson, J. C, Golin, M., Malcome, M., Whiting, C. E Capillary Zone Electrophoresis in a Comprehensive Screen for Drugs of Forensic Interest in Whole Blood: An Update. J. Can. Soc. Forensic Set, 1998; 31:1. 123. Thorsteinsdottir, M., Beijersten, I., Westerlund, D. Capillary Electroseparations of Enkephalin- Related Peptides and Protein Kinase A Peptide Substrates. Electrophoresis, 1995; 16:564. 124. Mrestani, Y., Neubert, R. Separation of Etoposide Phosphate and Methotrexate by Capillary Zone Electrophoresis Using a UV Detector with a High Sensitivity Cell. Electrophoresis, 1998; 19:3022. 125. Kulomaa, A., Siren, H., Riekkola, M.-K. Identification of Antioxidative Compounds in Plant Beverages by Capillary Electrophoresis with the Marker Index Technique. J. Chromatogr, A, 1997; 781:523. 126. Vogt, C, Vogt, J., Becker, A., Rohde, E. Separation, Comparison and Identification of Foun- tain Pen Inks by Capillary Electrophoresis with UV-Visible and Fluorescence Detection and by Proton-Induced X-Ray Emission. J. Chromatogr, A, 1997; 781:391. 127. Shihabi, Z. K., Kute, T., Garcia, L. L., Hinsdale, M. Analysis of Isoflavones by Capillary Elec- trophoresis. J. Chromatogr, A, 1994; 680:181. 128. Cifuentes, A., Poppe, H. Effect of pH and Ionic Strength of Running Buffer on Peptide Behav- ior in Capillary Electrophoresis: Theoretical Calculation and Experimental Evaluation. Elec- trophoresis, 1995; 16:516. 129. Friedberg, M. A., Hinsdale, M. E., Shihabi, Z. K. Analysis of Nitrate in Biological Fluids by Capillary Electrophoresis. J. Chromatogr, A, 1997; 781:491. 130. Wainright, A. Capillary Electrophoresis Applied to the Analysis of Pharmaceutical Com- pounds. J. Microcolumn Sep., 1990; 2:166. 131. Cahours, X., Morin, P., Dreux, M. Sub-minute Separation of Nucleoside 5'-Triphosphates with Co-electroosmotic Capillary Electrophoresis.J. Liq. Chromatogr Related Technol, 1999; 22:2389. 132. Shirao, M., Furuta, R., Suzuki, S., Nakazawa, H., Fujita, S., Maruyama, T. Determination of Organic Acids in Urine by Capillary Electrophoresis. J. Chromatogr, A, 1994; 680:247.
    • 1 3 2 Chapter 3 Capillary Zone Electrophoresis 133. Oda, R. P., Madden, B. J., Morris,J. C, Spelsberg, T. C, Landers,J. P. Multiple-Buffer-Additive Strategies for Enhanced Capillary Electrophoretic Separation of Peptides. J. Chromatogr., A, 1994; 680:341. 134. Shihabi, Z. K. Serum Procainamide Analysis Based on Acetonitrile Stacking by Capillary Elec- trophoresis. Electrophoresis, 1998; 19:3008. 135. Takigiku, R., Schneider, R. E. Reproducibility and Quantitation of Separation for Ribonucle- oside Triphosphates and Deoxyribonucleoside Triphosphates by Capillary Zone Elec- trophoresis. J. Chromatogr, 1991; 559:247. 136. Ackermans, M. T., Beckers, J. L., Everaerts, E M., Hoogland, H., Tomassen, M.J. H. Determi- nation of Sulphonamides in Pork Meat Extracts by Capillary Zone Electrophoresis. J. Chro- matogr, 1992; 596:101. 137. Wren, S. A. C. , Rowe, R. C. Theoretical Aspects of Chiral Separation in Capillary Elec- trophoresis. 1. Initial Evaluation of a Model. J. Chromatogr, 1992; 603:235. 138. Wren, S. A. C, Rowe, R. C. Theoretical Aspects of Chiral Separation in Capillary Elec- trophoresis. II. The Role of Organic Solvent./ Chromatogr, 1992; 609:363. 139. Wren, S. A. C, Rowe, R. C. Theoretical Aspects of Chiral Separation in Capillary Elec- trophoresis. III. Application to p-Blockers. J. Chromatogr, 1993; 635:113. 140. Mosher, R. A. The Use of Metal Ion-Supplemented Buffers to Enhance the Resolution of Pep- tides in Capillary Zone Electrophoresis. Electrophoresis, 1990; 11:765. 141. Kajiwara, H. Application of High-Performance Capillary Electrophoresis to the Analysis of Conformation and Interaction of Metal-Binding Proteins. J. Chromatogr, 1991; 559:345. 142. Kajiwara, H., Hirano, H., Oono, K. Binding Shift Assay of Parvalbumin, Calmodulin and Car- bonic Anhydrase by High-Performance Capillary Electrophoresis. J. Biochem. Biophys. Meth., 1991; 22:263. 143. Wright, R B., Dorsey, J. G. Silver(I)-Mediated Separations by Capillary Zone Electrophoresis and Micellar Electrokinetic Chromatography: Argentation Electrophoresis. Anal. Chem., 1996; 68:415. 144. Plocek, J., Chmelik, J. Separation of Disaccharides as Their Borate Complexes by Capillary Electrophoresis with Indirect Detection in the Visible Range. Electrophoresis, 1997; 18:1148. 145. Hoffstetter-Kuhn, S., Paulus, A., Gassmann, E., Widmer, H. M. Influence of Borate Com- plexation on the Electrophoretic Behavior of Carbohydrates in Capillary Electrophoresis. Anal. Chem., 1991; 63:1541. 146. Morin, P., Villard, E, Druex, M., Andre, P. Borate Complexation of Flavonoid-O-Glycosides in Capillary Electrophoresis. II. Separation of Flavonoid-3-O-Glycosides Differing in Their Sugar Moiety J. Chromatogr, 1993; 628:161. 147. Liu, Y., Shu, C, Lamb, J. D. High-Performance Capillary Electrophoretic Separation of Car- bohydrates with Indirect UV Detection Using Diethylamine and Borate as Electrolyte Addi- tives. J. Capillary Electrophor, 1997; 4:97. 148. McLaughlin, G. M., Nolan, J. A., Lindahl, J. L., Palmieri, R. H., Anderson, K. W, Morris, S. C, Morrison, J. A., Bronzert, T.J. Pharmaceutical Drug Separations by HPCE: Practical Guidelines. J. Liq. Chromatogr, 1992; 15:961. 149. Jandik, R, Jones, W. R., Weston, A., Brown, R R. Electrophoretic Capillary Ion Analysis: Ori- gins, Principles, and Applications. LC-GC, 1991; 9:634. 150. Harakuwe, A. H., Haddad, R R., Buchberger, W Optimization of Separation Selectivity in Cap- illary Zone Electrophoresis of Inorganic Anions Using Binary Cationic Surfactant Mixtures. J. Chromatogr, A, 1994; 685:161. 151. Boden, J., Darius, M., Bachmann, K. Determination of Inorganic and Small Organic Anions in Pure Boric Acid Using Capillary Zone Electrophoresis. J. Chromatogr, A, 1995; 716:311. 152. Stahl, R. Routine Determination of Anions by Capillary Electrophoresis and Ion Chromatog- raphy J. Chromatogr, A, 1994; 686:143. 153. Roder, A., Bachmann, K. Simultaneous Determination of Organic and Inorganic Anions in the Sub-|Limol/l Range in Rain Water by Capillary Zone Electrophoresis. J. Chromatogr, A, 1995; 689:305.
    • References 133 154. Harrold, M. P., Wojtusik, M. J., Riviello, J., Henson, P. Parameters Influencing Separation and Detection of Anions by Capillary Electrophoresis. J. Chromatogr., 1993; 640:463. 155. Lee, Y.-H., Lin, T.-l. Capillary Electrophoretic Determination of Amino Acids with Indirect Absorbance Detection. J. Chromatogr., A, 1994; 680:287. 156. Lee, Y.-H., Lin, T.-l. Capillary Electrophoretic Determination of Amino Acids. Improvement by Cyclodextrin Additives. J. Chromatogr, A, 1995; 716:335. 157. Klockow, A., Paulus, A., Figueiredo, V, Amado, R., Widmar, H. M. Determination of Carbo- hydrates in Fruit Juices by Capillary Electrophoresis and High-Performance Liquid Chro- matography. J. Chromatogr, A, 1994; 680:187. 158. Xu, X., Kok, W. T., Poppe, H. Sensitive Determination of Sugars by Capillary Zone Elec- trophoresis with Indirect UV Detection Under Highly Alkaline Conditions. J. Chromatogr, A, 1995; 716:231. 159. Xu, X., Kok, W. T., Kraak, J. C, Poppe, H. Simultaneous Determination of Urinary Creati- nine, Calcium and Other Inorganic Cations by Capillary Zone Electrophoresis with Indirect Ultraviolet Detection. J. Chromatogr, B: Biomed. Appl, 1994; 661:35. 160. Jimidar, M., Hamoir, T., Degezelle, W, Massart, D. L., Soykenc, S., Van de Winkel, P Method Development and Optimization for the Determination of Rare Earth Metal Ions by Capillary Zone Electrophoresis. Anal. Chim. Acta, 1993; 284:217. 161. Shi, Y, Fritz, J. S. Separation of Metal Ions by Capillary Electrophoresis with a Complexing Electrolyte. J. Chromatogr, A, 1993; 640:473. 162. Lee, Y.-H., Lin, T.-L Determination of Metal Cations by Capillary Electrophoresis. Effect of Background Carrier and Complexing Agents. J. Chromatogr, A, 1994; 675:227. 163. Jackson, P E., Haddad, P R. Capillary Electrophoresis of Inorganic Ions and Low-Molecular- Mass Ionic Solutes. TRAC, 1993; 12:231. 164. Simunicova, E., Kaniansky, D., Loksikova, K. Separation of Alkali and Alkaline Earth Metal and Ammonium Cations by Capillary Zone Electrophoresis with Indirect UV Absorbance Detection. J. Chromatogr, A, 1994; 665:203. 165. Beck, W., Engelhardt, H. Separation of Non UV-Absorbing Cations by CapiUary Elec- trophoresis. FreseniusJ. Anal. Chem., 1993; 346:618. 166. Chen, J., Preston, B. P, Zimmerman, M. J. Analysis of Organic Acids in Industrial Samples. Comparison of Capillary Electrophoresis and Ion Chromatography. J. Chromatogr, A, 1997; 781:205. 167. Degenhardt, M., Benend, H., Watzig, H. Quality Control of Pentosane Polysulfate by Capil- lary Zone Electrophoresis Using Indirect Detection. J. Chromatogr, A, 1998; 817:297. 168. Wang, T., Li, S. E Y Development of a Capillary Electrophoresis Method with Indirect Pho- tometric Detection for the Determination of Anions Related to Anticaries. J. Chromatogr, A, 1997; 781:457. 169. Stover, E S., Keffer, S. S. Separation of Condensed Phosphates Using Capillary Zone Elec- trophoresis with Indirect UV Detection. J. Chromatogr A, 1993; 657:450. 170. Pianetti, G. A., Taverna, M., Baillet, G., Mahusier, G., Baylocq-Ferrier, D. Determination of Alkylphosphonic Acids by Capillary Zone Electrophoresis Using Indirect UV Detection. J. Chromatogr, 1993; 630:371. 171. Haddadian, E, Shamsi, S. A., Schaeper, J. P., Danialson, N. D. Capillary Electrophoresis of Phospholipids with Indirect Photometric Detection. J. Chromatogr Set, 1998; 36:395. 172. Nardi, A., Cristalh, M., Desiderio, C, Ossicini, L., Shukla, S. K., Fanah, S. Indirect UV Pho- tometric Detection in Capillary Zone Electrophoresis for the Determination of Phytate in Soy- beans. J. Microcolumn Sep., 1992; 4:9. 173. Altria, K. D., Wood, T., Kitscha, R., Roberts-Mcintosh. Validation of a Capillary Elec- trophoresis Method for the Determination of Potassium Counter-Ion Levels in an Acidic Drug Salt. J. Pharm. Biomed. Anal, 1995; 13:33. 174. Zuriguel, V, Causse, E., Bounery J. D., Nouadje, G., Simeon, N., Nertz, M., Salvayre, R., Cou- derc, F Short Chain Fatty Acids Analysis by Capillary Electrophoresis and Indirect UV Detec- tion or Laser-Induced Fluorescence. J. Chromatogr, A, 1997; 781:233.
    • 1 3 4 Chapters Capillary Zone Electrophoresis 175. Gibbons, J. M., Hoke, S. H. Capillary Zone Electrophoresis with Indirect UV Detection: Deter- mination of Sodium Dodecyl Sulfate in Simulated Stream Water. J. High Resolut. Chromatogr., 1994; 17:665. 176. Nielen, M. W. E Quantitative Aspects of Indirect UV Detection in Capillary Zone Elec- trophoresis. J. Chromatogr., 1991; 588:321. 177. Buchberger, W, Cousins, S. M., Haddad, P. R. Optimization of Indirect UV Detection in Cap- illary Electrophoresis of Low-Molecular Mass Anions. Trends Anal. Chem., 1994; 13:313. 178. Romano, J., Jandik, P., Jones, W. R., Jackson, P E. Optimization of Inorganic Capillary Elec- trophoresis for the Analysis of Anionic Solutes in Real Samples.J. Chromatogr, 1991; 546:411. 179. Yeung, E. S., Kuhr, W. G. Indirect Detection Methods for Capillary Separations. Anal. Chem., 1991; 63:275. 180. Ma, Y., Zhang, R. Optimization of Indirect Photometric Detection of Anions in High-Perfor- mance Capillary Electrophoresis. J. Chromatogr, 1992; 625:341. 181. Weston, A., Brown, P R., Jandik, P, Jones, W R., Heckenberg, A. L. Factors Affecting the Sep- aration of Inorganic Metal Cations by Capillary Electrophoresis. J. Chromatogr, 1992; 593:289. 182. Jones, W R., Jandik, R Controlled Changes of Selectivity in the Separation of Ions by Capil- lary Electrophoresis. J. Chromatogr, 1991; 546:445. 183. Shi, Y., Fritz, J. S. New Electrolyte Systems for the Determination of Metal Cations by Capil- lary Electrophoresis. J. Chromatogr, A, 1994; 671:429. 184. Lin, T.-L., Lee, Y.-H., Chen, Y.-C. Capillary Electrophoretic Analysis for Inorganic Cations. Role of Complexing Agent and Buffer pH. J. Chromatogr A, 1993; 654:167. 185. Oehrle, S. A. Controlled Changes in Selectivity of Cation Separations by Capillary Elec- trophoresis Using Various Crown-Ether Additives. J. Chromatogr, A, 1996; 745:87. 186. Yang, Q., Smeyers-Verbeke, J., Wu, W, Khots, M. S., Massart, D. L. Simultaneous Separation of Ammonium and Alkali, Alkaline Earth and Transition Metal Ions in Aqueous-Organic Media by Capillary Ion Electrophoresis. J. Chromatogr, A, 1994; 688:339. 187. Francois, C, Morin, P., Druex, M. Effect of the Concentration of 18-Crown-6 Added to the Electrolyte upon the Separation of Ammonia, Alkali and Alkaline-Earth Cations by Capillary Electrophoresis. J. Chromatogr, A, 1995; 706:535. 188. Francois, C, Morin, P., Dreux, M. Separation of Transition Metal Cations by Capillary Elec- trophoresis. Optimization of Complexing Agent Concentrations (Lactic Acid and 18-Crown-6). J. Chromatogr, A, 1995; 717:393. 189. Dabek-Zlotorzynska, E., Dlouhy J. E Apphcation of Capillary Electrophoresis in Atmospheric Aerosol Analysis: Determination of Cations. J. Chromatogr, A, 1995; 706:527. 190. Lewis, R. E., Ahuja, E. S., Foley, J. R Ion Analysis by Capillary Zone Electrophoresis with Indi- rect Injection: Applications in the Nuclear Power Industry. Analyst, 1998; 123:1465. 191. Amran, M. B., Lakkis, M. D., Lagarde, E, Leroy M.J. E, Lopez-Sanchez, J. E, Rauret, G. Sep- aration of Bromide, Bromate, Iodide, lodate. Nitrite, Nitrate and Selenite Anions by Capillary Zone Electrophoresis. FreseniusJ. Anal. Chem., 1993; 345:420. 192. Janini, G. M., Muschik, G. M., Issaq, H. J. Sample Matrix Effects in Capillary Zone Elec- trophoresis. Effect of Chloride Ion on Nitrate and Nitrite. J. Cap. Electrophor, 1994; 1:116. 193. Leone, A. M., Moncada, S. The Determination of Plasma Nitrite and Nitrate by Capillary Ion Analysis. Methods, 1995; 7:98. 194. Meulemans, A., Delsenne, E Measurement of Nitrite and Nitrate Levels in Biological Samples by Capillary Electrophoresis. J. Chromatogr, B: Biomed. Appl, 1994; 660:401. 195. Song, L., Ou, Q., Yu, W, Fang, L., Jin, Y Determination of the Petroleum Tracers Nitrate and Thiocyanate in Subterranean Waters by Capillary Ion Electrophoresis. J. Chromatogr, A, 1995; 376. 196. Ueda, T., Maekawa, T., Sadamitsu, D., Oshita, S., Ogino, K., Nakamura, K. The Determina- tion of Nitrite and Nitrate in Human Blood Plasma by Capillary Zone Electrophoresis. Elec- trophoresis, 1995; 16:1002.
    • References 135 197. Bjergegaard, C, Moller, P., Sorensen, H. Determination of Thiocyanate, Iodide, Nitrate and Nitrite in Biological Samples by Micellar Electrokinetic Capillary Chromatography. J. Chro- matogr.,A, 1995; 717:409. 198. Jia, L., Zhang, H., Hu, Z. Separation and Determination of Chromium(Vl), Molybdenum(VI), and Vanadium in Steel Using Capillary Ion Electrophoresis with Direct UV Detection. J. Liq. Chromatogr., 1996; 19:565. 199. Motomizu, S., Hahoko, M., Kuwabara, M., Oshima, M. Separation and Sensitive Determina- tion of Metal Ions by Capillary Zone Electrophoresis with 2-(5-Nitro-2-pyridylazo)-5-(N- propyl-N-sulfopropylamino)phenol. Anal. Set, 1994; 10:101. 200. Motomizu, S., Oshima, M., Kuwabara, M., Obata, Y. Separation and Sensitive Detection of Metal Ions by Capillary Zone Electrophoresis with 2-(5-Bromo-2-pyridylazo)-5-(N-propyl- N-sulfopropylamino)phenol. Analyst, 1994; 119:1787. 201. Timerbaev, A. R., Semenova, O. P., Jandik, P, Bonn, G. K. Metal Ion Capillary Electrophore- sis with Direct UV Detection. Effect of a Charged Surfactant on the Migration Behavior of Metal Chelates. J. Chromatogr., A, 1994; 671:419. 202. Timerbaev, A. R., Semenova, O. P, Bonn, G. K., Fritz, J. S. Determination of Metal Ions Com- plexed with 2,6-Diacetylpyridine bis(N-Methylenepyridiniohydrazone) by Capillary Elec- trophoresis. Anal. Chim. Acta, 1994; 296:119. 203. Saitoh, T., Hoshino, H., Yotsuyanagi, T. Separation of 4-(2-Pyridylazo)resorcinolato Metal Chelates by Micellar Electrokinetic Capillary Chromatography. J. Chromatogr, 1989; 469:175. 204. Hilder, E. E, Macka, M., Bogan, D. P, Haddad, P R. Separation of Metal bis(2-Hydroxy- ethyl)dithiocarbamate Complexes by Micellar Electrokinetic Capillary Chromatography. Anal. Commun., 1997; 34:63. 205. Regan, F. B., Meaney, M. P., Lunte, S. M. Determination of Metal Ions by Capillary Elec- trophoresis Using On-Column Complexation with 4-(2-Pyridylazo)resorcinol Following Trace Enrichment by Peak Stacking. J. Chromatogr, B: Biomed. Appl, 1994; 657:409. 206. Timerbaev, A. R., Buchberger, W, Semenova, O. P, Bonn, G. K. Metal Ion Capillary Zone Elec- trophoresis with Direct UV Detection: Determination of Transition Metals Using an 8-Hydroxy- quinoline-5-Sulfonic Acid Chelating System. J. Chromatogr, 1993; 630:379. 207. Motomizu, S., Nishimura, S.-I., Obata, ¥., Tanaka, H. Separation and Determination of Diva- lent Metal Ions with UV-Absorbing Chelating Agents by Capillary Electrophoresis. Anal. Set, 1991; 7:253. 208. Motomizu, S., Oshima, M., Matsuda, S., Obata, Y., Tanaka, H. Separation and Determination of Alkaline-Earth Metal Ions as UV-Absorbing Chelates with EDTA by Capillary Electrophoresis. Determination of Calcium and Magnesium in Water and Serum Samples. Anal. Set, 1992; 8:619. 209. Chao, Y.-C, Whang, C.-W Capillary Zone Electrophoresis of Eleven Priority Phenols with Indirect Fluorescence Detection. J. Chromatogr A, 1994; 663:229. 210. Bachmann, K., Haumann, 1., Groh, T. Simultaneous Determination of Inorganic Cations and Anions in Capillary Zone Electrophoresis (CZE) with Indirect Fluorescence Detection. Fre- seniusj. Anal. Chem., 1992; 343:901. 211. Kuhr, W. G., Yeung, E. S. Indirect Fluorescence Detection of Native Amino Acids in Capillary Zone Electrophoresis. Anal. Chem., 1988; 60:1832. 212. Xue, Q., Yeung, E. S. Indirect Fluorescence Determination of Lactate and Pyruvate in Single Erythrocytes by Capillary Electrophoresis. J. Chromatogr A, 1994; 661:287. 213. Huang, X., Pang, T. K. J., Gordon, M. J., Zare, R. N. On-Column Conductivity Detector for Capillary Zone Electrophoresis. Anal. Chem., 1987; 59:2747. 214. Jones, W. R., Soglia, J., Mcglynn, M., Haber, C, Reineck, J., Krstanovic, C. Capillary Ion Elec- trophoresis with Conductivity Detection. Amer Lah., 1996; 28:25. 215. Haber, C, VanSaun, R.J.,Jones, W. R. Quantitative Analysis of Anions at ppb/ppt Levels With Capillary Electrophoresis and Conductivity Detection: Enhancement of System Linearity and Precision Using an Internal Standard. Anal. Chem., 1998; 70:2261.
    • 1 3 6 chapters Capillary Zone Electrophoresis 216. Gallagher, P., Danielson, N. D. Capillary Electrophoresis of Cationic and Anionic Surfactants with Indirect Conductivity Detection. J. Chromatogr, A, 1997; 781:533. 217. Bihoreau, N., Ramon, C, Vincentelli, R., Levillain, J.-P, Troalen, F. Peptide Mapping Charac- terization by Capillary Electrophoresis of a Human Monoclonal Anti-Rh(D) Antibody Pro- duced for Clinical Study J. Capillary Electrophor, 1995; 2:197. 218. Wheat, T. E., Young, P M., Astephen, N. E. Use of Capillary Electrophoresis for the Detection of Single-Residue Substitutions in Peptide Mapping, J. Liq. Chromatogr, 1991; 14:987. 219. Rush, R. S., Derby P L., Strickland, T. W, Rohde, M. E Peptide Mapping and Evaluation of Glycopeptide Microheterogeneity Derived from Endoproteinase Digestion of Erythropoietin by Affinity High-Performance Capillary Electrophoresis. Anal. Chem., 1993; 65:1834. 220. Castagnola, M., Messana, 1., Cassiano, L., Rabino, R., Rossetti, D. V, Giardina, B. The Use of Capillary Electrophoresis for the Determination of Hemoglobin Variants. Electrophoresis, 1995; 16:1492. 221. Chang, H.-T., Yeung, E. S. On-Column Digestion of Protein for Peptide Mapping by Capillary Zone Electrophoresis with Laser-Induced Native Fluorescence. Anal. Chem., 1993; 65:2947. 222. Chang, J. P, Smiley D. L., Coleman, M. R. Free-Solution Capillary Electrophoresis of Tryp- tic Digest Fragments of a Recombinant Porcine Pro-Growth Hormone Releasing Hormone (2-76) OH. J. Liq. Chromatogr, 1994; 17:1899. 223. Nielsen, R. G., Riggin, R. M., Rickard, E. C. Capillary Zone Electrophoresis of Peptide Fragments from Trypsin Digestion of Biosynthetic Human Growth Hormone.J. Chromatogr, 1989; 480:393. 224. Nashabeh, W, Rassi, Z. E. Capillary Zone Electrophoresis of apacid Glycoprotein Fragments from Trypsin and Endoglycosidase Digestions. J. Chromatogr, 1991; 536:31. 225. Frenz, J., Wu, S.-L., Hancock, W. S. Characterization of Human Growth Hormone by Capil- lary Electrophoresis. J. Chromatogr, 1989; 480:379. 226. Valko, I. E., Porras, S. P, Riekkola, M.-L. Capillary Electrophoresis with Wide-Bore Capillar- ies and Non-aqueous Media. J. Chromatogr, A, 1998; 813:179. 227. Sahota, R. S., Khaledi, M. G. Nonaqueous Capillary Electrophoresis. Anal. Chem., 1994; 66:1141. 228. Valko, I. E., Siren, H., Riekkola, M.-L. Capillary Electrophoresis in Nonaqueous Media: An Overview. LC/GC, 1997; 15:560. 229. Salimi-Moosavi, H., Cassidy R. M. Capillary Electrophoresis of Inorganic Anions in Non- aqueous Media with Electrochemical and Indirect UV Detection. Anal. Chem., 1995; 67:1067. 230. Chiari, M., Kenndler, E. Capillary Zone Electrophoresis in Organic Solvents: Separation of Anions in Methanolic Buffer Solutions. J. Chromatogr, A, 1995; 716:303. 231. Lu, W, Yang, G., Cole, R. B. Determination of Amino Acids by Online Capillary Elec- trophoresis-Electrospray Ionization Mass Spectrometry. Electrophoresis, 1995; 16:487. 232. Cherkaoui, S., Varesio, E., Christen, P, Veuthey, J.-L. Selectivity Manipulation Using Non- aqueous Capillary Electrophoresis. Application to Tropane Alkaloids and Amphetamine Deriv- atives. Electrophoresis, 1998; 19:2900. 233. Leung, G. N. W, Tang, H. P O., Tso, T. S. C, Wan, T. S. M. Separation of Basic Drugs with Non-aqueous Capillary Electrophoresis. J. Chromatogr, A, 1996; 738:141. 234. Zhang, C.-X., von Herren, E, Thormann, W Separation of Hydrophobic, Positively Charge- able Substances by Capillary Electrophoresis. Anal. Chem., 1995; 67:2070. 235. Wang, E, Khaledi, M. G. Chiral Separations by Nonaqueous Capillary Electrophoresis. Anal. Chem., 1996; 68:3460. 236. Nie, S., Dadoo, R., Zare, R. N. Ultrasensitive Fluorescence Detection of Polycyclic Aromatic Hydrocarbons in Capillary Electrophoresis. Anal. Chem., 1993; 65:3571. 237. Bjoernsdottir, I., Hansen, S. H.J. Chromatogr, A, 1995; 711:313. 238. Tomhnson, A. J., Benson, L. M., Gorrod, J. W, Naylor, S. Investigation of the In Vitro Metab- olism of the Hj-Antagonist Mefentidine by Online Capillary Electrophoresis-Mass Spec- trometry Using Non-aqueous Separation Conditions. J. Chromatogr, B: Biomed. Appl., 1994; 657:373.
    • References 137 239. Shi, Y., Fritz, J. S. Capillary Zone Electrophoresis of Neutral Organic Molecules in Organic- Aqueous Solution. J. High Res. Chromatogr., 1994; 17:713. 240. Tomlinson, A. J., Benson, L. M., Naylor, S. Effects of Organic Solvent in the CE and Online CE-MS Analysis of Drug Metabolite Mixtures. Am. Lab., 1994; 26:29. 241. Ng, C. L., Lee, H. K., Li, S. E Y. Separation of Tamoxifen and MetaboUtes by Capillary Elec- trophoresis with Non-aqueous Buffer System. J. Liq. Chromatogr., 1994; 17:3847. 242. Naess, O., Tilander, T., Pedersen-Bjergaard, S., Rasmussen, K. E. Analysis of Vitamin Formu- lations by Electrokinetic Chromatography Utilizing Tetradecylammonium Ions as the Pseu- dostationary Phase. Electrophoresis, 1998; 19:2912. 243. El Rassi, Z. Capillary Electrophoresis of Carbohydrates. Adv. Chromatogr, 1994; 34:177. 244. Oefner, P, Chiesa, C, Bonn, G., Horvath, C. Developments in Capillary Electrophoresis of Carbohydrates. J. Cap. Electrophor, 1994; 1:5. 245. El Rassi, Z., Ed. Paper Symposium. Capillary Electrophoresis of Carbohydrate Species. Elec- trophoresis, 1996; 17(2). 246. Toida, T., Linhardt, R. J. Detection of Glycosaminoglycans as a Copper (II) Complex in Cap- illary Electrophoresis. Electrophoresis, 1996; 17:341. 247. Brewster, J. D., Fishman, M. L. Capillary Electrophoresis of Plant Starches as the Iodine Com- plexes. J. Chromatogr, A, 1995; 693:382. 248. Oefner, P J., Vorndran, A. E., Grill, E., Huber, C, Bonn, G. K. Capillary Zone Electrophoretic Analysis of Carbohydrates by Direct and Indirect UV Detection. Chromatographia, 1992; 34:308. 249. Richmond, M. D., Yeung, E. S. Development of Laser-Excited Indirect Fluorescence Detec- tion for High-Molecular-Weight Polysaccharides in Capillary Electrophoresis. Anal. Biochem., 1993; 210:245. 250. Garner, T. W, Yeung, E. S. Indirect Fluorescence Detection of Sugars Separated by Capillary Zone Electrophoresis with Visible Laser Excitation. J. Chromatogr, 1990; 515:639. 251. Stefansson, M., Novotny M. Separation of Complex Oligosaccharide Mixtures in the Open- Tubular Format. Anal. Chem., 1994; 66:1134. 252. Evangelista, R. A., Liu, M.-S., Chen, F-T. A. Characterization of 9-Aminopyrene-l,4,6-trisul- fonate-Derivatized Sugars by Capillary Electrophoresis with Laser-Induced Fluorescence Detection. Anal. Chem., 1995; 67:2239. 253. Vorndran, A. E., Grill, E., Huber, C, Oefner, P J., Bonn, G. K. Capillary Zone Electrophore- sis of Aldoses, Ketoses and Uronic Acids Derivatized with p-Aminobenzoate. Chromatographia, 1992; 34:109. 254. Zhang, Y, Arriaga, E., Diedrich, P, Hindsgaul, O., Dovichi, N. J. Nanomolar Determination of Aminated Sugars by Capillary Electrophoresis. J. Chromatogr, A, 1995; 716:221. 255. Yu, Z., Chen, Y, Xu, G., Marina, M. L. Separation and Determination of Ganghosides Using High Performance Capillary Electrophoresis. J. Liq. Chromatogr Related Technol., 1998; 21:349. 256. Malsch, R., Harenberg, J., Heene, D. L. High-Resolution Capillary Electrophoresis and Poly- acrylamide Gel Electrophoresis of Heparins. J. Chromatogr, A, 1995; 716:259. 257. Honda, S., Iwase, S., Makino, A., Fujiwara, S. Simultaneous Determination of Reducing Mono- saccharides by Capillary Zone Electrophoresis as the Borate Complexes of N-2-Pyridylgly- camines. Anal. Biochem., 1989; 176:72. 258. Le, X. C, Zhang, Y, Dovichi, N. J., Compston, C. A., Palcic, M. M., Beever, R. J., Hindsgaul, O. Study of the Enzyme Transformation of Fluorescently Labeled Oligosaccharides in Human Epidermoid Cells Using Capillary Electrophoresis with Laser-Induced Fluorescence Detec- tion./. Chromatogr, A, 1997; 781:515. 259. Le, X., Seaman, C, Zhang, Y, Zhang, J., Dovichi, N. J., Hindsgaul, O., Palcic, M. M. Analysis by Capillary Electrophoresis-Laser Induced Fluorescence Detection of Oligosaccharides Pro- duced from Enzyme Reactions. J. Chromatogr, A, 1995; 716:215. 260. Klockow, A., Amado, R., Widmar, H. M., Paulus, A. Separation of 8-Aminonaphthalene-l,3,6- trisulfonic acid-Labelled Neutral and Sialylayed N-Linked Complex Oligosaccharides by Cap- illary Electrophoresis. J. Chromatogr, A, 1995; 716:241.
    • 138 Chapter 3 Capillary Zone Electrophoresis 261. Schaeper, J. R, Shamsi, S. A., Danielson, N. D. Separation of Phosphorylated Sugars Using Capillary Electrophoresis with Indirect Photometric Detection. J. Capillary Electrophor., 1996; 3:215. 262. Kakehi, K., Susami, A., Taga, A., Suzuki, S., Honda, S. High-Performance Capillary Elec- trophoresis of O-Glycosidically Linked Sialic Acid-Containing Oligosacchardies with Low- Wavelength UV Monitoring. J. Chromatogr., A, 1994; 680:209. 263. Mechref, Y., Ostrander, G. K., El Rassi, Z. Capillary Electrophoresis of Carboxylated Carbo- hydrates. 1. Selective Precolumn Derivatization of Gangliosides with UV Absorbing and Flu- orescent Tags. J. Chromatogr., A, 1995; 695:83. 264. Chen, E-T. A., Liu, C.-M., Hsieh, Y.-Z., Sternberg, J. C. Capillary Electrophoresis—a New Clin- ical Tool. Clin. Chem., 1991; 37:14. 265. Bienvenu, J., Graziani, M. S., Rpin, E A., Bernon, H., Blessum, C, Marchetti, C, Righetti, G., Somenzini, M., Verga, G., Aguzzi, E Multicenter Evaluation of the Paragon CZE 2000 Capil- lary Zone Electrophoresis for Serum Protein Electrophoresis and Monoclonal Component Typing. Clin. Chem., 1998; 44:599. 266. Bossuty X., Schiettekatte, G., Bogaerts, A., Blanckaert, N. Serum Protein Electrophoresis by CZE 2000 Clinical Capillary Electrophoresis System. Clin. Chem., 1998; 44:749.
    • CHAPTER 4 Capillary Zone Electrophoresis Secondary Equilibrium, Micelles, Cyclodextrins, and Related Reagents 4.1 Introduction 4.2 Micelles 4.3 Separation Mechanism 4.4 Selecting the Electrolyte System 4.5 Elution Range of MECC 4.6 Alternative Surfactant Systems 4.7 Cyclodextrins 4.8 Applications and Methods Development 4.9 Chiral Recognition 4.10 Affinity Capillary Electrophoresis References 4.1 INTRODUCTION Retention in liquid chromatography is based on the distribution of a solute between two discrete phases, the stationary phase and the mobile phase. A sepa- ration between two or more solutes can be achieved whenever the equilibrium distribution between the phases is distinct for each component in the mixture. Under this condition, solute will differentially migrate through a chromatographic column. The separation factor, a, for solutes A and B can be expressed as (1) 139
    • 140 Chapter 4 Capillary Zone Electrophoresis a = —-—^, (4.1) [A],[B], where [A] = the concentration of A in phase x or y and [B] = the concentra- tion of B in either of the chromatographic phases. Nowhere in Eq. (4.1), nor in any of the other fundamental expressions for retention in chromatography, is there an absolute stipulation of the velocity of either phase. It is generally assumed that one phase is mobile while the other is stationary. If that assumption of a stationary phase is disregarded, it is easy to imagine a chromatographic separation taking place through the equilibrium distribution of a solute between two phases that are moving at differing velocities. This concept forms the basis for many forms of electro- kinetic separations. Chromatographic-type processes in HPCE are the most profound applica- tions of secondary equilibrium in CZE. While these are often considered as sep- arate techniques, they are a variant of CZE, since the BGE is uniform throughout the capillary and electrolyte reservoirs. The semistationary, or slow-moving, phase in electrokinetic chromatography is composed of molecular aggregates or discrete molecules that are dissolved as additives in the BGE. This formulated buffer system contains, on a molecular level, a heterogeneous environment or "pseudophase" that can compete with the bulk aqueous solution in interacting with the solute. The driving forces that control the speeds of the bulk solution and the heterogeneous pseudophase are electroosmotic and/or electrophoretic migration factors. The creation of the pseudophase can be accomplished with a variety of buffer additives. Surfactants that generate aggregates known as micelles are the most common additives. This form of EKC is known as micellar electro- kinetic (capillary) chromatography (MEKC or MECC). The first reports of this remarkable advance were published in 1984 and 1985 (2, 3). Microemulsions (4-6), liposomes (7), and vesicles (8) represent additional examples of mole- cular aggregates acting as a pseudophase. Molecules that are not aggregates can also be considered a pseudophase. Cyclodextrins (9) are representative of that class, but dendrimers (10), macrocyclic antibiotics (11), polymeric ion- exchange reagents (12, 13), and polymeric surfactants (14) can be used in a similar fashion. Electrokinetic chromatographic separations are used primarily for the sepa- ration of small molecules, though there have been reports on the separation of proteins (15,16). Unique applications such as chiral recognition can be accom- plished directly with micelles (17), cyclodextrins (18, 19), crown ethers (20), or macrocyclic antibiotics (11) or by the MECC separation of diastereomers that were prepared by precapillary derivatization (21). Each of these techniques will be covered in this chapter.
    • 4.2 Micelles 141 4.2 MICELLES Surfactants are molecules comprising long hydrophobic "tails" and polar "head groups." Above a certain concentration, known as the critical micelle concen- tration (CMC), surfactant molecules spontaneously organize into roughly spherical to ellipsoidal aggregates known as micelles. This form of molecular organization occurs due to hydrophobic and electrostatic effects and serves to lower the free energy of the system. In aqueous solution, the surfactant's hydrophobic tail cannot be solvated by water molecules. As the concentration of surfactant is increased in the bulk solu- tion, the molecules begin to find each other with increasing probability. Since the polar head groups are solvated in aqueous solution, the surfactant molecules orient toward each other's tail, forming first a dimer, and later trimers, tetramers, and so forth. These aggregates are known as premicellar assemblies. Finally, at the CMC, the full micellar organization takes shape, a drawing of which is shown in Figure 4.1. The aggregate forms with a hydrophobic core, the result FIGURE 4.1 Representation of an anionic micelle associated with a solute, naphthalene. The spiked shapes indicate the anionic head group.
    • 1 4 2 Chapter 4 Capillary Zone Electrophoresis of tail-in orientation. Shape and stability of micelles are further determined by electrostatic repulsion of the polar head groups and van der Waals attraction of the lipoid chains. Materials insoluble in water are frequently dissolved through hydrophobic interaction with the surfactant. With polar head groups at the periphery, electrostatic interaction with external solutes can occur provided ionic surfactants are employed. The micellar model provides for four zones (22): 1. A hydrocarbon-like core with a diameter of 10-28 A 2. The Stern layer, which contains the polar head groups and counterions 3. The Gouy-Chapman layer, an electric double layer that is hundreds of angstroms thick 4. The bulk surrounding water At the CMC, the bulk properties of the micellar solution are dramatically altered, including surface tension, conductivity, solubilizing power, and the abil- ity to scatter light. Micelles are dynamic entities in equilibrium with the sur- rounding environment. Surfactant molecules are free to exchange between the micelle and the external media. Solutes dissolved in surfactant solutions are free to exchange within the micelle as well. For example, typical entrance rate con- stants for arenes dissolved in sodium dodecyl sulfate are 10^ s"i, whereas the exit rates are lO'^ s"i. Another class of surfactants forms micelles in nonaqueous solvents. Known as inverted micelles, these aggregates have an aqueous core, with the hydrophobic portion of the surfactant in contact with the bulk organic solvent. There have been no reports to date of the use of inverted micelles in electrokinetic separations. Micellar solutions play an important role in many phases of analytical and organic chemistry, including catalysis, electrochemistry, spectroscopy, chro- matography, and now, capillary electrophoresis. The use of these intriguing solu- tions for analytical chemistry has been reviewed (23). Of particular relevance to this chapter is the use of micellar mobile phases in liquid chromatography (24). Surfactant solutions above the CMC can serve as mobile-phase modifiers and function in a similar fashion to conventional organic solvents in reversed- phase liquid chromatography. The phase distribution is more complicated because of the presence of a chromatographic stationary phase, the micellar aggregate, and the bulk aqueous solution. The phase equilibria of a solute between these phases is shown in Figure 4.2. In MECC, the absence of the sta- tionary phase simplifies the phase distribution (25). Sodium dodecyl sulfate (SDS) is the most widely used surfactant for both electrophoresis and chromatography. This surfactant has the proper hydrophilic-lipophilic balance (HLB) for its intended use. In other words, SDS is very water soluble and has a high degree of lipid-solubilizing power. Because of its widespread applicability, the surfactant is available in highly purified form and is very inexpensive. The CMC for SDS is 8 mM, and its aggregation num- ber is 63 (22). While many surfactants can be employed in electrokinetic sep-
    • 4.3 Separation Mechanism 143 FIGURE 4.2 Partition coefficients for a solute in micellar liquid chromatography. K^^ = station- ary phase-aqueous phase, K^^ = micellar phase-aqueous phase, and Kgm = stationary phase-micel- lar phase partition coefficients. arations, much of this chapter, as reflected by the scientific hterature, will be devoted to the use of SDS. The pioneering works ofJorgensen and Lubacs (26) for CZE and Armstrong and Nome (24) for micellar liquid chromatography, both appearing in 1981, provided pieces of a puzzle, the solution of which led to the discovery and devel- opment of MECC. 4.3 SEPARATION MECHANISM A. BASIC CONCEPTS In untreated fused silica, the EOF, which is directed toward the cathode, is sub- stantial at pH values ranging from mildly acidic through alkaline. On the other hand, SDS micelles are anionic and electrophorese toward the anode. As a result.
    • 144 Chapter 4 Capillary Zone Electrophoresis the overall micellar velocity is reduced compared with the bulk flow. These con- cepts are illustrated in Figure 4.3. Electroosmotic flow overcomes the micellar electrophoretic velocity at the aforementioned pH range, resulting in a net micellar flow toward the cathode. Since a solute may partition into and out of the micellar aggregate, its own migration velocity can be affected as well. When partitioned into the micelle, solute velocity is retarded. When present in the bulk phase or interstitial space between micelles, the solute, if neutral, is simply swept through the capillary by the EOF This too appears in Figure 4.3, where a mixture of naphthalene, anthracene, and pyrene represent prototypical neutral molecules. In that mixture, naphthalene elutes first, since it spends more time in the bulk aqueous phase. An illustration of a single-component separation is shown in Figure 4.4. The term t^ is analogous to the chromatographic description of the void volume of the column. Similarly, t^ describes the retention of a solute. The term t^^^^ which describes the velocity of the pseudophase, distinguishes MECC from chromatog- raphy Under most separation conditions, all solutes must elute between t^ and t^c- The fundamental equation for fe' accounts for presence of the mobile pseudophase: ¥ = ^od-^R/fmc) (4.2) Mep" EOF lojp) FIGURE 4.3 Illustration of the micelle being swept toward the cathode by the EOF while coun- termigrating toward the anode. The solutes are partitioning between the micelle and bulk aqueous phase. Separation occurs due to differences in hydrophobic interaction with the micelle.
    • 4.3 Separation Mechanism 145 DETECTOR -Ld- WATER SOLUTE INJECTOR MICELLE i 1 0 IR mc TIME FIGURE 4.4 Representation of the zones separated in a capillary (upper trace) along with the detected electropherogram (lower trace) for a hypothetical mixture of water, solute, and micelle. The broadening of the slowly migrating peaks is a consequence of on-capillary detection (Section 9.1) and diffusion. As the velocity of the pseudophase approaches zero (a true stationary phase), t^c approaches infinity, and Eq. (4.2) reduces to the classical chromatographic expres- sion for ^'.Equation (4.2) implies that as t^^ is approached, the peaks elute at more closely spaced intervals. Terabe et al. (3) recognized this effect is similar to that obtained with concave gradient elution LC for solutes with fe'< 150. The following equation describes the resolution between two solutes by MECC: a - 1 V ^ y l + k2 / 1 - tjt^. l+(tjt^jk[ (4.3) As in Eq. (4.2), when the micellar velocity approaches zero, the equation reduces to the classical expression for chromatographic resolution. The optimal value for k' (maximum resolution) is given by K,. = (t^JO'"- (4.4) The parameters tg and t^^ must be determined experimentally (Section 4.5).
    • 146 B. ELUTION ORDER Chapter 4 Capillary Zone Electrophoresis Prediction of the elution order can be straightforward, provided a homologous series of compounds are being separated. MECC has the capability of separat- ing, within a single run, anionic, neutral, and cationic species. Figure 4.5 shows the separation of a series of peptides that differ only by a single amino acid. Pep- tide 15 has a net charge of -2 and is strongly repelled from the anionic SDS micelle. As a result, the peptide spends much of its time in the bulk phase, thereby migrating the fastest of the group. Peptide 2 has a charge of-1 and is repelled less strongly, so it spends more time attached to the micelle and exhibits a longer migration time than does peptide 15. Peptides 1 and 7 are neutral and are separated based on hydrophobic effects.^ Since these peptides are not repelled from the micelle, the migration times are lengthened relative to the anionic peptides. Finally, the cationic peptides are last to elute. These peptides exhibit strong electrostatic interaction with the micelle, and as a result, both have lengthy migration times compared with the other peptides. Note that the migration order of the charged peptides is the reverse of what is found without the use of the surfactant. In the absence of the micelle, the cationic peptides migrate rapidly toward the cathode, since both the EOF and electrophoretic mobility are in the same direction. The anionic peptides coun- iThe calculation of neutrality is based on the pH of the bulk solution. Since the pH is much lower at the micellar surface (due to an electrical double layer of protons), it is probable that these "neu- tral" peptides are cationic in the micellar domain. »»<<>rt>#S#M>»JI SDS M E C C PEPTIDE i 15 AFDfONG 2 AFDAING 1 AFAAING 1 7 AFKADNG 4 AFKAING ! 10 AFKIKNG CHARGE - 2 - 1 0 0 +1 +2 1 I I I J L_ 10 16 18 20 22 24 26 28 TIME (min) FIGURE 4.5 MECC of cationic, anionic, and neutral peptides. Capillary: 65 cm (45 cm to detec- tor) X 50 i^m i.d.; BGE: 10 mM phosphate, 100 mM SDS, pH 7.0; voltage: 20 kV; injection: vac- uum, 2 s; detection: UV, 200 nm. Courtesy of Applied Biosystems, Inc.
    • 4.3 Separation Mechanism 147 termigrate toward the positive electrode but are swept by the EOF toward the negative electrode. As a result of this, the anionic peptides elute last. For solutes that are not part of a homologous series, prediction of the elu- tion order is a daunting task. Both electrostatic and hydrophobic interaction with micelles are in force. If the solutes are charged, they to will also experience electrophoresis, at least when contained in the bulk solution. The structures of a series of nonsteroidal anti-inflammatory drugs are shown in Figure 4.6. These compounds are all aromatic and have carboxylic acid groups as well. Otherwise, phenyl, biphenyl, naphthalene, and other moieties form the struc- tural features of these diverse compounds. Separations by CZE and MECC are shown in Figure 4.7 (27). There is no apparent rationale for the comparative order of migration of these compounds by either mode of electrophoresis. With reversed- phase LC, the order of elution is peak numbers 3, 1, 5, 2, 4. If only hydrophobic effects were in operation by MECC, the order of elution by LC would be expected to be comparable to that by MECC. Since the factors that contribute to the solutes' migration velocity by MECC are complex, a theoretical approach toward the pre- diction of retention requires a model that considers solute-micelle hydrophobic and electrostatic interactions as well as the solute's electrophoretic properties. HgCO" CHgCOOH CH2CH(CH^2 HgCO'^ CH2COOH jmamrnAcm CH3COOH TCHJffitTK FIGURE 4.6 Structures of nonsteroidal anti-inflammatory drugs.
    • 148 Chapter 4 Capillary Zone Electrophoresis yiLL TIME(MiN.) FIGURE 4.7A CZE of non-steroidal antiinflamatory drugs. Capillary: 64.5 cm (43.5 cm to detector) x 25|Ltm i.d., BGE: 20mM phosphate, pH 7.0; 25 mM SDS; voltage: 25kV; temperature: 30°C; injection: vacuum, 2 sec; detection, UV 230 nm. Key: 1) sulindac, 100 jXg/mL; 2) indomethacin, 100 }ig/mL; 3) tolmetin, 100 |ig/mL; 4) ibuprofen, 100 )J.g/mL; 5) naproxen, 10 |ig/mL; 6) diflunisal, 50 |Xg/mL. Reprinted with permission from J. Liq. Chromatogr., 14, 952 (1991), copyright ©1991 Marcel Dekker. 4.4 SELECTING THE ELECTROLYTE SYSTEM A. SURFACTANT CONCENTRATION A general recipe for an MECC electrolyte includes the surfactant, usually SDS, a buffer to fix the pH, and other additives to adjust k and/or the overall elution range (t^Jt^). The SDS concentration generally ranges from 25 to 150 mM.
    • 4.4 Selecting the Electrolyte System 149 " TrME(MIN.) ^ FIGURE 4.7B MECC of non-steroidal antiinflammatory drugs. BGE: 20mM phosphate, pH 7.0. Other conditions and key as per Fig. 4.7A. Reprinted with permission from J. Liq. Chromatogr., 14, 952 (1991), copyright ©1991 Marcel Dekker. Higher SDS concentrations usually result in longer solute migration times, since the probability of partitioning into the micelle increases. Since SDS is ionic, the current increases as well. As Figure 4.8 indicates, substantial selectivity can be designed into the sep- aration, depending on the degree of interaction between the solutes and the micellar assembly (28). That interaction can be hydrophobic or electrostatic. For example, vitamins B^ and 3^2 ^^^ cationic, thereby forming ion pairs with the anionic micelle. On the other hand, anionic species are repelled from
    • 150 Chapter 4 Capillary Zone Electrophoresis .•-vitamin Bl PL-5'-phosphate vitamin B12 niacin P[/l-5'-phospiiate vitamin B2 phosphate vitamin B2 -vitamin B6 pyridoxyl (PL) nicotinamide pyridoxylamine (PM) 0.05 0.1 0.15 SDS CONCENTRATION (M) FIGURE 4.8 Effect of SDS concentration on the retention time of 11 water-soluble vitamins. BGE: 20 mM phosphate-borate, pH 9.0 plus SDS. Capillary: 65 cm (50 cm to detector) x 50 jim i.d.; voltage: 20 kV; temperature: ambient; detection: UV, 210 nm. Redrawn with permission from J. Chromatogr, 465, 331 (1989), copyright © 1989 Elsevier Science Publishers. anionic micelles. In this case, increasing the surfactant concentration may not affect the migration time unless hydrophobic interactions are significant. It is possible to calculate the optimal surfactant concentration (25): [SURF] = k' + CMC, P V (4.5) Here [SURF] is the optimal surfactant concentration, P^^ is the partition coef- ficient of the solute between the water phase and the micellar phase, and V is the partial molar volume of the surfactant. Since it is necessary to experi- mentally determine some of the parameters of this equation, it is seldom used in practice.
    • 4.4 Selecting the Electrolyte System B. EFFECT OF P H 151 A suitable buffer is chosen, depending on the required pH. Many papers have reported on the use of a phosphate-borate blend. The advantage of this com- position is the maintenance of a common ionic environment over a pH range including 6-11. For reasons not entirely clear, the borate-phosphate blend pro- vided better peak symmetry than a borate-acetate blend for water-soluble vita- mins (28). Following that paper, the buffer blend became self-perpetuating. In most cases, borate buffer, pH 9.3, or phosphate buffer, pH 7, is sufficient. The selection of pH may be based on the pK values of the solutes and the req- uisite selectivity. The ¥ for neutral compounds is pH independent. For bases, ¥ increases as the pH is lowered due to ion pairing with the anionic SDS micelle. For acids, k'decreases as the pH is raised due to ion repulsion with the micelle. Study- ing the impact of pH on migration time and selectivity is useful for selecting the optimal pH for the separation of charged solutes. Figure 4.9 illustrates a migration time versus pH plot for several vitamins (28). The separation is best at pH 8.5. 15 1 | 1 0 z o I- o 8 PL-5*-phosphate vitamin B1 /iiiaan PM-5*"phosphat0 --vitamin B12 -vitamin B6 pyridoxyl (PL) nicotinamide pyridoxylamine (PI 9 pH FIGURE 4.9 Effect of pH on the retention time of 11 water-soluble vitamins. SDS concentration: 50 mM; voltage: 25 kV Other conditions as per Figure 4.8. Redrawn with permission from J. Chro- matogr., 465, 331 (1989), copyright © 1989 Elsevier Science Publishers.
    • 152 Chapter 4 Capillary Zone Electrophoresis In addition to the impact of pH on charge, the EOF is also affected. As Fig- ure 4.10 illustrates, this has a profound impact on the technique. Since SDS is ionized at all pH values studied, Vgp has a constant and negative velocity. The electroosmotic velocity Vgo is positive and changes as usual as the pH is adjusted. The net migration velocity v^^ of the SDS micelle is a function of both v^^ and Vgp. At pH 5, the net migration velocity of the micelle approaches zero. At this point, we have a stationary phase. When pH is above 5, SDS migrates toward the cathode; when pH is below 5, its direction of migration reverses. At low pH, it is necessary run the separation in the reversed-polarity mode. The order of migration, too, is reversed from the high-pH run, since hydropho- FIGURE 4.10 Impact of pH on the EOF (v^o), the electrophoretic velocity of the SDS micelle (Vep), and the net direction of micellar migration (Vmc)- Reprinted with permission from J. Microcolumn Sep., 1, 150 (1989), copyright © 1989 Microseparations, Inc.
    • 4.4 Selecting the Electrolyte System 153 bic compounds spend more time attached to the micelle and elute first. These features are illustrated in Figure 4.11. To speed up the separations, it is advan- tageous to use a coated capillary to completely suppress the EOF (29, 30). Since the bulk liquid is stationary, only solutes that are anionic or partition into the micelle will be swept past the detector. (a) Jn*MIMMM*|W« L L r~T~rT~T~sr-5~?4 tim* Cininut««) (b) 2 y 3 UI—I 1 — X — r 4 1—X—^ 30 •^-IfsIS tlmm (mifiut#s) FIGURE 4.11 Effect of pH on the order of elution of parabens. Capillary: 100 cm (50 cm to detec- tor) X 100 |im i.d.; BGE: 50 mM SDS, 10 mM phosphate, in a, pH 7.0; in b, pH 3.37; voltage: in a, +25 kV; in b, -25 kV; injection: electrokinetic, in a, +5 kV, 5 s; in b, -10 kV, 10 s; detection: 254 nm; Key: (a) (1) methyl; (2) ethyl; (3) propyl; (4) butyl paraben. (b) (1) butyl; (2) propyl; (3) ethyl; (4) methyl paraben. Reprinted with permission from J. High Res. Chromatogr., 12, 635 (1989), copy- right © 1989 Dr. Alfred Heuthig Publishers.
    • 154 Chapter 4 Capillary Zone Electrophoresis 4.5 ELUTION RANGE OF MECC Micellar electrokinetic separations have a limited elution range, which is defined by the terms to and t^^. A. MEASUREMENT OF to Determination of t^ can be accomphshed by measuring the transit time to the detector for a neutral species that has no affinity for the micelle. Methanol, ace- tone, or formamide is typically selected. B. MEASUREMENT OF t mc The calculation of the capacity factor ^'requires the knowledge of t^c^ the micel- lar migration time. This is determined by employing a probe such as Sudan 111, a water-insoluble dye that is bound to micelles (3). When organic solvents are used as additives, the probe method becomes insufficient, since the dye can par- tition into the bulk phase. In this example, the determination of tmc becomes difficult. A homologous series of compounds of increasing hydrophobicity has been employed to determine i^^ by an iterative calculation (31). In this method, a series of dansylated aliphatic amines was employed, includ- ing Ci, C6, Cg, and C12, in a buffer system containing 25% methanol and 25 mM SDS. The migration time of dodecylamine only differed from octylamine by less than a minute despite a four-carbon chain length difference, and so it was assumed that dodecylamine was migrating at a rate close to the micellar veloc- ity. This was tested by plotting logfe'versus the carbon number of all solutes except dodecylamine. A fe'for dodecylamine was then extrapolated. The calcu- lated migration time, assumed equal to t^^^ was used to calculate a new set of K'values using Eq. (4.2). This process was repeated until successive iterations showed no substantial differences in t^c- This technique proved that dansylated dodecylamine could be used as a t^^ marker with an error of only 0.04%. Because of these difficulties, it is fortunate that accurate measurement of t^c is seldom necessary. C. INCREASING THE ELUTION RANGE The peak capacity of MECC is directly proportional to Init^c^to); therefore, increasing the ratio t^c^t^ will increase the number of components that can be resolved in a single run (32). Decreasing the EOF with a treated capillary is one
    • 4.5 Elution Range of MECC 1 5 5 means of improving this ratio (32, 33). When using Cg- or Cis-coated capillar- ies, hydrophobic sites on the capillary are effectively saturated by SDS, so that wall binding is not a problem. Binding of SDS to the capillary wall is sufficiently strong that the net surface charge on the capillary remains anionic, though the charge density, as evidenced by the reduced EOF, is lower than that for bare sil- ica. Since the capillary coatings are usually unstable at high pH, it is better to use other means of increasing the elution range. Organic modifiers can also be used to modify the elution range (34, 35). It is far more productive to consider the use of the modifier as in LC—as a means of adjusting the solute's partition coef- ficient between the chromatographic phases. The selection of the modifier can increase both to and t^^. The use of methanol or other linear alcohols reduces the EOF, whereas acetonitrile has a much lesser effect. The full impact of the use of the organic modifier is illustrated in Figure 4.12 (36). These separations are for a series of impurities found in heroin seizure samples. Many of these impurities are very hydrophobic and elute near t^^. The addition of 15% acetonitrile alters the partition coefficients and dramatically lowers fe'for many of these components. Many organic modifiers are useful in MECC. These include methanol, propanol, acetonitrile, tetrahydrofuran, and dimethylformamide. Acetonitrile has the particular advantage of not affecting the EOF, and the solvent does not absorb in the low UV. The percent modifier that can be added is limited by the impact of the sol- vent on the micellar aggregate. Features such as the CMC, aggregation number, and micellar ionization (rate of exchange of surfactant between micelle and bulk solution) are affected by the percent organic modifier. Generally, the use of less than 25% organic modifier does not totally disrupt the micellar aggre- gate. Higher amounts of modifier may cause sufficient micellar disorder that the separation mechanism is changed. Separations may still occur, due to hydrophobic binding between the nonmicellized surfactant and a solute (37). This technique has been used to separate very hydrophobic compounds such as C20 aryl ketones. Highly concentrated solutions of urea are frequently employed to solubilize pro- teins, DNA, hydrocarbons, and amino acids. The mechanism of solubilization is probably due to a diminished water structure surrounding the hydrophobic solute (38). Both to and t^c are affected, but the elution window increases, as indicated by the decreasing tjt^^ ratio seen in Table 4.1. In addition, the In V values for hydrophobic solutes such as naphthalene, phenanthrene, and fluoranthene show a linear decrease as the concentration of added urea is increased. The current decreases as well, due to an increase in the viscosity (1.66 times as viscous for 8 M urea) of the electrolyte as well as other changes in ionic mobiUties. Separations of 23 PTH-amino acids and eight corticosteroids were reported using this technique without the need for organic solvent modifiers (38). Using
    • 156 Chapter 4 Capillary Zone Electrophoresis ttl O sm < (a) J - A ^ L T 1 1 1 1 T- 16 32 48 TIME (min.) a tso-j a nan a 0 3 7 - | "T I I 1 1 1 1 1 1 1 1 1 O S 1 0 1 S 2 0 2 S 3 0 3 S 4 0 4 5 9 0 S 5 MIKUTES FIGURE 4.12 Impact of the organic modifier on the MECC separation of heroin impurities. Cap- illary: in a, 100 cm; in b, 50 cm x 50 |Im i.d.; BGE: (a) 100 mM SDS, 10 mM phosphate-borate, pH 8.5; (b) 85 mM SDS, 8.5 mM phosphate-borate, pH 8.5, 15% acetonitrile; temperature: 50°C; detec- tion: Uy 210 nm. Reprinted with permission from Anal. Chem., 63, 823 (1991), copyright © 1991 Am. Chem. Soc.
    • 4.6 Alternative Surfactant Systems 157 Table 4.1 Migration Times of the Aqueous Phase and Micelle at Different Urea Concentrations Migration Time Urea Concentration (M) 0.0 2.0 4.0 6.0 8.0 to (min) t^e (min) '-c/'-mc 3.92 14.57 0.269 3.92 16.10 0.243 4.65 22.76 0.204 5.46 30.11 0.181 6.38 6.45 0.175 Buffer: 50 mM SDS in 100 mM borate-50 mM phosphate; voltage: 20 kV. Data from reference (38). computer-aided experimental design, optimization of urea and SDS was accom- plished for pesticides, derivatized amines, and nitrotoluenes (39). Urea-based electrolytes are very useful in keeping marginally soluble mate- rials in solution in a totally aqueous media. Its main problem is absorption in the low-UV region of the spectrum. Since urea absorbs strongly below 230 nm, the solutes must absorb light above that wavelength. D. DECREASING THE ELUTION RANGE Admixtures of SDS and a nonionic surfactant such as Brij-35 (polyoxyeth- ylene-23-lauryl ether) can be employed to form co-micelles in solution. Since Brij-35 is neutral, the mobility of the co-micelle is lower than that of the pure SDS micelle. Thus, t^^ is decreased, while t^ is unchanged. Con- comitant with the reduction in the elution range is a change in selectivity (40-42). While the effects on selectivity cannot be predicted in advance, it is very worthwhile to try this approach. Typical electrolytes for this combi- nation are 20 mM borate, pH 9.3, 25-100 mM SDS, and 10-50 mM Brij-35. The efficiency of the separation can be 2-3 times as great as that with SDS alone (40). Optimization of the system is simple once scouting runs give an indication of separation. 4.6 ALTERNATIVE SURFACTANT SYSTEMS The number of potential reagents for MECC is enormous and overwhelming. The reader should be aware that these alternative surfactant systems represent less than 10% of the world's literature on MECC. A partial listing of surfactants is given in Table 4.2.
    • 158 Chapter 4 Capillary Zone Electrophoresis Table 4.2 Surfactants for MECC Anionic CMC(mM) Sodium dodecyl sulfate (SDS) 8 Sodium decyl sulfate (STS) 40 Sodium taurocholate (STC) 10-15 Sodium cholate (SC) 13-15 Sodium taurodeoxycholate (STDC) 2-6 Sodium deoxycholate 4-6 Sodium lauroyl methyltaurate (SLMT) Catonic Decyltrimethylammonium chloride (DTAC) or bromide (DTAB) 61, 68 Dodecyltrimethylammonium chloride (DoTAC) or bromide (DoTAB) 20. 16 Cetyltrimethylammonium chloride (CTAC) or bromide (CTAB) 1.3, 0.92 Tetradecyltrimethylammonium chloride (TTAC) bromide (TTAB) 4.5, 3.6 Hexyltrimethylammonium bromide (HTAB) Octatrimethylammonium bromide (OTAB) 140 Propyltrimethylammonium bromide (PTAB) Nonionic Polyoxyethylene-23-lauryl ether (Brij-35) Octyl-^-D-glucopyranoside (OG) 25 Nonanoyl-N-methylglucamide (MEGA 9) 19-25 Octyl-^-D-maltopyranoside 23 n-Octanoylsucrose 24 Triton X-100 A. ANIONIC SURFACTANTS The alkyl chain can be varied to change the hydrophobicity of the formed micelles. Surfactants with alkyl chains of less than eight carbons are not very useful, since their CMCs are far too high; however, they can be used as ion-pair- ing reagents to modify selectivity (43-45). Alkyl chains of greater than 14 car- bons pose solubility problems (46). The best alternative to SDS is sodium decyl sulfate (47), though alternatives are not generally needed. B. CATIONIC SURFACTANTS Cationic surfactants have the unique ability to reverse the charge of the capil- lary wall and, thus, of the EOF. Separations are performed using reversed polar-
    • 4.6 Alternative Surfactant Systems 159 ity, where the negative electrode is designated as the inlet. Charge reversal occurs at surfactant concentrations well below the CMC, but without the char- acteristic selectivity that accompanies MECC. Varying the size of the alkyl chain does not change the EOF, but the micel- lar mobility is modified. The longer the alkyl chain, the narrower the elution window (48). In many cases, separations can be performed using either SDS or a cationic surfactant. For those cases, SDS is preferred, unless there are other reasons such as shortened analysis time (49). If low-UV detection is employed, the noise lev- els are higher with the cationic surfactant due to its higher (than SDS) UV absorption. Once a capillary has been treated with a cationic surfactant, it should not be used for any other purpose. C. NoNiONic SURFACTANTS Nonionic surfactants such as Brij-35 can be used to separate charged solutes (50, 51). Presumably, the only interactions between the solute and the micelle are hydrophobic, although it has been reported that nonionic micelles can adsorb ions onto its surface (52). Alkylglycoside surfactants are neutral carbohydrate surfactants. An in situ charge in the presence of borate buffer is developed through complexation (53-57). The ratio of surfactant to borate determines the effective charge. The effi- ciencies appear greater than those found with conventional surfactant systems. Typical electrolytes contain 200 mM borate and 100 mM of the surfactant. Volt- ages are limited to 15 kV in 50-|Lim-i.d. capillaries to avoid heating problems. Sur- factants such as octyl-j8-D-glucopyranoside are commercially available. These surfactants are less hydrophobic than SDS, which contributes to decreased reten- tion of hydrophobic species. D. BILE SALTS Bile salts form micelles with an aggregation number of up to 10 (58). The struc- ture and physical properties of several bile salts are given in Figure 4.13. The molecular structure of these micellar aggregates differs substantially from the long-chain alkyl variety. The hydroxyl moieties all line up in the same plane; thus, the surfactant possesses both hydrophilic and hydrophobic surfaces. These surfactants have limited utility for chiral recognition, but they are use- ful for separating cationic solutes that bind strongly to SDS and for resolving hydrophobic solutes that have a migration time equal to t^c- The interior of the bile salt micelle is less hydrophobic than SDS (59). Other operating character- istics such as pH and organic modifier control are similar to those of SDS, though bile salts are more tolerant of organic modifiers (59). The CMC of
    • 160 Chapter 4 Capillary Zone Electrophoresis COR. BILE SALT SODIUM TAURODEOXYCHOLATE SODIUM DEOXYCHOLATE SODIUM TAUROCHOLATE SODIUM CHOLATE R i OH OH OH OH Ra H H OH OH R3 OH OH OH OH R4 NHCHaCHgSOaNa ONa ONa CMC (M) 0.009 0.006 0.013 FIGURE 4.13 Structure and properties of some bile salt surfactants. sodium chelate does not change appreciably until the methanol content is above 30%. For SDS, changes in the CMC begin at the 10% methanol level. A separa- tion of corticosteroids is shown in Figure 4.14. Rational selection of the appropriate bile salt is not obvious, since it not pos- sible to predict the selectivity in advance. Bile salts have also been mixed with other surfactants to adjust the selectivity of the separation (60, 61). E. MISCELLANEOUS SYSTEMS Complexities and availability notwithstanding, a plethora of reagents and vari- ants of the MECC technique abound in the literature. Polymeric cationic sur- factants such as polybrene can be used for ion-exchange-like separations of acidic compounds (12, 13). The equilibrium model is similar to that presented for secondary equilibrium. Polymerized sodium undecylene sulfate has been used for separation of polycyclic aromatic hydrocarbons (62) in 25 min. These huge aggregates can be thought of having a CMC of 1 molecule. Chiral versions have been used for chiral recognition (63), but none of these are commercially available at this writing. The first reports of the use of microemulsions for electrokinetic separations appeared in 1991 (4, 5). Microemulsions consisting of, for example, hep- tane:SDS:butanol:pH 7 buffer (0.81:1.66:6.61:90.92) can be used for separations
    • 4.7 Cyclodextrins 161 u 12 Time (min) 16 20 FIGURE 4.14 Separation of corticosteroids with a bile salt surfactant. BGE: 100 mM borate, pH 8.45, 100 mM sodium cholate; voltage: 12.5 kV; temperature: 25°C; detection: UV, 254 nm. Key: (1) triamcinalone; (2) hydrocortisone; (3) betamethasone; (4) hydrocortisone acetate; (5) dexam- ethasone acetate; (6) triamcinalone acetonide; (7) fluocinolone acetionide; (8) fluocinonide. Reprinted with permission from the Beckman Chromatogram, August 1990. with a utility similar to MECC (6). Of particular note is the use of such a sys- tem to indirectly determine water:octanol partition coefficients (64). 4.7 CYCLODEXTRINS Cyclodextrins (CDs) are macrocyclic oligosaccharides that are synthesized by the bacterial enzymatic digestion of starch. The basic structures comprise six, seven, or eight glucopyranose units attached by a-1,4 linkages and are referred to as a-, /3-, and /-cyclodextrins. In addition to the native CDs, many deriva- tized cyclodextrins are now used, particularly for chiral recognition. The interior of the CD is quite hydrophobic and is optically active. Figure 4.15 shows a view of a-CD looking down into the molecule. The shape of the
    • 162 Chapter 4 Capillary Zone Electrophoresis f i n (IBb^tlnaQrit woe at 0 6 Cftrboiw > FIGURE 4.15 Structure of a-cyclodextrin. Reprinted with permission from J. Liq. Chromatogr., 15, 961 (1992), copyright © Marcel Dekker. molecule is cylindrical, except the diameter is tapered; this is called a torus. This is better illustrated in Figure 4.16, which also shows the nature of the inclusion complex. CDs can effectively solubilize poorly soluble solutes by formation of an inclusion complex, provided the size and shape of the compounds conform to the interior dimensions of the torus. It is also possible that a solute can sit at the opening of the CD. The important physicochemical characteristics of CDs are listed in Table 4.3. Single-ring aromatic solutes with few side chains are best separated using a-CD. /3-CD is best for one- to two-ring aromatic compounds, whereas y-CD is used for even larger molecules. The solubility of native /J-CD is poor. The material can be solubilized with urea, but functionalized CDs such as hydrox- ypropyl-/?-CD effectively solve the solubility problem. Most electrokinetic applications employing CDs are in chiral recognition, which we cover in Section 4.9. Cyclodextrins can be used for secondary equi- librium in achiral separations as well. For example, the addition of 2 mM dimethyl-/?-CD in 25 mM borate adjusted to pH 2.4 with phosphoric acid is used in the stability-indicating separation of the drug ranitidine from its impu- rities and degradants (65).
    • 4.7 Cyclodextrins 163 OH ***C;ir''*'—V-»w.-.'' /Estradiol FIGURE 4.16 Possible appearance of an inclusion complex between estradiol and a cyclodextrin. Reprinted with permission from J. Liq. Chromatogr., 15, 961 (1992), copyright © Marcel Dekker. The use of cyclodextrins follows the general principles of secondary equi- librium, which were outlined in Section 3.5. If the solutes are charged and have identical mobilities, then a neutral or charged CD can be employed. If the equi- librium constants for the formation of the inclusion complexes differ, then a separation will occur. If the solutes are neutral, then a charged CD is required. For example, CDs were used to separate structural isomers of substituted ben- zoic acids (66). When using a charged CD such as sulfobutylether4-j8-CD, the anionic CD countermigrates against the EOF much as the SDS micelle does. In this regard, the CD can serve as the slowly moving "phase" in electrokinetic chromatography Since micelles are so effective for this task, CDs are not as widely used, except in the area of chiral recognition. Table 4.3 Important Characteristics of Cyclodextrins Parameter Molecular weight Diameter of cavity (A) Volume of cavity (A^) Solubihty (g/100 mL, 25°C) Molecules per unit cell a 972 4.7-6 176 14.5 4 Type of CD P 1135 8 346 1.85 2 7 1297 10 510 23.2 6 Data from Luminescence Applications in Biological, Chemical, and Hydrological Sciences, ACS Sym- posium Series 383, p. 169.
    • 164 Chapter 4 Capillary Zone Electrophoresis In addition to the aforementioned achiral separation of benzoic acid struc- tural isomers, cyclodextrins have been used in achiral applications including estrogens (67), positional isomers of methylbenzoates (68), leukotriene posi- tional isomers (69), and ergot alkaloids (70). The BGE for the ergot alkaloids consisted of 20 mM j8-CD, 8 mM y-CD, 2 M urea, 0.3% polyvinylalcohol in phosphate buffer, pH 2.5. When used in conjunction with mass spectroscopy, concentrations of up to 20 mM did not interfere with detection (71). Differences in the mechanism of separation with micelles or cyclodextrins account for the greater applicability of micelles in HPCE separations. The rela- tionship between a solute and a micelle is a surface interaction. For CDs and solutes, an inclusion complex forms. This imposes steric factors, which are not found when micelles are employed. Because of these mechanistic differences, the combination of micelles and cyclodextrins is particularly powerful, especially for nonpolar compounds such as polycyclic aromatic hydrocarbons (72) and positional isomers of nitroaro- matic compounds (73). The separation mechanism for CD-MECC is illustrated in Figure 4.17. Micelles and CDs coexist in aqueous solution with little interaction. Underivatized CDs are neutral and have a hydrophilic outer surface, and so there is little driving force for micellar interaction. The CD in this example is simply carried by the EOF NEUTRAL CD ANIONIC MICELLE EOF INCLUSION COMPLEX FIGURE 4.17 Separation mechanism of CD-MECC. The solute partitions between the micelle and a cyclodextrin.
    • 4.7 Cyclodextrins 165 toward the negative electrode. SDS micelles electromigrate toward the positive electrode as usual. Hydrophobic solutes that are normally bound to the micelle can form inclusion complexes with the CDs. The separation mechanism is then based on differences in a solute's partition coefficient between the micelle and the CD. Increasing the CD concentration will decrease ¥ for compounds that form inclusion complexes within the micelle, as shown in Figure 4.18. Whereas Fig- ure 4.18 illustrates a decrease in k'for some corticosteroids with j3-CD, there was little change in the selectivity. The use of /-CD, shown in Figure 4.19, provides substantial improvements in corticosteroid separations. The larger cavity of the 7-CD better accommodates the bulk of the steroid moiety. 1 30 40 50 p-CD CONCENTRATION {mM) FIGURE 4.18 Effect of j3-CD concentration on 1/k'of corticosteroids. BGE: 50 mM SDS, pH 9.0, borate-phosphate with 4.0 M urea; capillary: 50 cm length to detector x 50 jLim i.d.; voltage: 20 kV; temperature: ambient; detection: UV, 220 nm. Key: (a) hydrocortisone; (b) hydrocortisone acetate; (c) betamethasone; (d) cortisone acetate; (e) triamcinolone acetonide; (f) fluocinolone acetonide; (g) dexamethasone acetate; (h) fluosinonide. Redrawn with permission from J. Liq. Chromatogr., 14, 973 (1991), copyright © Marcel Dekker.
    • 166 Chapter 4 Capillary Zone Electrophoresis 15 30 Y-CD CONCENTRATION (mM) FIGURE 4.19 Effect of y-CD concentration on the migration times of eight corticosteroids. The dashed hne indicates the migration of methanol, an unretained EOF marker. Other conditions as per Figure 4.18. Redrawn with permission from J. Liq. Chromatogr., 14, 973 (1991), copyright © Marcel Dekker. 4.8 APPLICATIONS AND METHODS DEVELOPMENT A summary of applications and buffer recipes, beyond those already discussed, is given in Table 4.4. The balance of this section is devoted to two separations: urinary porphyrins (120) and drug seizure samples (36). From the first, a basis for methods development is provided. The second method provides a strong argument supporting HPCE for small-molecule separations.
    • 4.8ApplicationsandMethodsDevelopment167 u u OH 1 u ex Q -^LA oB X- %H B in ON'CK tn QCO aoin 00^ E D^ /iT LO Q so(N QJ" o o in iK 00 X p. (U" C« o -9J> Q m B in fN 00^ 00 X Pu p ^asPHpLiP3-r^ B4dCL,(Uaj O ^o nl(^ Q00*" ^en p-P- S s -^Q^"^ PH 1B'BBB cyiP-. ^SSS sssaOOOO(N S2 u o rP P. P u 3c4 p LO s a § ;rjinm ^5^ So^ «^r~i'^ r-400 §00 P. o» ^o p^m PH ^X PH PH-^O in-^ inS o PH a ^2^^.^ rP a-5 i:^PH o-5 C/5P^ aa rorHm ^-^;^'a.y OJpXS ^^N^^7-* PH a a •Pn 36 <d<PQpqpqPQUU p •coPH en Si 13 PH 4J U cn >>^fH* O o 2 u tn 4J 00 <U W .a "3X! U -5X
    • 168Chapter4CapillaryZoneElectrophoresis CO^Tj-invor^ G^fOON0>ON0^ ^ ^ Q in^ ex ^o ON<^ aQ X o^o XB '^.in O 1-§^^ o!^"^.^ CD^r o X00E 5S :::^Q inu^ oo *-NcCrr*cCcC o-S ooOOO ron4(N s f5o So OX o -3 o COr-H ys •^in 12 ^ S <u C o(U O ^<u w o <y) Dcyi S F2 P ON X v/-> nCT) s S SBr O S o,0 X BB u ;3 ^ ^ ^<I O z < z QQWW a[5W XOS o 2 o -a o -^>-i(TSRSnsi; U4Jij*J XKXX.5S ^^-^^a^ 'S
    • 4.8ApplicationsandMethodsDevelopment169 mT^in^h-00 r^(NfN(NfS<Nin r^^rH^r^^00 B o op—( ON Pi o ^ :§ g in oT C« ^P. in O ^P- in Q o o vq ON P: p- (S « PH O M P^ S 3 IB ^S2 g o B o p N m Pi CO O P. :§ in d p sh- •^!>-i H S 6 o 0J3 B o Q S eo o h-T E PH <iJ t^ ^P. CD O ^Pi S sO ty-! P S so o t-^r X PH lu" c« ,fi Pi ID O ^P. S so (N(N(Nin^.—^rH :3 ^^ tJO&t) o5fS §5o C/5 ^PH O P3 > -d PH <u OH P O OS o CJ OS 2CC _CJ ^'o pu en P 1xr "o01 C3 42 XS P 03 P Crt" Cfl <U PM 3, S o p N -13 P cs P U C/5 ')-1 &oPH 1 P "S-H Pi oPH _p '^ ^Pi o 2PP ^^T3_P .s p eu if) d) "C3 aOS p _o "3en o >< OSH CU O -SSlU a'Xi p OS !U _P T^ rP PH o(U rSH H GO P !M t3 W -5o -13 P OS <u _P ^rSli PH O tu rP H *"'.JHPuS oc5rt 'Si;."S03 H>X .2t^ 1^1 p "Pi (inO S2 2B ^B .3u P^ SX iM It 11 II ^^ CO3 PH O P^ PHN O. CJrH o •p o s B A^-B oPi<u 03^i4. II P:s'? 'S^^ ^^p^ '5Sg II-g.^ •i" isU ,2£;s ^MH^ IIp" P^Q B p
    • 170 A. URINARY PORPHYRINS Chapter 4 Capillary Zone Electrophoresis Urinary porphyrins are important precursors in the biosynthetic pathway lead- ing to hemoglobin. Various disease and toxic states interrupt the synthetic cas- cade, leading to a buildup of porphyrins in urine and other body tissues. These conditions are known as porphyrias. The quantitation of some of the various porphyrins are diagnostic for many of these conditions. The structure of mesoporphyrin, a synthetic porphyrin not found in nature, is shown in Figure 4.20. Other species differ in the degree of carboxylation at the perimeter of the porphyrin ring structure. Mesoporphyrin is doubly car- boxylated, followed by coproporphyrin (4 COOHs), pentacarboxylporphyrin (5 COOHs), hexacarboxylporphyrin (6 COOHs), heptacarboxylporphyrin (7 COOHs), and uroporphyrin (8 COOHs). At the time of this work, the author was involved in the development of a fluorescence detector for HPCE. Since these compounds fluoresce strongly and have many charge states, they were considered an ideal application for this detector. Porphyrins are usually determined by LC via gradient elution. Since the important porphyrins contain between two and eight carboxylic acid sub- stituents, they are good candidates for HPCE as well. A CZE separation is shown in Figure 4.21 and compared with one by HPLC. Isomers of hexacarboxylpor- phyrin not separated by LC are clearly resolved by CZE. The elution order is reversed for the two techniques. By LC, the more polar carboxylated porphyrins VH2CH3 COOHCHaCHi CH3 FIGURE 4.20 Structure of mesoporphyrin.
    • 4.8 Applications and Methods Development 171 m m z oa. m m (£ m o z m O m ui tc O 3 LC 1 m til 1 O m I m m 1 '' U 1 i i ii 1 jyuiii ]±0 TIME (MIN.) M 1 2 ^^'**»*4*-u»i**<^ CE 3 UteM»Mt/ ! ^ i 1 s J 4 *WH i 1 /WMMMAA* 1 [o 12 1 TlME(min.) FIGURE 4.21 (Main figure) CZE of urinary porphyrins. Capillary: 72 cm (50 cm to detector) x 50 ]im i.d.; BGE: 20 mM CAPS, pH 11, with 10% methanol; sample porphyrin test mix, 5 nmol/mL in methanol:20 mM CAPS (50:50); injection: electrokinetic, 12 s at 10 kV; voltage: 30 kV; detection: fluorescence; excitation: 400 nm; emission wavelengths > 595 nm. (Inset) Gradient elution reversed-phase LC of urinary porphyrins. Key: (1) mesoporphyrin (dicarboxyl); (2) copropor- phyrin (tetracarboxyl); (3) pentacarboxyl porphyrin; (4) hexacarboxylporphyrin positional iso- mers; (5) heptacarboxyl porphyrin; (6) uroporphyrin (octacarboxyl). Reprinted with permission from J. Chromatogr., 516, 271 (1991), copyright © 1991 Elsevier Science Publishers. elute first. By CZE, the most highly charged porphyrins migrate toward the pos- itive electrode but are swept toward the negative electrode by the EOF. In this case, the more polar and charged species elute last. Although the CZE separation appears adequate, repeated runs show a merg- ing and broadening of peaks, characteristic of solutes binding to the capillary walls. Since the porphyrins are all anionic, mesoporphyrin, which is poorly sol- uble, binds through hydrophobic interaction of the uncharged quadrant of the
    • 172 Chapter 4 Capillary Zone Electrophoresis molecule with the capillary wall. This is indicated in Figure 4.21 by the short broad band surrounding peak 1. The porphyrins are anionic and hydrophobic, and thus MECC seemed appro- priate, since SDS is anionic and hydrophobic as well, thereby increasing the like- lihood that the active sites on the capillary wall would be saturated. The mechanism of separation would be expected to resemble the separation with- out surfactant, since the anionic porphyrins would be expected to be repelled from the anionic micelle. In 100 mM SDS, pH 11 (Figure 4.22A), the elution order is the same as CZE except for mesoporphyrin. Mesoporphyrin has its carboxylate groups located on one quadrant of the molecule. The other side of the molecule is free to interact hydrophobicly with the micelle. At 150 mM SDS (Figure 4.22B), the mesoporphyrin exhibits a further shift in migration time that is consistent with this argument. £ c o o z O Q. S w m < 100 mM SDS 6, 3J 150 mM SDS 13 B m14 TIME(min.) FIGURE 4.22 MECC of urinary porphyrins: Capillary: 77 cm (55 cm to detector) x 50 |lm i.d.; sample: porphyrin test mix, 20 nmol/mL dissolved in 20 mM CAPS, pH 11, 100 mM SDS; (A) run BGE: 20 mM Caps, pH 11, 100 mM SDS; voltage: 20 kV; temperature 45°C; (B) run BGE: 20 mM Caps, pH 11, 150 mM SDS; voltage 20 kV; temperature 45°C. Key: see Figure 4.21. Reprinted with permission from J. Chromatogr., 516, 271 (1991), copyright © 1991 Elsevier Science Publishers.
    • 4.8 Applications and Methods Development 173 For coproporphyrin, peak 2 exhibits fronting. This is due to a solubihty problem, wherein it is not very soluble in the bulk solution nor in the micelle. An organic modifier was employed to solve the solubility problem (Figure 4.23). With 15% methanol, a sharper peak is obtained, but the time of separa- E c o o g a. QC O m < 85 fiiM SOS, 17 fflM CAPS pn n 15% M«OH 20 KV; 45 C c JU 20 KV; 55 C D 30 KV; 45 C ^ 3j 3 13 TIMEdnin.) FIGURE 4.23 MECC of urinary porphyrins with an organic modifier. Capillary and sample: see Figure 4.22; BGE: 85 mM SDS, 17 mM CAPS, 15% methanol; (C) voltage: 20 kV; temperature: 45°C; (D) voltage: 20 kV; temperature 55°C; (E) voltage: 30 kV; temperature: 45°C. Key: see Fig- ure 4.21. Reprinted with permission from J. Chromatogr., 516, 271 (1991), copyright © 1991 Else- vier Science Publishers.
    • 174 Chapter 4 Capillary Zone Electrophoresis tion is prolonged due to a reduction in the EOF Acetonitrile would have been a better choice of modifier, since it does not reduce the EOF To speed the sep- aration, both increased temperature and increased voltage were applied. At 30 kV, 45"^C, the time of separation is only 13 min, and the coproporphyrin peak is now very sharp. Next, a urine sample taken from a patient suffering from porphyria cutanea tarda, a genetic disorder, was run (Figure 4.24). Characteristic of this disease is Ui in z oa. en m tc m O z UI o CO m tr, o 3 PHOTOOEGRADED STANDARD 6 PATIENT SAMPLE U 3 TIMEdnln.) FIGURE 4.24 (Main figure) Electropherogram of a urine sample from a patient with porphyria cutanea tarda. Sample preparation: centrifugation of urine for 1 min; injection: 2 s vacuum (10 nL). (Inset) Electropherogram of partially decomposed porphyrins in a urine sample. Other conditions given in Figure 4.22A. Key: see Figure 4.21. Reprinted with permission from J. Chromatogr., 516, 271 (1991), copyright © 1991 Elsevier Science Publishers.
    • 4.8 Applications and Methods Development 175 an elevation of peaks 5 and 6. Splitting of these peaks was noted. Perhaps the porphyrins were further separated into various classes. Standards of type I and type III isomers were studied, and it was found that separation was not occur- ring. However, a photodegraded standard showed the same splitting pattern, and that is why all porphyrin labs are kept dark. The splitting in the sample was due to photodegradation during a 24-h urine collection. To complete this story, the type I and type III isomers of copro- and uropor- phyrin were separated by affinity capillary electrophoresis (ACE) using an elec- trolyte containing 20 mM phosphate, pH 1.6, and 0.03 mM bovine serum albumin (129). Bile salt micelles also served to fractionate the isomers. A BGE containing 60 mM deoxycholic acid, 15% acetonitrile, and 10 mM borate was effective for this purpose (130). As will be described later, this porphyrin appli- cation has a few more surprises in store. B. DRUG SEIZURE SAMPLES HPLC is a superb technique for small-molecule separations. Figure 4.25 shows the HPLC separation of a series of drug standards that are used for screening of seizure samples by the U.S. Drug Enforcement Administration (DEA) (36). The separation employs a complex gradient and uses hexylamine to cover free silanols. The separation time is nearly 1 h including the gradient reequilibra- tion step. Fine-tuning this separation took many weeks. 3 a: e 1 5 0 0 - 1 0 0 0 - 5 0 0 - 0-^ n n- j M o nwU z o X M L. itSi i IT 2 o 9 z 5 m -< u r < ir O X S 5 n .•.qJW-^ 3» n -4 •< I r ooD mM Z n i _J a: o 1 M z 1 1T" H X n Z ; O m m 1H •-* s r i1 JU 1 o to o IB T) w Z w Tl 3) H <n z n 1 — ^ — 1 — ™ — r — 3 1 m 1 ~4 1 i s38 I r ?fl 1 J 10 2 0 T1 me C m f n• ) 3 0 FIGURE 4.25 HPLC of a heroin seizure sample. Column: Partisil 5 ODS 3, 11 cm x 4.7 mm; mobile phase: (A) phosphate buffer, pH 2.2 with 23 mM hexylamine; (B) methanol; gradient: 5% B to 30% B over 20 min, hold for 6 min, 30% B to 80% B over 10 min, hold for 4 min; flow rate: 1.5 mL/min; detection: UV, 210 nm. Reprinted with permission from Anal. Chem., 63, 823 (1991) copyright © 1991 Am. Chem. Soc.
    • 176 Chapter 4 Capillary Zone Electrophoresis In 1990, the DEA decided to attempt this separation by MECC. The ratio- nale for using MECC was to apply the method to acidic, basic, and neutral drug substances simultaneously. During the course of an afternoon's work, the sepa- ration shown in Figure 4.26 was developed (36). The separation was not opti- mized, but the run time was much shorter than for HPLC. Unlike the HPLC separation, where resolution was barely adequate, the MECC separation time could be shortened by reducing the capillary length and using a lower concen- tration of SDS. That separation is shown in Figure 4.27. Including the reequili- bration time, the MECC separation is now 10 times as fast as HPLC. The same BGE can be used for screening cocaine samples. For screening of drug seizure samples, a single CE unit could replace 10 liquid chromatographs. C. A BASIS FOR METHODS DEVELOPMENT AND OPTIMIZATION The remarkable ability of electrokinetic chromatography to provide a few hun- dred thousand theoretical plates permits complex separations to be performed. l.OOO-j 0. 875H 0.75CH 0.825H 0.50DH 0.3754 0.25OH 0. 125H O.OOCH S € S II sfg i ? I Jv.. .«^ « I 8 I U "~T T " 8 7 MINUTES 10 n 12 "~r" 13 ~1 14 FIGURE 4.26 MECC of a heroin seizure sample. Capillary: 25 cm x 50 [im i.d.; BGE: 85 mM SDS, 8.5 mM borate, 8.5 mM phosphate, pH 8.5, 15% acetonitrile; voltage: 20 kV; temperature: 40°C, detection: UV, 210 nm. Reprinted with permission from Anal. Chem., 63, 823 (1991) copy- right © 1991 Am. Chem. Soc.
    • 4.8 Applications and Methods Development 177 "l>wniwii.ii»M i I I 0 e s I a TIME (min) FIGURE 4.27 MECC of a heroin seizure sample. Capillary: 20 cm X 50 |lm i.d.; BGE: 50 mM SDS, 10 mM borate, 10 mM phosphate, pH 8.5,15% acetonitrile; voltage: 30 kV; temperature: 30°C, detection: UV, 210 nm. Courtesy of Ira Lurie. frequently without the need to employ chemometrics-based optimization schemes. Following a scheme such as that illustrated in Figure 4.28 will usu- ally lead to an adequate separation, often during the course of less than a day of experimentation. More often than not, the 100 mM SDS, 20 mM borate buffer will yield a good starting point. Switching to surfactants other than SDS is normally beneficial for the sepa- ration of nonpolar substances or when SDS alone gives too much or too little retention. Even in the former case, the use of cyclodextrins permits the separa- tion of nonpolar species such as aromatic hydrocarbons. Usually, alternative sur- factants should be considered only after other experiments covering pH, modifiers, and so forth have been performed using SDS—unless, of course, a suitable reference has been located. Most problems will be solvable using SDS or SDS with various additives. Even if a publication reported on an alternative surfactant system, the separation may be possible with SDS. Often, several dif- ferent surfactant systems are suitable for a given problem. On the other hand, bile salts are useful for separating rigid planar molecules such as steroids (131). The sterol architecture resembles the steroid structure; thus, the old adage from freshman chemistry, "like dissolves like," applies here. In a similar fashion, the planar macrolide antibiotics are well separated using
    • 178 Chapter 4 Capillary Zone Electrophoresis Scouting Runs 25-150mMSDS,pH9.3 ionic Soiutes Adjust pH No No Non-Polar Solutes Urea. CD. Blie Salt Yes Yes Fine tune and complete Yes No Yes Cationic Surfactants Non-Ionic Surfactants Mixed Micelles No Try Another Technique 0 No Non-Ionic Surfactants Mixed Micelles Organic Solvents FIGURE 4.28 An empirical scheme for methods development using MECC. bile salt surfactants (105). In any event, a few scouting runs should point you in the correct direction. Once the appropriate system has been identified through scouting runs, opti- mization is usually straightforward. Adjustments in pH and additive concen- trations should be carefully studied. It is best not to rely on a long capillary to perform the separation, although this may become necessary when many com- ponents are being resolved. In complex samples, solving the separation of a pair of overlapping components often causes coelution of other solutes. For these situations, statistical tools can be a valuable tool for speeding meth- ods development. This can be particularly true when ternary blends of solvents or cyclodextins are needed to optimize the separation. For example, overlap- ping resolution maps (ORM) have been used for years to optimize HPLC sepa- rations. In 1991, this technique was used to optimize the separation of plant growth regulators using mixtures of a-, /?-, and /-CD (132), and in 1997, it was applied to optimize the separation of quinolone antibacterials using cholate and heptane sulfonate (133). A pure chemometric approach using Plackett-Burman statistics has also been shown useful in the separation of testosterone esters (134). While these tools are not often used, they should be considered when trial and error proves frustrating.
    • 4.9 Chiral Recognition 1 7 9 4.9 CHIRAL RECOGNITION A. BASIC CONCEPTS Chiral recognition of racemic mixtures continues to be an active area of research in gas chromatography, hquid chromatography, and of late, capillary elec- trophoresis. Whatever the separation technique employed, chiral recognition is obtained in one of three ways: 1. Formation of diastereomers^ by additives to the mobile phase or carrier electrolyte 2. Formation of diastereomers through interaction with a stationary phase or the functionalized capillary wall 3. Precolumn (capillary) derivatization with an optically pure derivatizing reagent In the first two cases, diastereomer formation is transient, occurring via elec- trostatic and/or hydrophobic mechanisms. Since derivatization is not employed, the enantiomers are directly separated. In the third case, covalently bound deriv- atives are separated by MECC. Derivatization is advantageous when the solute lacks a good chromophore. In this case, the problem of chiral recognition and that of detection sensitivity both are solved in a single step. Chiral recognition in HPCE employs secondary equilibrium for the separa- tion of enantiomers. Reagents such as cyclodextrins, bile salts, mixed micellar systems with chiral surfactants, crown ethers, macrocyclic antibiotics, proteins, heparins, dextrins, oligosaccharides and other carbohydrates, and trimolecular peptide-Cu(II)-amino acid complexes and MECC resolution of preformed diastereomers have all been reported. Polymerized surfactants and cyclodex- trins have also been used, but these are not currently available. Other unusual reagents for chiral recognition appear in the literature as well. A summary of applications and buffer recipes is given in Table 4.5. HPCE is distinctly supe- rior to LC for chiral recognition in cost, speed, and resolution. Chiral columns for LC are relatively expensive. B. METAL-ION COMPLEXES The first examples of chiral recognition in HPCE employed the addition of Cu(II) and L-histidine to the buffer solution to resolve dansyl amino acids via a trimolecular complex (135). A Cu(II)-aspartame complex was later shown to be superior (47). Addition of a surfactant can improve the hydrophobic aspects of the separation, permitting the simultaneous resolution 14 out of 18 dansyl ^Diastereomers (also called diastereoisomers) are stereoisomers that contain at least two asym- metric centers that are not mirror images of each other.
    • 180Chapter4CapillaryZoneElectrophoresis i^ooa^OrHrvJcn-^fNin^h-oooNOr—I(Nro U 00 X ex U O as Q IT) s .2SS O U ^dj I"^ o2^ 'li SOS S" _^o^ mm.—(m Q U pa £ Q U £ D. 1/1 O D. S £ X 1if) H S £ o > Q O uo CI. U U PQ £ £ PC op £ (/)o ss >-o oo m(N Q U Q £ X X :^a^:ii O u2o' ^.£S S£ £ o £ ^o Xo ^ D. O ^;c-c SSS £££ ^•^.£ <:« i-3 OU )^PS P3O ^O P.rH Oto ^;C p.H ££ oo oo U P u £ pa 'u £ £-fi Pw 0V d'^ 00"^^ p. a;b(N ^^a, 1-O O PHm "§ -^'C_^ti^ pa £ C/5^• PH r-l,—Ir-HLOJ^fN C/5 O 2^ PH^ 2£ PHO pa •fi<I o £ c/T.y £^ ^X £ PH O -^3 < B <OOU (/) CJ -5 o P £ <uN .2 r^ b <u o NOS C O •£ D p N C3 P O a '£ 5 pp £c« C _C P p BI/) ^pV5 bJO gQ in £ c/T u P B to ^p 00 p ;>H o OTP-P
    • 4.9ChiralRecognition181 U P U '=4 ^^^ X Q U CO. 6 ri X H s o X &. X u w d W a U 3 P U CO. o P<N oB u "=4 p u T3 P u 6I 62 p u B 00 d < 82 1•§ '5^p 2-g <u <u 2r^ CDO O^ PH o PH o p. s s PH 43 PH en O PH P U CO. o Q-5 X p- PH p. UB o P- p P. p 'PH W V5 'o 1C3 o ^ w PH 3 ^ c"^ o PH O P PH U 3'<j 'u 3 X og^ u P^OP T3O PcS a> •;jp iS;2P^PH b^ PHLO P P OS p (-2 ^11 6II PP 2B §1 c^P "I z" IIcy p3' oi.^ T!'^ -5-?. IIOS v^ pII Vp «^ 'B^><^ IIcxii. 2 w P U^ -pp B^ IIINII «Q oV^ IIg2 o P-'^^ pp-^ o pili PH CD O pXi PH B in (N n3
    • 182 Chapter 4 Capillary Zone Electrophoresis amino acids (47). The use of 2.5 mM CuS04»5H20, 5.0 mM aspartame, and 10 mM ammonium acetate, pH 7.2, gave the best separation. Addition of 20 mM STS provided hydrophobic selectivity via the MECC mechanism. The capillary had to be rigorously conditioned with 100 mM phosphoric acid for several hours to remove any metal hydroxides that may have been precipitated at the capillary wall. After rinsing for 10 min with KOH, the capillary was conditioned in acetate buffer for 10 h. Amino acid separations are the only known applica- tions of this technique. C. CHIRAL SURFACTANTS AND MIXED MICELLES Separations have been reported employing a mixture of SDS and optically active surfactants such as N,N-dodecyl-L-alanine [in the presence of Cu(II)] or sodium N-dodecanoyl-L-valinate (SDVal) (17, 173). Separations reported to date have been limited to derivatized amino acids. Mixtures of SDS with the nonionic optically active surfactant digitonin (140) have been reported to separate PTH-amino acids. A low buffer pH was selected so that electrophoresis greatly dominated electroendosmosis. The separation times were lengthy, and the early eluting solutes were not adequately resolved. Surfactants specifically designed for chiral separation are commercially avail- able^ (148, 174). The surfactants are either of the enantiomers of N-dodecoxy- carbonylvaline. By selection of the alternate enantiomer, the order of elution of the chiral solutes can be changed. This is advantageous, since it is often desir- able to have the trace enantiomer elute first. Separations are scouted and optimized in a similar fashion as in conventional MECC. For hydrophobic neutral solutes and bases, 25 mM surfactant concen- tration in 50 mM borate is usually sufficient. Acetonitrile can be added if the solutes elute near t^^. For acidic solutes that are repelled from the anionic micelle or for hydrophilic neutrals and bases, the surfactant concentration can be raised to 100 mM. The surfactants are not soluble under acidic conditions. D. CYCLODEXTRINS Cyclodextrins (CDs) are the reagents of first choice for chiral recognition. Results such as that illustrated in Figure 4.29 are frequent occurrences. The vast majority of the reported HPCE chiral separations employ these compounds. The first HPCE reports appeared in 1988. In one article, the cyclodextrin was incor- porated in a rigid gel (19); in another, HPCE with CDs was used for isota- chophoretic separations (175). The following year, the use of CDs as electrolyte additives in chiral CZE appeared (18), although CDs were reported for achiral ^Enantioselect, Scientific Resources Inc., Eatontown, NJ.
    • 4.9 Chiral Recognition 183 10 o CM ^ u 1 ^ 2 4 mm. FIGURE 4.29 Separation of (+) and (-) terbutaline with 5 mM heptakis(2,6-di-0-methyl)-)8-CD. Capillary: polyacrylamide-coated 20 cm x 25 liim i.d.; BGE: 100 mM phosphate, pH 2.5; constant cur- rent: 19 (xA; voltage: 9 kV; injection: electrokinetic, 8 ky 10 s of a 10~5 M solution. Reprinted with permission from J. Chromatogr., 545,437 (1991), copyright © 1991 Elsevier Science Publishers. separations as early as 1985 (9). Since that time, hundreds of papers have appeared in the hterature. The first generation of cyclodextrins were the native a-, j8-, and y-CD. Because of the relatively low solubility of j3-CD and the inability of native CDs to resolve all enantiomers, it was not long before CD derivatives were used in HPCE (176-178). The next generation were the negatively charged sul- fobutylether-/3-CDs (179).^ This CD is charged at all pH values and, like SDS, countermigrates against the EOF. The fourth generation are the highly substi- tuted single-isomer CDs (180,181). These materials are well characterized and prevent the possibility of the separation being affected by the isomer content of the CD. These and similar highly sulfated CDs are commercially available.^ Because of the high currents that are generated, a 25-|am-i.d. capillary is gener- ally required when highly charged CDs are used, but their resolving power is usually superior to other reagents. They are also quite expensive. "^Available from Cydex, Overlook Park, KS, and Bioscience Innovations, Lawrence, KS. 5Regis Chemical, Morton Grove, IL, and Beckman Instruments, Fullerton, CA.
    • 184 Chapter 4 Capillary Zone Electrophoresis Chiral recognition kits and protocols are available from a number of instru- ment manufacturers, including Hewlett-Packard and Beckman Instruments. Cyclolab, a company located in Budapest, Hungary, specializes in CDs and offers many different derivatives of all three native materials. The mechanism of chiral resolution is based on differences in the complex stability between each enantiomer and the CD. The basic principles of sec- ondary equilibrium apply here. The Wren and Rowe model, which is generally applicable to secondary equilibrium, was originally developed for chiral recog- nition with CDs (182-184). If the solutes spend either too little or too much time attached to the CD, no separation occurs. Then, the CD concentration or type must be changed. For solutes that are too strongly bound, the addition of organic solvents can be helpful. Both hydrophobic inclusion within the CD and hydrogen bonding between the analyte and CD hydroxyl groups are in part responsible for resolution. The molecular fit of the solute within the CD cavity is critical if chiral recognition is to be obtained. It is generally not possible to predict if a separation will occur. More sophisticated models have recently appeared in the literature that seek to explain the relationships of pH and CD concentration on chiral separations. The models also account for the reversal of elution order at different pHs (185-187). While not covered here, elegant 3-D graphs provide an under- standing for the development of optimal conditions. The relatively long history of LC and GC provides a framework for deter- mining if applications will be successful. Armstrong's empirical procedure employs molecular structure to predict enantioselectivity in LC using a func- tionalized/J-CD (188). In this model, sp^-hybridized carbons connected to the stereogenic center were found to provide enhanced resolution. Conversely, sp^- hybridized carbons showed diminished stereoselectivity. Amido groups improved selectivity, especially when associated with ;r-acid (3,5-dinitroben- zoyl) or ;r-basic (naphthyl) groups. These studies employed 121 compounds to develop the model. Most of the reported literature on CDs employs CZE on uncoated capillar- ies. It is possible to immobilize CDs in a gel (19) or use a coated capillary with immobilized CD (189-191). The gel format lowers the EOF and improves res- olution, but the inconvenience of gel-filled capillaries is substantial. In the lat- ter case, open tubular capillary electrochromatography is being performed. Because of mass transport problems, the efficiencies are generally less than those found in CZE. If it is necessary to lower the EOF, a polymer network (176) or coated capillary is a simpler solution. Figure 4.30 shows the separation of chlor- amphenicol at pH 3.5 with and without the polymer network. It is possible that by lowering the pH to 2.5, the reduction of EOF would eliminate the need for the network. Charged solutes can be separated using neutral CDs. Adding the appropriate CD to 50 mM phosphate buffer, pH 2.5, for bases and 50 mM borate buffer, pH
    • 4.9 Chiral Recognition 185 FIGURE 4.30 Influence of methylhydroxyproplycellulose on the chiral recognition of chloram- phenicol enantiomers (A) without methylhydroxyethylcellulose (MHEC) and with 0.1% MHEC. BGE: 20 mM Tris adjusted to pH 3.5 with citric acid with 10 mM heptakis(2,6-di-0-methyl)-j8-CD; capil- lary: 65 cm (45 cm to detector); voltage: 18 kV; current: 6 |LIA; detection: UV, 254 nm. Reprinted with permission from J. Chromatogr., 559, 215 (1991), copyright © 1991 Elsevier Science Publishers. 9.3, for acids are good starting points. Use CD concentrations of 5 and 20 mM. If no separation occurs, first adjust the pH to equal the pK^ of the solute. If the separation still does not occur, try another CD. For separating neutral com- pounds, charged CDs must be employed. Once scouting runs have revealed a separation, optimization is relatively straightforward. It is important during these scouting runs that the direction of migration be determined. This is particularly important when using charged CDs at low pH, where the EOF is minimal. The direction of migration is then
    • 1 8 6 Chapter 4 Capillary Zone Electrophoresis determined by the strength of the solute-CD complex (192). In this example, where mixed CDs are employed, a solute such as cocaine that has a high affin- ity for the anionic CD migrates toward the anode. Solutes such as amphetamines have a low affinity for the anionic CD and migrate toward the cathode. Some scouting runs on the short end of the capillary ensure that the proper polarity of the power supply is selected. When charged cyclodextrins are used for separating charged solutes, ion pair- ing or ion repulsion can occur (178). In this case, reversal of the enantiomer elution order can occur as well, and depending on the strength of the solute-CD interaction, migration can occur in either direction, particularly at low pH or when coated capillaries are used as described in the previous paragraph. When necessary, ion-pairing reagents can be added to the BGE to improve separations. Such reagents include quinine (193), tartaric acid (194), and various sulfonic acids (195). Once the appropriate CD is selected, the important variables to optimize are the CD concentration, the buffer concentration, and the temperature. If the res- olution is optimized, then the benefits of a shortened capillary length can be enjoyed. Most solutes have relatively weak affinity for the CD. This is illustrated using the drug quinagolide as an example in Figure 4.31 (top) (20). As the buffer con- centration is increased, the resolution of the enantiomers increases in a nearly linear manner until the point where Joule heating becomes important. A con- centration of 50 mM was optimal under the conditions studied. SinceJoule heat- ing can be limiting, decreasing the capillary diameter and/or the field strength might further improve the resolution by permitting the use of higher concen- tration buffers. The buffer type also played a role in chiral resolution. Glycine HCl, pH 2.5, 50 mM gave poorer resolution than phosphate, pH 2.5, and no res- olution was found in 50 mM citrate, pH 2.5. A linear dependence of the migration time on the concentration of/J-CD was found in the concentration range 10-30 mM. No separation occurred below 10 mM CD concentration. This is consistent with the solute's weak inter- action with the CD. If the interaction were strong, the resolution would begin to decline as the equilibrium was pushed too far to the right. The impact of temperature is substantial in chiral HPCE. As Figure 4.31 (bot- tom) indicates, lowering the temperature improves the resolution. This will usu- ally be the case when there are weak interactions between the solute and the CD. The order of elution of the enantiomers can be important. Drug purity deter- minations entail the undesirable enantiomer to be present at quantities of less than 0.1% relative to the major component. For these separations, it may be advantageous for the impurity to elute prior to the main component. For exam- ple, a peptide drug with two chiral centers, separated at pH 2.5 with sul- fobutylethery-jS-CD, has the trace impurity eluting after the major component.
    • 4.9 Chiral Recognition 1.2 y 1.0 4- 0.8 4- R 0.6-1- 0.4-|- 0.24- 187 0.0 4- 4- 4- 0.00 0.02 0.04 0.06 0.08 Phosphate cone. |nK>l t'^ ] 0.10 1.2-y 1.0 4- 0.84- R 0.6 4- 0.44- 0.24- 0.0 15 20 25 30 35 40 45 Temperature fC] FIGURE 4.31 Influence of BGE concentration (top) and temperature (bottom) on the resolution of the enantiomers of quinagolide. Capillary: 50 cm X 75 |lm i.d.; voltage: 15 kV; BGE: 50 mM phosphate, pH 2.5, p-CD (top, variable; bottom, 50 mM); detection: UV, 214 nm. Reprinted with permission from Chromatographia, 33, 32 (1992), copyright © 1992 Vieweg.
    • 188 Chapter 4 Capillary Zone Electrophoresis By running at pH 9.3, the order of migration switches, and the trace component elutes first. Such a separation is shown in Figure 4.32. The separation shown in Figure 4.32 deserves further comment. A long 108- cm capillary was used here with an electrolyte containing 50 mM borate and 20 mM sulfobutylethery-^-CD. The current was 70 |iA at 30 kV, 30°C, using a 50-|im-i.d. capillary. Reducing the temperature to 15^C reduced the current, permitting a shorter capillary to be employed at 30 kV The run time decreased to 40 min with baseline resolution. E. CROWN ETHERS Crown ethers, represented in Figure 4.33 by 18-crown-6 tetracarboxylic acid, are another class of complexing reagents that have been employed in LC for TIME (min) FIGURE 4.32 Separation of trace enantiomers in the presence of the major component: Capil- lary: 108 cm X 50 |xm i.d., "bubble factor 3"; BGE: 20 mM sulfobutylethery-jS-CD, 50 mM borate, pH 9.3; injection: 100 mbs; detection: UV, 200 nm; voltage: 30 kV; temperature: 30 °C; solute con- centration: 1 mg/mL.
    • 4.9 Chiral Recognition 189 COOH^^,^O ,^>COOH COOH^< O' COOH FIGURE 4.33 Structure of 18-crown-6 tetracarboxylic acid. chiral recognition. This reagent is useful for chiral separation of primary amines (20, 196, 197). The material is no longer commercially available, and it was very expensive. It was shown in 1997 and 1998 that by combining CDs in conjunction with inexpensive nonfunctionalized 18-crown-6, comparable separations could be obtained (164,198,199). Typical BGE recipes include 50 mM phosphate, pH 2, 5 mM 18-crown-6 and either 5 mM dimethyl-j8-CD or 20 mM 7-CD, depending on the application. F. MACROCYCLIC ANTIBIOTICS Macrocyclic antibiotics are a broad class of naturally occurring compounds that have numerous chiral centers and a variety of functional groups that are known to produce chiral separations (200). The structure of one such compound, van- comycin, is shown in Figure 4.34. Macrocyclics such as vancomycin (200), teicoplanin (143), and rifamycin B (11) have all produced chiral separations. Ristocetin A may be the most widely applicable of these glycopeptide com- pounds (201). While there is certainly overlap within the scope of compounds separated by CDs, the chiral resolving power of these selectors may be superior. These selectors are not without difficulties. The main disadvantage is strong absorption of light in the mid- to low-UV region of the spectrum. This requires that the solute not be detected at wavelengths where the antibiotic absorbs. For solutes lacking a chromophore, they can be used simultaneously for both indi- rect detection and chiral recognition when a solute does not absorb light (11).
    • 190 Chapter 4 Capillary Zone Electrophoresis Vancomycin R = H Me, ^NHj A82846B R FIGURE 4.34 Structure of a macrocyclic antibiotic. Courtesy of John Reilly, Eli Lilly and Com- pany Limited, United Kingdom. Typical electrolytes contain 40-100 mM phosphate buffer, pH 6, and 0.5-5 mM of the antibiotic. Organic solvents such as acetonitrile may be necessary additives when solute binding to the antibiotic is very strong (143). The solvent 2- methoxyethanol was shown more effective than acetonitrile for resolving nons- teroidal anti-inflammatory drugs (202). If the solute's UV absorption spectrum overlaps the that of the antibiotic, it may be possible to overcome this problem via a special technique (203). A coated capillary is used to suppress the EOF As Figure 4.35 indicates, the cap- illary is filled with BGE containing the antibiotic, and a sample is loaded onto the capillary. Operating in the reversed-polarity mode (sample-side negative), the cationic antibiotic migrates toward the negative electrode away from the detector, while the anionic solute migrates toward the positive electrode. Since the outlet electrolyte reservoir does not contain the antibiotic, the detector win- dow is clear when the separated enantiomers reach it. Naturally, this system works only for anionic solutes. For cationic solutes, an anionic antibiotic would be required. This might involve adjusting the pH, since many of the macro- cyclics are zwitterionic. A separation of dansyl glutamic acid using this approach is shown in Figure 4.36. Note the rapidly stabilizing baseline as the antibiotic clears the detector.
    • 4.9 Chiral Recognition 191 ^^,,.^...^^^^^^^^^,^^^^^^^2 ^^-'^^^^^^^^^^^^^'^^^^^s^^^^Mm^^ FIGURE 4.35 Schematic illustrating the separation of an ionic drug using a macrocyclic antibi- otic. The UV-absorbing macrolide is not present in the electrolyte reservoirs. A coated capillary and reversed polarity are used to ensure the capillary window is clear of the antibiotic prior to detec- tion of the solutes. G. OLIGOSACCHARIDES Oligosaccharides comprise a vast array of compounds that include linear ohgosaccharides, maltodextrin mixtures, maltooligosaccharides, linear non-a- (l-4)-linked glucose polymers, low-molecular-mass galactose-glucose-fructose copolymers, and even cyclodextrins (145). These compounds and others such as amylodextrins can form complexes with many small molecules (204). A maltooligosaccharide such as 10% Dextrin 10 solution in 100 mM phos- phate/pyrophosphate, pH 7 was more effective than 10% Dextran or 20 mM /3-CD in separating some nonsteroidal anti-inflammatory drugs (148). It is known that derivatized CDs are often required for chiral recognition of these classes of acidic drugs (205). It has been found that a degree of polymeriza- tion (DP) greater than 7 was required for chiral recognition (172). Separations of a variety of drug substances have been demonstrated with 3% chondroitin sulfate C, a mucopolysaccharide, in 20 mM borate-phosphate, pH 2.8. That reagent was favored over heparin sulfate and dextran as a chiral selector (206).
    • 192 Chapter 4 Capillary Zone Electrophoresis 875 843 400 Time (Seconds) FIGURE 4.36 Chiral separation of dansyl glutamic acid. Conditions: capillary: 27 cm (20 cm to detector) x 50 ^m eCAP neutral (Beckman); BGE: 2 mM vancomycin, 100 mM phosphate, pH 6; the voltage was applied for 5 min prior to injection to purge the detection window of antibiotic; injection: 2 s, low pressure (0.5 psi); detection: UV, 254 nm; voltage: -10 kV; temperature: 25°C; sample con- centration: 0.1 mg/mL. Courtesy ofJohn Reilly Eli Lilly and Company Limited, United Kingdom. The advantages and disadvantages of these materials compared with cyclodextrins are unclear at this time. Only a dozen papers have been published, and the range of compounds studied overlaps with those studied with CDs. H. BILE SALTS Bile salts have already been shown useful for the determination of hydrophobic solutes. This usefulness can be extended to the separation of optical isomers; bile salts are naturally optically active. Unlike the work with CDs, bile salts are best utilized under conditions of a strong EOF; this is a consequence of the sep- aration chemistry following the MECC mechanism. Operation at low pH val- ues generally results in lengthy separation times. Bile salts tend to provide enantioselectivity when the structure of the solute is more rigid than that of the surfactant (146). The selection of the appropriate bile salt has a substantial impact on the chiral recognition. There is no way of predicting which salt will yield the best results at this time. High buffer pH val- ues where solutes become anionic reduce chiral recognition, presumably due to repulsion from the anionic micelle (146). Neutral compounds are not affected by pH changes. The use of organic solvents to reduce K'and improve a has been reported (207). A textbook separation is shown in Figure 4.37.
    • 4.9 Chiral Recognition 193 U n Hi if U—IIL—r- 19 """""I -'l 12 14 —r- 16 18 20 FIGURE 4.37 Chiral separation of trimetoquinol HCl, tetrahydropapaveroline, five diltiazen- related compounds, 2,2'-dihydroxy-l,r-dinaphthyl, and 2,2,2-trifluoro-l-(9-anthryl)ethanol. Cap- illary: 65 cm (50 cm to detector) x 50 )im i.d.; BGE: 50 mM STDC in 20 mM phosphate-borate, pH 4.0; voltage: 20 kV; detection: Uy 210 nm. Reprinted with permission from J. Chromatogr., 515, 223 (1990), copyright © 1990 Elsevier Science Publishers. Admixtures of bile salts with cyclodextrins (208) and polyoxyethylene ethers (60) have also been reported. Since very few papers have been published in this field and general utility has not been demonstrated, bile salts are usually tried only upon failure of other methods. I. PRECAPILLARY DERIVATIZATION Separations have been reported by MECC for amino acids derivatized with Mar- fey's reagent (l-fluoro-2,4-dinitrophenyl-5-L-alanine amide) (209), GITC (2,3,4,6- tetra-0-acetyl-j8-D-glucopyranosylisothiocyanate) (21), and l-(9-fluorenyl)-ethyl chloroformate (FLEC) (210). The GITC derivatives of amphetamine andmetham- phetamine separated with 80 mM SDS, 8 mM phosphate-borate, pH 9; 20% methanol allows simultaneous separation of the precursors as well (211). The FLEC reagent is particularly notable. This reagent reacts rapidly with primary and secondary amines to form stable fluorescent derivatives. Detection
    • 1 9 4 Chapter 4 Capillary Zone Electrophoresis can be by absorption at 260 nm or laser-induced fluorescence using a krypton fluoride laser with fluorescence collected above 300 nm. The reagent meets all of the standard criteria for an ideal reagent (to be listed presently). Its only shortcoming is the need to perform a solvent extraction to remove the excess reagent. This can result in recovery losses for very hydrophobic solutes. A variety of reagents have been employed to create synthetic diastereomers that can be separated by LC (212). It is likely that many of these will be appli- cable to separation by MECC. When a reagent is available in both optically active forms, it is possible to control the order of elution of the enantiomers. Ideally, the enantiomer present in the lower concentration should elute first. It is less likely to be lost on the tail of the more concentrated solute. The ideal reagent will have the following characteristics: 1. Rapid reaction 2. Stable products 3. No racemization 4. Excess reagent invisible to detector or easily removable 5. Reagent contains or produces a strong chromophore or fluorophore 6. Commercially available in either form of purified enantiomer 7. Inexpensive The advantages of precapillary derivatization are 1. It provides a highly predictable mechanism for chiral recognition, pro- vided the chiral center is in the proximity of the reaction site. 2. It simultaneously produces a good chromophore and chiral selectivity. The disadvantages of precapillary derivatization are 1. It complicates assay validation. 2. Incomplete reactions are possible. 3. Excess reagent can complicate separations. 4. There are extra sample-handling steps. Many analytical chemists are averse to using derivatization procedures to improve separation and detection. This is unfortunate, since the enhanced results often justify the extra work in sample preparation and method valida- tion. In chiral separations, it is possible to solve both separation and detection problems using a single procedure. 4.10 AFFINITY CAPILLARY ELECTROPHORESIS The use of HPCE to study molecular interactions is known as affinity capillary elec- trophoresis (ACE). While all forms of secondary equilibrium, including the use of micelles and cyclodextrins, can be considered affinity interactions, the term ACE is generally reserved for the determination of noncovalent interactions of biomol-
    • 4.10 Affinity Capillary Electrophoresis 195 ecules with various reagents. For example, the separation of immune complexes would be termed immunoaffinity CE (213). The study of protein-drug interac- tions is particularly important, since it is important for the pharmacologist to know the concentration of free drug in blood serum. The screening of combinatorial libraries for activity (binding) is another potential application (214). ACE relates changes in the mobility of a protein (P) with a ligand (L). Either the protein or ligand can be present in the buffer, while the other is the injected solute. Analysis of the change in mobility of the protein as a function of the lig- and concentration provides the binding constant K^. In the absence of EOF, the change in migration time of L is proportional to the change in mobility of L (215). Then, the binding constant can be estimated by [L] K.Ar^-KbAtL, (4.6) Table 4.6 lists applications that employ ACE. Affinity interactions can be pre- capillary (216), on-capillary (gel) (217), or postcapillary (218). The affinity Table 4.6 Application of Affinity Capillary Electrophoresis Biomolecule Actinividin ai-Acid glycoprotein Amyeloid P component Antithrombin Bovine serum albumin Carbonic anhydrase Concanavalin A Glycosoaminoglycans (GAGs) Human myeloma IgE Human serum albumin Humic substances Immunoglobulin G Monoclonal anti-phosphotyrosine Oligodeoxynucleotides Peptides Ligand Biotin Remoxipride Heparin Heparin Leucovorin Coproporphyrin Benzenesulfonamides Arylsulfonamides Monosaccharides Heparin binding peptides DNA aptamer Benzoin Triazine Protein A Phosphototyrosine Poly(9-vinyladenine) Vancomycin Note Chiral Chiral Type I and III isomers EOF compensated LIF Immobilized GAG FITC tagged Chiral FITC tagged Immuno CE Gel Multipeptide separation Reference 221 222 223 224 225 129 215 226 227 228 229 230 231 232 233 234 235,236
    • 196 Chapter 4 Capillary Zone Electrophoresis interaction can be used to effect a separation without the determination of bind- ing constants (129). In this case, the rules of secondary equihbrium apply as always. Depending on the reaction kinetics between the protein and ligand, some unusual peak shapes can be obtained. Some of these are illustrated in Figure 4.38. There are also many methods for performing ACE, and the merits and lim- itations of each have been published (219, 220). REACTION KINETICS Ref. It I No interaction Fast Slow ^ Slow i Slow _ ^ ^ FIGURE 4.38 Illustration of some possible patterns in affinity CE. The reference component is a noninteracting solute. Reprinted with permission from J. Chromatogr., A, 680, 405 (1994), copy- right © 1994 Elsevier Science Publishers.
    • References 197 REFERENCES 1. Karger, B. L., Snyder, L. R., Horvath, C, An Introduction to Separation Science. 1973, Wiley: 586. 2. Terabe, S., Otsuka, K., Ichikawa, K., Tsuchiya, A., Ando, T. Electrokinetic Separations with Micellar Solutions and Open-Tubular Capillaries. Anal. Chem., 1984; 56:111. 3. Terabe, S., Otsuka, K., Ando, T. Electrokinetic Chromatography with Micellar Solution and Open-Tubular Capillary. Anal Chem., 1985; 57:834. 4. Watari, H., Ogawa, K., Abe, M., Monta, T., Takahashi, I. Capillary Electrophoresis with OAV Microemulsions of Water/SDS/1-Butanol/Heptane. Anal. Set, 1991; 7:245. 5. Watari, H. Microemulsion Capillary Electrophoresis. Chem. Lett, 1991; 391. 6. Terabe, S., Matsubara, N., Ishihama, Y., Okada, Y. Microemulsion Electrokinetic Chromatog- raphy: Comparison with Micellar Electrokinetic Chromatography. J. Chromatogr, 1992; 608:23. 7. Zhang, Y., Zhang, R., Hjerten, S. Liposome Capillary Electrophoresis for Analysis of Interac- tions between Lipid Bilayers and Solutes. Electrophoresis, 1995; 16:1519. 8. Hong, M., Weekley, B. S., Grieb, S. J., Foley, J. P. Electrokinetic Chromatography Using Ther- modynamically Stable Vesicles and Mixed Micelles Formed from Oppositely Charged Surfac- tants. Anal. Chem., 1998; 70:1394. 9. Terabe, S., Ozaki, H., Otsuka, K., Ando, T. Electrokinetic Chromatography with 2-O-Car- boxymethyl-^-Cyclodextrin as a Moving "Stationary" Phase. J. Chromatogr, 1985; 332:211. 10. Tanaka, N., Tanigawa, T., Hosoya, K., Kimata, K., Araki, T., Terabe, S. Starburst Dendrimers as Carriers in Electrokinetic Chromatography. Chem. Lett., 1992; 959. 11. Armstrong, D. W, Rundlett, K., Reid, G. L. I. Use of a Macrocyclic Antibiotic, Rifamycin B, and Indirect Detection for the Resolution of Racemic Aromatic Amino Alcohols by CE. Anal. Chem., 1994; 66:1690. 12. Terabe, S., Isemura, T. Effect of Polymer Ion Concentrations on Migration Velocities in Ion- Exchange Electrokinetic Chromatography. J. Chromatogr, 1990; 515:667. 13. Terabe, S., Isemura, T. Ion-Exchange Electrokinetic Chromatography with Polymer Ions for the Separation of Isomeric Ions Having Identical Electrophoretic Mobilities. Anal. Chem., 1990; 62:650. 14. Shamsi, S. A., Warner, I. M. Monomeric and Polymeric Chiral Surfactants as Pseudo-Station- ary Phases for Chiral Separations. Electrophoresis, 1997; 18:853. 15. Strege, M. A., Lagu, A. L. Capillary Electrophoretic Separations of Biotechnology-Derived Pro- teins in E. coli Fermentation Broth. Electrophoresis, 1995; 16:642. 16. Andrieux, K., Olivier, J. C, Taverna, M., Vauthier, C, Couvreur, R, Ferrier, D. Analysis of Serum Proteins by Micellar Electrokinetic Capillary Chromatography. Application to a Drug Carrier Evaluation. J. Liq. Chromatogr Related Technol, 1996; 19:3333. 17. Dobashi, A., Ono, T., Hara, S., Yamaguchi, J. Optical Resolution of Enantiomers with Chiral Mixed Micelles by Electrokinetic Chromatography. Anal. Chem., 1989; 61:1984. 18. Fanali, S. Separation of Optical Isomers by Capillary Zone Electrophoresis Based on Host- Guest Complexation with Cyclodextrins. J. Chromatogr, 1989; 474:441. 19. Guttman, A., Paulus, A., Cohen, A. S., Grinberg, N., Karger, B. L. Use of Complexing Agents for Selective Separation in High-Performance Capillary Electrophoresis: Chiral Resolution via Cyclodextrins Incorporated within Polyacrylamide Gel Columns.J. Chromatogr, 1988; 448:41. 20. Kuhn, R., Stoecklin, E, Erni, F Chiral Separations by Host-Guest Complexation with Cyclodex- trin and Crown Ether in Capillary Zone Electrophoresis. Chromatographia, 1992; 33:32. 21. Nishi, H., Fukuyama, T., Matsuo, M. Resolution of Optical Isomers of 2,3,4,6 Tetra-O-acetyl- /3-D-glucopyranosyl Isothiocyanate (GITC)-Derivatized DL-Amino Acids by Micellar Elec- trokinetic Chromatography. J. Microcolumn Sep., 1990; 2:234.
    • 1 9 8 Chapter 4 Capillary Zone Electrophoresis 22. Gratzel, M., Thomas, J. K., Eds. Modern Fluorescence Spectroscopy, Ed. E. L. Wehry, Vol. 2. 1976, Plenum Press. 23. Mclntire, G. L. Micelles in Analytical Chemistry. Crit. Rev. Anal. Chem., 1990; 21:257. 24. Armstrong, D. W, Nome, E Pseudophase Liquid Chromatography. Anal. Chem., 1981; 53:1662. 25. Foley, J. P Optimization of Micellar Electrokinetic Chromatography. Anal. Chem., 1990; 62:1302. 26. Jorgenson, J. W, Lukacs, K. D. Zone Electrophoresis in Open Tubular Glass Capillaries. Anal. Chem., 1981; 53:1298. 27. Weinberger, R., Albin, M. Quantitative Micellar Electrokinetic Capillary Chromatography: Linear Dynamic Range. J. Liq. Chromatogr, 1991; 14:953. 28. Nishi, H., Tsumagari, N., Kakimoto, T., Terabe, S. Separation of Water-Soluble Vitamins by Micellar Electrokinetic Chromatography J. Chromatogr, 1989; 465:331. 29. Chiari, M., Nesi, M., Ottolina, G., Righetti, P G. Separation of Charged and Neutral Isotopic Molecules by Micellar Electrokinetic Chromatography in Coated Capillaries. J. Chromatogr, A, 1994; 680:571. 30. Janini, G. M., Muschik, G. M., Issaq, H.J. Micellar Electrokinetic Chromatography in Zero- Electroosmotic Flow Environment. J. Chromatogr, B: Biomed. Appl, 1996; 683:29. 31. Bushey, M. M., Jorgenson, J. W Separation of Dansylated Methylamine and Dansylated Methyl-d3-amine by Micellar Electrokinetic Capillary Chromatography with Methanol-Mod- ified Mobile Phase. Anal. Chem., 1989; 61:491. 32. Balchunas, A. T., Sepaniak, M. J. Extension of Elution Range in Micellar Electrokinetic Cap- illary Chromatography. Anal. Chem., 1987; 59:1466. 33. Lux,J. A., Yin, H., Schomburg, G. Influence of Polymer Coating of Capillary Surfaces on Migra- tion Behavior in Micellar Electrokinetic Capillary Chromatography. HRC & CC, 1990; 13:145. 34. Sepaniak, M. J., Swaile, D. E, Powell, A. C, Cole, R. O. Capillary Electrokinetic Separations: Influence of Mobile Phase Composition on Performance. HRC & CC, 1990; 13:679. 35. Gorse, J., Balchunas, A. T., Swaile, D. E, Sepaniak, M.J. Effects of Organic Mobile Phase Mod- ifiers in Micellar Electrokinetic Capillary Chromatography J. High Resolut. Chromatogr, 1988; 11:554. 36. Weinberger, R., Lurie, I. S. Micellar Electrokinetic Capillary Chromatography of Illicit Drug Substances. Anal. Chem., 1991; 63:823. 37. Ahuja, E. S., Foley, J. R Separation of Very Hydrophobic Compounds by Hydrophobic Inter- action Electrokinetic Chromatography. J. Chromatogr, A, 1994; 680:73. 38. Terabe, S., Ishihama, Y., Nishi, H., Fukuyama, T., Otsuka, K. Effect of Urea Addition in Micel- lar Electrokinetic Chromatography. J. Chromatogr, 1991; 545:359. 39. Pyell, U., Butehorn, U. Optimization of Resolution in Micellar Electrokinetic Chromatogra- phy via Computer-Aided Simultaneous Variation of Concentrations of Sodium Dodecyl Sul- fate and Urea as Modifier. J. Chromatogr, A, 1995; 716:81. 40. Litde, E. L., Foley J. P Optimization of the Resolution of PTH-Amino Acids through Control of Surfactant Concentration in Micellar Electrokinetic Capillary Chromatography: SDS vs. Brij 35/SDS Micellar Systems. J. Microcolumn Sep., 1992; 4:145. 41. Rasmussen, H. T., Goebel, L. K., McNair, H. M. Micellar Electrokinetic Chromatography Employing Sodium Alkyl Sulfates and Brij 35. J. Chromatogr, 1990; 517:549. 42. Rasmussen, H. T., Goebel, L. K., McNair, H. M. Optimization of Resolution in Micellar Elec- trokinetic Chromatography J. High Resolut. Chromatogr, 1991; 14:25. 43. Nishi, H., Tsumagari, N., Kakimoto, T., Terabe, S. Separation of j3-Lactam Antibiotics by Micel- lar Electrokinetic Chromatography. J. Chromatogr, 1989; 477:259. 44. Nishi, H., Tsumagari, N., Terabe, S. Effect of Tetraalkyl-ammonium Salts on Micellar Electro- kinetic Chromatography of Ionic Substances. Anal. Chem., 1989; 61:2434. 45. Sciacchitano, C. J., Mopper, B., Specchio, J. J. Identification and Separation of Five Cephalosporins by Micellar Electrokinetic Capillary Chromatography. J. Chromatogr, B: Bio- med. Appl, 1994; 657:395.
    • References 199 46. Burton, D. E., Sepaniak, M. J., Maskarinec, M. P. Evaluation of the Use of Various Surfactants in Micellar Electrokinetic Capillary Chromatography. J. Chromatogr. Set, 1987; 25:514. 47. Gozel, P., Gassman, E., Michelsen, H., Zare, R. N. Electrokinetic Resolution of Amino Acid Isomers with Copper(II)-Aspartame Support Electrolyte. Anal. Chem., 1987; 59:44. 48. Crosby, D., El Rassi, Z. Micellar Electrokinetic Capillary Chromatography with Cationic Sur- factants. J. Liq. Chromatogr., 1993; 16:2161. 49. Sainthorant, C, Morin, E, Dreux, M., Baudry, A., Goetz, N. Separation of Phenylenediamine, Phenol and Aminophenol Derivatives by Micellar Electrokinetic Chromatography. Compari- son of the Role of Anionic and Cationic Surfactants. J. Chromatogr., A, 1995; 717:167. 50. Matsubara, N., Terabe, S. Separation of Closely Related Peptides by Capillary Electrophoresis with a Non-ionic Surfactant. Chromatographia, 1992; 34:493. 51. Matsubara, N., Koezuka, K., Terabe, S. Separation of Eleven Angiotensin 11 Analogs by Capil- lary Electrophoresis with a Nonionic Surfactant in Acidic Media. Electrophoresis, 1995; 16:580. 52. Swedberg, S. A. Use of Non-ionic and Zwitterionic Surfactants to Enhance Selectivity in High- Performance Capillary Electrophoresis: An Apparent Micellar Electrokinetic Capillary Chro- matography Mechanism. J. Chromatogr, 1990; 503:449. 53. Mechref, Y., El Rassi, Z. Comparison of Alkylglycoside Surfactants in Enantioseparation by Capillary Electrophoresis. Electrophoresis, 1997; 18:912. 54. Cai, J., El Rassi, Z. Micellar Electrokinetic Capillary Chromatography of Neutral Solutes with Micelles of Adjustable Surface Charge Density. J. Chromatogr, 1992; 608:31. 55. Mechref, Y., Smith, J. T., El Rassi, Z. Micellar Electrokinetic Capillary Chromatography with In Situ Charged Micelles. VII. Expanding the Utility of Alkylglycoside-Borate Micelles to Acidic and Neutral pH for Capillary Electrophoresis of Dansyl Amino Acids and Herbicides. J. Liq. Chromatogr, 1995; 18:3769. 56. Smith, J. T., El Rassi, Z. Micellar Electrokinetic Capillary Chromatography with In Situ Charged Micelles: 5. Evaluation of Background Fluorophores for Indirect Fluorescence Detec- tion. J. Cap. Electrophor, 1994; 1:136. 57. Smith, J. T., El Rassi, Z. Micellar Electrokinetic Capillary Chromatography with In Situ Charged Micelles. IV. Influence of the Nature of the Alkylglycoside Surfactant. J. Chromatogr, A, 1994; 685:131. 58. Terabe, S., Shibata, M., Miyashita, Y. Chiral Separation by Electrokinetic Chromatography with Bile Sak Micelles. J. Chromatogr, 1989; 480:403. 59. Cole, R. O., Sepaniak, M. J., Hinze, W. L., Gorse, J.,Oldiges, K, Bile Salt Surfactants in Micel- lar Electrokinetic Capillary Chromatography. Application to Hydrophobic Molecule Separa- tions. J. Chromatogr, 1991; 557:113. 60. Clothier J. G., Jr., Daley, L. M., Tomellini, S. A. Effects of Bile Salt Structure on Chiral Sepa- rations with Mixed Micelles of Bile Salts and Polyethylene Oxide Ethers Using Micellar Elec- trokinetic Capillary Chromatography. J. Chromatogr, B: Biomed. Appl., 1996; 683:37. 61. Bumgarner, J. G., Khaledi, M. G. Mixed Micelles of Short Chain Alkyl Surfactants and Bile Salts in Electrokinetic Chromatography. Enhanced Separation of Corticosteroids. J. Chro- matogr., A, 1996; 738:275. 62. Shamsi, S. A., Akbay C, Warner, I. M. Polymeric Anionic Surfactant for Electrokinetic Chro- matography: Separation of 16 Priority Polycyclic Aromatic Hydrocarbon Pollutants. Anal. Chem., 1998; 70:3078. 63. Billiot, E., Macossay, J., Thibodeaux, S., Shamsi, S. A., Warner, 1. M. Chiral Separations Using Dipeptide Polymerized Surfactants: Effect of Amino Acid Order. Anal. Chem., 1998; 70:1375. 64. Gluck, S. J., Benko, M. H., Hallberg, R. K., Steele, K. P Indirect Determination of Octanol- Water Partition Coefficients by Microemulsion Electrokinetic Chromatography.J. Chromatogr, A, 1996; 744:141. 65. Altria, K. D. High-Speed Determination of Drug-Related Impurities by Capillary Elec- trophoresis Employing Commercial Instrumentation. J. Chromatogr, 1993; 636:125. 66. Khaled, M. Y., McNair, H. M. Capillary Zone Electrophoretic Separation of Isomeric Benzoic Acids Using Cyclodextrin. J. Hi^. Resolut. Chromatogr, 1996; 19:143.
    • 2 0 0 Chapter 4 Capillary Zone Electrophoresis 67. Deng, Y., Zhou, J., Perkins, M. D., Lunte, S. M. Capillary Electrophoretic Separation of Estro- gens Using Anionic Sulfobutyl Ether ^-Cyclodextrin. Anal. Commun., 1997; 34:129. 68. Ferguson, P. D., Goodall, D. M., Loran, J. S. Systematic Approach to Links between Separa- tions in Capillary Electrophoresis and Liquid Chromatography. IV. Application of Binding Constant-Retention Factor Relationship to the Separation of 2-, 3-, and 4-Methylbenzoate Anions Using/9-Cyclodextrin as Selector J. Chromatogr., A, 1997; 768:29. 69. Fish, B. J. Separation and Quantification of Geometric Isomers in a Leukotriene Antagonist Using Cyclodextrins in Capillary Electrophoresis. Comparison to High-Performance Liquid Chromatographic Methods. J. Chromatogr, A, 1997; 768:81. 70. Frach, K., Blaschke, G. Separation of Ergot Alkaloids and Their Epimers and Determination in Sclerotia by Capillary Electrophoresis. J. Chromatogr, A, 1998; 808:247. 71. Rovatti, L., Curcuruto, O., Hamden, M. Investigations of Two Geometric Isomers by Capil- lary Zone Electrophoresis with and without Mass Spectrometry Forensic Sci. Int., 1998; 92:229. 72. Nguyen, A.-L., Luong, J. H. T. Separation and Determination of Polycyclic Aromatic Hydro- carbons by Solid Phase Microextraction/Cyclodextrin-Modified Capillary Electrophoresis. Anal. Chem., 1997; 69:1726. 73. Luong, J. H. T, Guo, Y. Mixed-Mode Capillary Electrokinetic Separation of Positional Explo- sive Isomers Using Sodium Dodecyl Sulfate and Negative-/3-Cyclodextrin Derivatives. J. Chro- matogr, A, 1998; 811:225. 74. Michaelsen, S., Moller, P, Sorensen, H. Analysis of Dansyl Amino Acids in Feedstuffs and Skin by Micellar Electrokinetic Capillary Chromatography J. Chromatogr, A, 1994; 680:229. 75. Matsubara, N., Terabe, S. Separation of 24 Dansylamino Acids by Capillary Electrophoresis with a Non-ionic Surfactant. J. Chromatogr, A, 1994; 680:311. 76. Skocir, E., Vindevogel, J., Sandra, R Separation of 23 Dansylated Amino Acids by Micellar Electrokinetic Chromatography at Low Temperature. Chromatographia, 1994; 39:7. 77. Chan, K. C, Janini, G. M., Muschik, G., Issaq, H. J. Laser-Induced Fluorescence Detection of 9-Fluorenylmethyl Chloroformate Derivatized Amino Acids in Capillary Electrophoresis. J. Chromatogr A, 1993; 653:93. 78. Kim, N. J., Kim, J. H., Lee, K.-J. Application of Capillary Electrophoresis to Amino Acid Sequencing of Peptide. Electrophoresis, 1995; 16:510. 79. Pyell, U., Butehorn, U. Optimization Strategies in Micellar Electrokinetic Capillary Chro- matography. Optimization of the Temperature of the Separation Capillary. Chromatographia, 1995; 40:69. 80. Cherkaoui, S., Varesio, E., Christen, R, Veuthey J.-L. Selectivity Manipulation Using Non- aqueous Capillary Electrophoresis. Application to Tropane Alkaloids and Amphetamine Deriv- atives. Electrophoresis, 1998; 19:2900. 81. Makino, K., Hirakawa, M., Goto, Y, Nakashima, K., Kataoka, Y, Oishi, R. Quahty Evaluation by Capillary Electrophoresis of Amphotericin B Injection After Filtration through Various Membrane Filters. Electrophoresis, 1998; 19:2930. 82. Takeda, S., Wakida, S.-I., Yamane, M., Kawahara, A., Higashi, K. Separation of Aniline Deriv- atives by Micellar Electrokinetic Chromatography. J. Chromatogr, A, 1993; 653:109. 83. Desiderio, C, Fanah, S. Atrazine and Simazine Determination in River Water Samples by Micellar Electrokinetic Capillary Chromatography. Electrophoresis, 1992; 13:698. 84. Plant, O., Staub, C. Determination of Atropine in Biological Fluids by Micellar Electrokinetic Capillary Chromatography in the Presence of Strychnine and Tetracaine. Electrophoresis, 1998; 19:3003. 85. Evenson, M. A., Wiktorowicz, J. E. Automated Capillary Electrophoresis Applied to Thera- peutic Drug Monitoring. Clin. Chem., 1992; 38:1847. 86. Boonkerd, S., Detaevemier, M. R., Michotte, Y Use of Capillary Electrophoresis for the Deter- mination of Vitamins of the B Group in Pharmaceutical Preparations./ Chromatogr, A, 1994; 670:209.
    • References 2 0 1 87. Lukkari, P., Nyman, T., Riekkola, M.-L. Determination of Nine j3-Blockers in Serum by Micel- lar Electrokinetic Capillary Chromatography. J. Chromatogr., A, 1994; 674:241. 88. Gaus, H.-J., Treumann, A., Kreis, W, Bayer, E. Separation of Cardiac Glycosides by Micellar Electrokinetic Capillary Electrophoresis. J. Chromatogr., 1993; 635:319. 89. Li, Y.-M., Vanderghinste, D., Pecanac, D., Van Schepdael, A., Roets, E., Hoogmartens, J. Analy- sis of Cefadroxil by Micellar Electrokinetic Capillary Chromatography: Development and Val- idation. Electrophoresis, 1998; 19:2890. 90. Saitoh, K., Kato, H., Teramae, N. Separation of Chlorophyll-Ci and -Cj by Micellar Electroki- netic Capillary Chromatography. J. Chromatogr, A, 1994; 687:149. 91. Bjergegaard, C, Ingvardsen, L., Sorenson, H. Determination of Aromatic Choline Esters by Micellar Electrokinetic Capillary Chromatography. J. Chromatogr A, 1993; 653:99. 92. Row, K. H., Griest, W. H., Maskarinec, M. P. Separation of Modified Nucleic Acid Constituents by Micellar Electrokinetic Capillary Chromatography. J. Chromatogr, 1987; 409:193. 93. Cohen, A. S., Terabe, S., Smith, J. A., Karger, B. L. High-Performance Capillary Electrophoretic Separation of Bases, Nucleosides, and Oligonucleotides: Retention Manipulation via Micellar Solutions and Metal Additives. Anal Chem., 1987; 59:1021. 94. Davis, P., Lafon, R., Large, T., Morgan, E. D., Wilson, I. D. Micellar Capillary Electrophoresis of Ecdysteroids. Chromatographia, 1993; 37:37. 95. Chan, K. C, Muschik, G. M., Issaq, H. J., Siteri, P K. Separation of Estrogens by Micellar Elec- trokinetic Chromatography. J. Chromatogr, A, 1995; 690:149. 96. Kleibohmer, W., Cammann, K., Robert, J., Mussenbrock, E. Determination of Explosives Residues in Soils by Micellar Electrokinetic Capillary Chromatography and High-Performance Liquid Chromatography. J. Chromatogr, 1993; 638:349. 97. Schmitz, O., Gab, S. Separation of Unsaturated Fatty Acids and Related Isomeric Hydroper- oxides by Micellar Electrokinetic Chromatography. J. Chromatogr, A, 1997; 781:215. 98. Pietta, P. G., Mauri, P. L., Rava, A., Sabbatini, G. Application of Micellar Electrokinetic Capil- lary Chromatography to the Determination of Flavonoid Drugs.J. Chromatogr, 1991; 549:367. 99. Ferreres, E, Blazquez, M. A., Gil, M. 1., Tomas-Barberan, F. A. Separation of Honey Flavonoids by Micellar Electrokinetic Capillary Chromatography. J. Chromatogr, A, 1994; 669:268. 100. Pietta, P, Mauri, P, Bruno, A., Zini, L. High-Performance Liquid Chromatography and Micel- lar Electrokinetic Chromatography of Flavonol Glycosides from Tilia. J. Chromatogr, 1993; 638:357. 101. Dinelli, G., Bonetti, A., Catizone, P., Galletti, G. C. Separation and Detection of Herbicides in Water by Micellar Electrokinetic Capillary Chromatography. J. Chromatogr, B: Biomed. Appl, 1994; 656:275. 102. Thomas, B. R., Fang, X. G., Chen, X., Tyrell, R. J., Ghodbane, S. Validated Micellar Electro- kinetic Capillary Chromatography Method for Quality Control of the Drug Substances Hydrochlorothiazide and Chlorothiazide. J. Chromatogr, B: Biomed. Appl, 1994; 657:383. 103. Sakodinskaya, 1. K., Desiderio, C, Nardi, A., Fanali, S. Micellar Electrokinetic Chromato- graphic Study of Hydroquinone and Some of Its Ethers. Determination of Hydroquinone in Skin-Toning Cream. J. Chromatogr, 1992; 596:95. 104. Tadey, T., Purdy, W. C. Capillary Electrophoretic Resolution of Phosphorylated Peptide Iso- mers Using Micellar Solutions and Coated Capillaries. Electrophoresis, 1995; 16:574. 105. Flurer, C. Analysis of Macrolide Antibiotics by Capillary Electrophoresis. Electrophoresis, 1996; 17:359. 106. Saitoh, K., Kiyohara, O., Suzuki, N. Micellar Electrokinetic Capillary Chromatography of Metal Complexes of Acetylacetone. Anal Scl, 1991; 7:269. 107. Saitoh, T., Hoshino, H., Yotsuyanagi, T. Separation of 4-(2-Pyridylazo)resorcinolato Metal Chelates by Micellar Electrokinetic Capillary Chromatography.J. Chromatogr, 1989; 469:175. 108. Beattie, J. H., Richards, M. P., Self, R. Separation of Metallothionein Isoforms by Capillary Zone Electrophoresis. J. Chromatogr, 1993; 633:127.
    • 202 Chapter 4 Capillary Zone Electrophoresis 109. Hughes, D. E., Richberg, P. Capillary Micellar Electrokinetic, Sequential Multiwavelength Chromatographic Characterization of a Chimeric Monoclonal Antibody-Cytotoxin Conju- gate. J. Chromatogr., 1993; 635:313. 110. Wernly, P., Thormann, W, Bourquin, D., Brenneisen, R. Determination of Morphine-3-glu- curonide in Human Urine by Capillary Zone Electrophoresis and Micellar Electrokinetic Cap- illary Chromatography J. Chromatogr., 1993; 616:305. 111. Mabondou, C. W, Paintaud, G., Berard, M., Bechtel, P. R. Separation of Fifteen Non-steroidal Anti-inflammatory Drugs Using Micellar Electrokinetic Capillary Chromatography. J. Chro- matogr, B: Biomed. Appl, 1994; 657:173. 112. Lecoq, A. E, Di Biase, S., Montanarella, L. Fraction Collection After an Optimized Micellar Electrokinetic Capillary Chromatographic Separation of Nucleic Acid Constituents. J. Chro- matogr, 1993; 638:363. 113. Lecoq, A.-E, Montanarella, L. Separation of Nucleosides and Nucleotide-3'-Monophosphates by Micellae Electrokinetic Capillary Chromatography. J. Microcolumn Sep., 1993; 5:105. 114. Taverna, M., Baillet, A., Baylocq-Ferrier, D. Analysis of Neutral and Sialylated N-Linked Oligosaccharides by Micellar Electrokinetic Capillary Chromatography with Addition of a Divalent Cation. Chromatographia, 1993; 37:415. 115. Zhu, Y., Van Schepdael, A., Roets, E., Hoognmartens, J. Micellar Electrokinetic Capillary Chro- matography for the Separation of Phenoxymethylpenicillin and Related Substances. J. Chro- matogr, A, 1997; 781:417. 116. Sutchff, N., Corran, R H. Comparison of Selectivities of Reversed-Phase High-Performance Liquid Chromatography, Capillary Zone Electrophoresis and Micellar Capillary Elec- trophoresis in the Separation of Neurohypophyseal Peptides and Analogues. J. Chromatogr, 1993; 636:95. 117. Terabe, S., Miyashita, Y., Ishihama, Y, Shibata, O. Cyclodextrin-Modified Micellar Electroki- netic Chromatography: Separation of Hydrophobic and Enantiomeric Compounds. J. Chro- matogr, 1993; 636:47. 118. Kristensen, H. K., Hansen, S. H. Separation of Polymyxins by Micellar Electrokinetic Capil- lary Chromatography. J. Chromatogr, 1993; 628:309. 119. Kiyohara, C, Saitoh, K., Suzuki, N. Micellar Electrokinetic Capillary Chromatography of Haematoporphyrin, Protoporphyrin and Their Copper and Zinc Complexes. J. Chromatogr, 1993; 646:397. 120. Weinberger, R., Sapp, E., Moring, S. Capillary Electrophoresis of Urinary Porphyrins with Absorbance and Fluorescence Detection. J. Chromatogr, 1990; 516:271. 121. Thormann, W, Minger, A., Molteni, S., Caslavska, J., Gebauer, R Determination of Substituted Purines in Body Fluids by Micellar Electrokinetic Capillary Chromatography with Direct Sam- ple Injection. J. Chromatogr, 1992; 593:275. 122. Valbuena, G. A., Rao, L. Y, Peterson, J. R., Okorodudu, A. O., Bissell, M. G., Mohammad, A. A. Anionic-Zwitterionic Mixed Micelles in the Micellar Electrokinetic Separation of Clin- ically Relevant Steroids on a Fused-Silica Capillary. J. Chromatogr, A, 1997; 781:467. 123. Dang, Q.-X., Sun, Z.-P, Ling, D.-K. Separation of Sulphonamides and Determination of the Active Ingredients in Tablets by Micellar Electrokinetic Capillary Chromatography. J. Chro- matogr, 1992; 603:259. 124. Chan, K. C, Alvarado, A. B., McGuire, M. T, Muschik, G. M., Issaq, H. J., Snader, K. M. High- Performance Liquid Chromatography and Micellar Electrokinetic Chromatography of Taxol and Related Taxanes from Bark and Needle Extracts of Taxus Species. J. Chromatogr, B: Bio- med. Appl, 1994; 657:301. 125. Linhares, M. C, Kissinger, P. T. Pharmacokinetic Studies Using Micellar Electrokinetic Capillary Chromatography with In Vivo Ultrafiltration Probes. J. Chromatogr, 1993; 615:327. 126. Dang, Q.-x., Ling-xao, Y, Sun, Z.-p., Ling, D.-k. Separation and Simultaneous Determination of the Active Ingredients in Theophylline Tablets by Micellar Electrokinetic Capillary Chro- matography. J. Chromatogr, 1993; 630:363.
    • References 2 0 3 127. Lee, K.-J. Determination of Tricyclic Antidepressants in Human Plasma by Micellar Electro- kinetic Capillary Chromatograpy J. Chromatogr., 1993; 616:135. 128. Ong, C. P., Ng, C. L., Lee, H. K., Li, S. E Y. Separation of Water- and Fat-Soluble Vitamins by Micellar Electrokinetic Chromatography. J. Chromatogr., 1991; 547:419. 129. Barker, G. E., Horvath, W. J., Huie, C. W, Hartwick, R. A. Separation of Type 1 and 111 Iso- mers of Copro- and Uroporphyrins Using Affinity Capillary Electrophoresis. J. Lic{. Chro- matogr, 1993; 16:2089. 130. Wu, N., Li, B., Sweedler,J. V. Recent Developments in Porphyrin Separations Using Capillary Electrophoresis with Native Fluorescence Detection. J. Liq, Chromatogr, 1994; 17:1917. 131. Nishi, H., Fukuyama, T., Matsuo, M., Terabe, S. Separation and Determination of Lipophilic Corticosteroids and Benzothiazepin Analogues by Micellar Electrokinetic Chromatography Using Bile Salts. J. Chromatogr, 1990; 513:279. 132. Yeo, S. K., Ong, C. E, Li, S. E Y Optimization of High-Performance Capillary Electrophore- sis of Plant Growth Regulators Using the Overlapping Resolution Mapping Scheme. Anal. Chan., 1991; 63:2222. 133. Sun, S.-W, Chen, L.-Y. Optimization of Capillary Electrophoretic Separation of Quinolone Antibac- terials Using the Overlapping Resolution Mapping Scheme.J. Chromatogr, A, 1997; 766:215. 134. Vindevogel, J., Sandra, P. Resolution Optimization in Micellar Electrokinetic Chromatogra- phy: Use of Plackett-Burman Statistical Design for the Analysis of Testosterone Esters. Anal. Chtm., 1991; 63:1530. 135. Gassmann, E., Kuo, J. E., Zare, R. N. Electrokinetic Separation of Chiral Compounds. Sc- ence, 1985; 230:813. 136. Tanaka, Y, Terabe, S. Enantiomer Separation of Acidic Racemates by Capillary Electrophore- sis Using Cationic and Amphoteric j8-Cyclodextrins as Chiral Selectors. J. Chromatogr, A, 1997; 781:151. 137. Okafo, N., Camilleri, P Direct Chiral Resolution of Amino Acid Derivatives by Capillary Elec- trophoresis. J. Microcolumn Sep., 1993; 5:149. 138. Rundlett, K. L., Armstrong, D. W. Effect of Micelles and Mixed Micelles on the Efficiency and Selectivity of Antibiotic-Based Capillary Electrophoretic Enantioseparations. Anal. Chem., 1995; 67:2088. 139. Desiderio, C, Fanali, S. Use of Negatively Charged Sulfobutyl Ether-j3-cyclodextrin for Enan- tiomeric Separation by Capillary Electrophoresis. J. Chromatogr, A, 1995; 716:183. 140. Otsuka, K., Terabe, S. Enantiomeric Resolution by Micellar Electrokinetic Chromatography with Chiral Surfactants. J. Chromatogr, 1990; 515:221. 141. Walbroehl, Y., Wagner, J. Enantiomeric Resolution of Primary Amines by Capillary Elec- trophoresis and High-Performance Liquid Chromatography Using Chiral Crown Ethers. J. Chromatogr, A, 1994; 680:253. 142. Varesio, E., Veuthey J.-L. Chiral Separation of Amphetamines by High-Performance Capillary Electrophoresis. J. Chromatogr, A, 1995; 717:219. 143. Rundlett, K. L., Gasper, M. P., Zhou, E. Y, Armstrong, D. W Capillary Electrophoretic Enan- tiomeric Separations Using the Glycopeptide Antibiotic, Teicoplanin. Chirality, 1996; 8:88. 144. Vincent, J. B., Vigh, G. Systematic Approach to Methods Development for the Capillary Elec- trophoretic Analysis of a Minor Enantiomer Using a Single-lsomer Sulfated Cyclodextrin. A Case Study J. Chromatogr, A, 1998; 817:105. 145. D'Hulst, A., Verbeke, N. Chiral Separation by Capillary Electrophoresis with Oligosaccha- rides. J. Chromatogr, 1992; 608:275. 146. Nishi, H., Fukuyama, T., Matsuo, M., Terabe, S. Chiral Separation of Optical Isomeric Drugs Using Micellar Electrokinetic Chromatography and Bile Salts.J. Microcolumn Sep., 1989; 1:234. 147. Furuta, R., Doi, T. Enantiomeric Separation of Diniconazole and Uniconazole by Cyclodex- trin-Modified Micellar Electrokinetic Chromatography. J. Chromatogr, A, 1994; 676:431. 148. Ward, T. J., Dann 111, C, Blaylock, A. Enantiomeric Resolution Using the Macrocyclic Antibi- otics Rifamycin B and Rifamycin SV as Chiral Selectors for Capillary Electrophoresis. J. Chro- matogr, A, 1995; 715:337.
    • 204 Chapter 4 Capillary Zone Electrophoresis 149. Koppenhoefer, B., Epperlein, U., Christian, B., Yibing, J., Yuying, C, Bingcheng, L. Separa- tion of Enantiomers of Drugs by Capillary Electrophoresis. I. y-Cyclodextrin as Chiral Sol- vating Agent.J. Chromarogr., A, 1995; 717:181. 150. Quang, C, Khaledi, M. G. Chiral Separations of Acidic Compounds by Dextrin-Mediated Cap- illary Zone Electrophoresis. J. High Res. Chromatogr., 1994; 17:609. 151. Wang, E, Khaledi, M. G. Nonaqueous Capillary Electrophoresis Chiral Separations with Qua- ternary Ammonium-j8-cyclodextrin. J. Chromatogr., A, 1998; 817:121. 152. Mazzeo, J. R., Grover, E. R., Schwartz, M. E., Petersen, J. S. Novel Chiral Surfactant for the Separation of Enantiomers by Micellar Electrokinetic Capillary Chromatography. J. Chro- matogr, A, 1994; 680:125. 153. Aturki, Z., Desiderio, C, Mannina, L., Fanah, S. Chiral Separations by Capillary Zone Elec- trophoresis with the Use of Cyanoethylated-/3-Cyclodextrin as Chiral Selector.J. Chromatogr, A, 1998; 817:91. 154. Peterson, T. E., Trowbridge, D. Quantitation of L-Epinephrine and Determination of the D/L- Epinephrine Enantiomer Ratio in a Pharmaceutical Formulation by Capillary Electrophore- sis. J. Chromatogr, 1992; 603:298. 155. Fanah, S., Flieger, M., Steinerova, N., Nardi, A. Use of Cyclodextrins for the Enantioselec- tive Separation of Ergot Alkaloids by Capillary Zone Electrophoresis. Electrophoresis, 1992; 13:39. 156. Desiderio, C, Polcaro, C. M., Padiglione, P, Fanah, S. Enantiomeric Separation of Acidic Her- bicides by Capillary Electrophoresis Using Vancomycin as Chiral Selector. J. Chromatogr, A, 1997; 781:503. 157. Nielen, M. W. E (Enantio-)Separation of Phenoxy Acid Herbicides Using Capillary Zone Elec- trophoresis. J. Chromatogr, 1993; 637:81. 158. Otsuka, K., Smith, C. J., Grainger, J., Barr,J. R., Patterson Jr., D. G., Tanaka, N., Terabe, S. Stereoselective Separation and Detection of Phenoxy Acid Herbicide Enantiomers by Cyclodextrin-Modified Capillary Zone Electrophoresis-Electrospray Ionization Mass Spec- trometry/ Chromatogr, A, 1998; 817:75. 159. Aumatell, A., Guttman, A. Ultra-fast Chiral Separation of Basic Drugs by Capillary Elec- trophoresis. J. Chromatogr, A, 1995; 717:229. 160. Shibukawa, A., Lloyd, D. K., Wainer, I. W. Simultaneous Chiral Separation of Leucovorin and Its Major Metabolite 5-Methyltetrahydrofolate by Capillary Electrophoresis Using Cyclodex- trins as Chiral Selectors: Estimation of the Formation Constant and Mobihty of the Solute- Cyclodextrin Complexes. Chromatographia, 1993; 35:419. 161. Valko, I. E., Billiet, H. A. H., Frank, J., Luyben, K. C. A. M. Factors Affecting the Separation of Mandelic Acid Enantiomers by Capillary Electrophoresis. Chromatographia, 1994; 38:730. 162. Fanah, S., Camera, E. Use of Cyclodextrins in the Capillary Electrophoretic Separation of Ery- thro- and Threo-Mefloquine Enantiomers. J. Chromatogr, A, 1996; 745:17. 163. Kuhn, R., Riester, D., Fleckenstein, B., Wiesmuller, K.-H. Evaluation of an Optically Active Crown Ether for the Chiral Separation of Di- and Tripeptides. J. Chromatogr, A, 1995; 716:371. 164. Huang, W X., Fazio, S. D., Vivilecchia, R. V Achievement of Enantioselectivity of Non-polar Primary Amines by a Non-chiral Crown Ether. J. Chromatogr, A, 1997; 781:129. 165. Schmitt, T., Engelhardt, H. Derivatized Cyclodextrins for the Separation of Enantiomers in Capillary Electrophoresis. J. High Res. Chromatogr, 1993; 16:525. 166. Fillet, M., Bechet, I., Chiap, P, Hubert, R, Crommen, J. Enantiomeric Purity Determination of Propranolol by Cyclodextrin-Modified Capillary Electrophoresis. J. Chromatogr, A, 1995; 717:203. 167. Bjornsdottir, I., Hansen, S. H., Terabe, S. Chiral Separation in Non-aqueous Media by Capil- lary Electrophoresis Using the Ion-Pair Principle. J. Chromatogr, A, 1996; 745:37. 168. Nouadje, G., Nertz, M., Courderc, E Study of the Racemization of L-Serine by Cyclodextrim- Modified Micellar Electrokinetic Chromatography and Laser-Induced Fluorescence Detec- tion. J. Chromatogr, A, 1995; 716:331.
    • References 205 169. Ferguson, P D., Goodall, D. M., Loran, J. S. Systematic Approach to the Treatment of Enan- tiomeric Separations in Capillary Electrophoresis and Liquid Chromatography III. A Binding Constant-Retention Factor Relationship and Effects of Acetonitrile on the Chiral Separation of Tioconazole. J. Chromatogr., A, 1996; 745:25. 170. Dethy J.-M., De Bronx, S., Lesne, M., Longstreth, J., Gilbert, P. Stereoselective Determination of Verapamil and Norverapamil by Capillary Electrophoresis. J. Chromatogr., B, 1994; 654:121. 171. Gareil, P., Gramond, J. P., Guyon, F. Separation and Determination of Warfarin Enantiomers in Human Plasma Samples by Capillary Zone Electrophoresis Using a Methylated j3-Cyclodex- trin-Containing Electrolyte. J. Chromatogr., 1993; 615:317. 172. Soini, H., Stefansson, M., Riekkola, M.-L., Novotny M. V. Maltooligosaccharides as Chiral Selectors for the Separation of Pharmaceuticals by Capillary Electrophoresis. Anal Chem., 1994; 66:3477. 173. Dobashi, A., Ono, T., Hara, S., Yamaguchi, J. Enantioselective Hydrophobic Entanglement of Enantiometric Solutes with Chiral Functionalized Micelles by Electrokinetic Chromatogra- phy J. Chromatogr, 1989; 480:413. 174. Swartz, M. E., Mazzeo, J. R., Grover, E. R., Brown, P. R. Validation of Enantiomeric Separa- tions by Micellar Electrokinetic Capillary Chromatography Using Synthetic Chiral Surfac- tants. J. Chromatogr, A, 1996; 735:303. 175. Snopek, J., Jelinek, I., Smolkova-Keulemansova, E. Micellar, Inclusion and Metal-Chelate Enantioselective Pseudophases in High-Performance Electromigration Methods. J. Chro- matogr, 1988; 452:571. 176. Snopek, J., Soini, H., Novotny, M., Smolkova-Keulemansova, E., Jelinek, I. Selected Applica- tions of Cyclodextrin Selectors in Capillary Electrophoresis. J. Chromatogr, 1991; 559:215. 177. Penn, S. G., Goodall, D. M., Loran, J. S. Differential Binding of Tioconazole Enantiomers to Hydroxypropyl-p-cyclodextrin Studied By Capillary Electrophoresis. J. Chromatogr, A, 1993; 636:149. 178. Schmitt, T, Engelhardt, H. Charged and Uncharged Cyclodextrins as Chiral Selectors in Cap- illary Electrophoresis. Chromatographia, 1993; 37:475. 179. Tait, R. J., Thompson, D. O., Stella, V J., Stobaugh, J. E Sulfobutyl Ether j8-Cyclodextrin as a Chiral Discriminator for Use with Capillary Electrophoresis. Anal. Chem., 1994; 66:4013. 180. Vincent, J. B., Sokolowski, A. D., Nguyen, T. V, Vigh, G. A Family of Single-lsomer Chiral Resolving Agents for Capillary Electrophoresis. 1. Heptakis(2,3-Diacetyl-6-Sulfato)-j8- Cyclodextrin. Anal. Chem., 1997; 69:4226. 181. Cai, H., Vigh, G. Use of Heptakis-(2,3-0-Dimethyl-6-Sulfato)-j5-Cyclodextrin, as a New Sin- gle-lsomer Chiral Resolving Agent for the Separation of the Enantiomers of Neutral Com- pounds by Capillary Electrophoresis. J. Microcolumn Sep., 1998; 10:293. 182. Wren, S. A. C, Rowe, R. C. Theoretical Aspects of Chiral Separation in Capillary Elec- trophoresis. 1. Initial Evaluation of a Model. J. Chromatogr, 1992; 603:235. 183. Wren, S. A. C, Rowe, R. C. Theoretical Aspects of Chiral Separation in Capillary Elec- trophoresis. II. The Role of Organic Solvent. J. Chromatogr, 1992; 609:363. 184. Wren, S. A. C, Rowe, R. C. Theoretical Aspects of Chiral Separation in Capillary Elec- trophoresis. 111. Application to B-Blockers. J. Chromatogr, 1993; 635:113. 185. Rawjee, Y. Y., Williams, R. L., Vigh, G. Capillary Electrophoretic Chiral Separations Using p-Cyclodextrin as Resolving Agent. II. Bases: Chiral Selectivity as a Function of pH and the Concentration of B-Cyclodextrin. J. Chromatogr, 1993; 652:233. 186. Rawjee, Y. Y, Staerk, D. U., Vigh, G. Capillary Electrophoretic Chiral Separations with Cyclodextrin Additives 1. Acids: Chiral Selectivity as a Function of pH and the Concentration of p-Cyclodextrin for Fenoprofen and Ibuprofen. J. Chromatogr, 1993; 635:291. 187. Williams, B. A., Vigh, G. Dry Look of the CHARM (Charged Resolving Agent Migration) Model of Enantiomer Separations by Capillary Electrophoresis. J. Chromatogr, A, 1997; 777:295. 188. Berthod, A., Chang, S.-C, Armstrong, D. W Empirical Procedure That Uses Molecular Struc- ture to Predict Enantioselectivity of Chiral Stationary Phases. Anal. Chem., 1994; 64:395.
    • 2 0 6 Chapter 4 Capillary Zone Electrophoresis 189. Armstrong, D. W, Tang, Y., Ward, T., Nichols, M. Derivatized Cyclodextrins Immobilized on Fused-Silica Capillaries for Enantiomeric Separations via Capillary Electrophoresis, Gas Chro- matography, or Supercritical Fluid Chromatography. Anal. Chem., 1993; 65:1114. 190. Mayer, S., Schurig, V Enantiomer Separation by Electrochromatography on Capillaries Coated with Chirasil-Dex. HRC & CC, 1992; 15:129. 191. Mayer, S., Schurig, V Enantiomer Separation by Electrochromatography in Open Tubular Columns Coated with CHIRASIL-DEX. J. Liq. Chromatogr., 1993; 16:915. 192. Lurie, 1. S., Klein, R. X., Lebelle, M., Brenneisen, R., Weinberger, R. Chiral Resolution of Drugs of Forensic Interest by Capillary Electrophoresis Using Cyclodextrins. Anal Chem., 1994; 66:4019. 193. Thomas, J., Bunke, A., Karbaum, A. Use of Chiral and Achiral Ion-Pairing Reagents in Com- bination with Cyclodextrins in Capillary Electrophoresis. J. Chromatogr., A, 1998; 798:281. 194. Zhou, L., Trubig, J., Dovletoglou, A., Locke, D. C. Enantiomeric Separation of the Novel Growth Hormone Secretagogue MK-0677 by Capillary Zone Electrophoresis. J. Chromatogr, A, 1997; 773:311. 195. Bunke, A., Jira, T. Enantiomeric Separation by Capillary Electrophoresis Using Chiral and Achiral Ion Pairing Reagents. Pharmazic, 1996; 51:479. 196. Kuhn, R., Wagner, J., Walbroehl, Y., Bereuter, T. Potential and Limitations of an Optically Active Crown Ether for Chiral Separation in Capillary Zone Electrophoresis. Electrophoresis, 1994; 15:828. 197. Kuhn, R., Erni, F, Bereuter, T. Chiral Recognition and Enantiomeric Resolution Based on Host-Guest Complexation with Crown Ethers in Capillary Zone Electrophoresis. Anal. Chem., 1992; 64:2815. 198. Huang, W. X., Xu, H., Fazio, S. D., Vivilecchia, R. V. Chiral Separation of Primary Amino Compounds Using a Non-chiral Crown Ether with y8-Cyclodextrin in Capillary Elec- trophoresis. J. Chromatogr, B: Biomed. Appl, 1997; 695:157. 199. Armstrong, D. W, Chang, L. W, Chang, S. S. C. Mechanism of Capillary Electrophoresis Enantioseparations Using a Combination of an Achiral Crown Ether Plus Cyclodextrins. J. Chromatogr, A, 1998; 793:115. 200. Armstrong, D. W, Rundlett, K. L., Chen, J.-R. Evaluation of the MacrocycUc Antibiotic Van- comycin as a Chiral Selector for Capillary Electrophoresis. Chirality, 1994; 6:496. 201. Gasper, M. P, Berthod, A., Nair, U. B., Armstrong, D. W Comparison and Modeling Study of Vancomycin, Ristocetin A, and Teicoplanin for CE Enantioseparations. Anal. Chem., 1996; 68:2501. 202. Trelh-Siefert, L. A., Risley D. S. Capillary Electrophoretic Enantiomeric Separations of Non- steroidal Anti-inflammatory Compounds Using the Macrocychc Antibiotic Actaplanin A and 2-Methoxyethanol. J. Liq. Chromatogr Related Technol, 1998; 21:299. 203. Reilly, J., Risley, D. S. The Separation of Enantiomers by Countercurrent Capillary Elec- trophoresis Using the MacrocycUc Antibiotic A82846B. LC/GC, 1998; 16:170. 204. Hong, M., Soini, H., Baker, A., Novotny M. V Complexation between Amylodextrin Oligomers and Selected Pharmaceuticals Measured through Capillary Electrophoresis. Anal. Chem., 1998; 70:3590. 205. Fillet, M., Hubert, P, Crommen, J. Enantioseparation of Non-steroidal Anti-inflammatory Drugs by Capillary Electrophoresis Using Mixtures of Anionic and Uncharged p-Cydodex- trins as Chiral Additives. Electrophoresis, 1997; 18:1013. 206. Nishi, H., Nakamura, K., Nakai, H., Sato, T. Enantiomeric Separation of Drugs by Mucopolysaccharide-Mediated Electrokinetic Chromatography. Anal. Chem., 1995; 67:2334. 207. Cole, R. O., Sepaniak, M. J., Hinze, W L. Optimization of Binaphthyl Enantiomer Separations by Capillary Zone Electrophoresis Using Mobile Phases Containing Bile Salts and Organic Sol- vent. HRC & CC, 1990; 13:579.
    • References 2 0 7 208. Aumatell, A., Wells, R. J. Enantiomeric Differentiation of a Wide Range of Pharmacologically Active Substances by Cyclodextrin-Modified Micellar Electrokinetic Capillary Chromatogra- phy Using a Bile SaU. J. Chromatogr., A, 1994; 688:329. 209. Iran, A. D., Blanc, T., Leopold, E. J. Free Solution Capillary Electrophoresis and Micellar Elec- trokinetic Resolution of Amino Acid Enantiomers and Peptide Isomers with L- and D-Marfey's Reagents. J. Chromatogr., 1990; 516:241. 210. Chan, K. C, Muschik, G. M., Issaq, H. J. Enantiomeric Separation of Amino Acids Using Micellar Electrokinetic Chromatography after Pre-column Derivatization with the Chiral Reagent l-(9-Fluorenyl)-ethyl chloroformate. Electrophoresis, 1995; 16:504. 211. Lurie, I. S. Micellar Electrokinetic Capillary Chromatography of the Enantiomers of Amphet- amine, Methamphetamine and Their Hydroxyphenethylamine Precursors. J. Chromatogr, 1992; 605:269. 212. Anhoff, M., Einarsson, S., Chiral Deriyatization, in Chiral Liquid Chromatography, Chapter 4, Ed. W J. Lough, 1990, Blackie & Sons: p. 39. 213. Guzman, N. A. Column Watch. On-Line Bioaffinity, Molecular Recognition, and Preconcen- tration in CE Technology LC/GC, 1999; 17:16. 214. Chu, Y.-H., Kirby, D. P, Karger, B. L. Free Solution Identification of Candidate Peptides from Combinational Libraries by Affinity Capillary Electrophoresis/Mass Spectrometry.J. Am. Chem. Soc, 1995; 117:5419. 215. Gomez, E A., Avila, L. Z., Chu, Y.-H., Whitesides, G. M. Determination of Binding Constants of Ligands to Proteins by Affinity Capillary Electrophoresis: Compensation for Electroosmotic Flow. Anal. Chem., 1994; 66:1785. 216. Dalluge, J. J., Sander, L. C. Precolumn Affinity Capillary Electrophoresis for the Identification of Clinically Relevant Proteins in Human Serum: Application to Human Cardiac Troponin 1. Anal. Chem., 1998; 70:5339. 217. Akashi, M., Sawa, T., Baba, Y, Tsuhaku, M. Specific Separation of Oligodeoxynucleotides by Capillary Affinity Gel Electrophoresis (CAGE) Using Poly(9-vinyladenine)-Polyacrylamide Conjugated Gel. J. High Res. Chromatogr, 1992; 15:625. 218. Alber, J. K., Reddy K. R., Lee, C. S. Post-capillary Affinity Detection of Protein Microhetero- geneity in Capillary Zone Electrophoresis. J. Chromatogr, A, 1997; 759:139. 219. Busch, M. H. A., Carels, L. B., Boelens, H. E M., Kraak, J. C, Poppe, H. Comparison of Five Methods for the Study of Drug-Protein Binding in Affinity Capillary Electrophoresis. J, Chro- matogr, A, 1997; 777:311. 220. Busch, M. H. A., Kraak, J.C, Poppe, H. Principles and Limitations of Methods Available for the Determination of Binding Constants with Affinity Capillary Electrophoresis. J. Chromatogr, A, 1997; 777:329. 221. Okun, V. M., Bilitewski, U. Analysis of the Biotin-Binding Protein Actinavidin Using Affinity Capillary Electrophoresis. Electrophoresis, 1996; 17:1627. 222. Amini, A., Westerlund, D. Evaluation of Association Constants Between Drug Enantiomers and Human aj-Acid Glycoprotein by Applying a Partial-Filling Technique in Affinity Capil- lary Electrophoresis. Anal. Chem., 1998; 70:1425. 223. Heegaard, N. H. H., Mortensen, H. D., Roepstorff, P Demonstration of a Heparin-Binding Site in Serum Amyloid P Component Using Affinity Capillary Electrophoresis as Adjunct Tech- nique. J. Chromatogr, A, 1995; 717:83. 224. Gunnarsson, K., Valtcheva, L., Hjerten, S. Capillary Zone Electrophoresis for the Study of the Binding of Antithrombin to Low-Affinity Heparin. GlycoconjugateJ., 1997; 14:859. 225. Barker, G. E., Russo, P, Hartwick, R.A. Chiral Separation of Leucovorin with Bovine Serum Albumin Using Affinity Capillary Electrophoresis. Anal. Chem., 1992; 64:3024. 226. Avila, L. Z., Chu, Y. H., Blossey E. C, Whitesides, G. M. Use of Affinity Capillary Elec- trophoresis to Determine Kinetic and Equilibrium Constants for Binding of Arylsulfonamides to Bovine Carbonic Anhydrase. J. Med. Chem., 1993; 36:126.
    • 208 Chapter 4 Capillary Zone Electrophoresis 227. Shimura, K., Kasai, K.-i. Determination of the Affinity Constants of Concanavalin A for Mono- saccharides by Fluorescence Affinity Probe Capillary Electrophoresis. Anal. Biochem., 1995; 227:186. 228. VanderNoot, V. A., Hileman, R. E., Dordick, J. S., Linhardt, R. J. Affinity Capillary Elec- trophoresis Employing Immobilized Glycosoaminoglycan to Resolve Heparin-Binding Pep- tides. Electrophoresis, 1998; 19:437. 229. German, I., Buchanan, D. D., Kennedy, R. T. Aptamers as Ligands in Affinity Probe Capillary Electrophoresis. Anal. Chem., 1998; 70:4540. 230. Ahmed, A., Ibrahim, H., Pastore, E, Lloyd, D. K. Relationship Between Retention and Effec- tive Selector Concentration in Affinity Capillary Electrophoresis and High-Performance Liq- uid Chromatography. Anal. Chem., 1996; 68:3270. 231. Schmitt, P, Freitag, D., Trapp, I., Garrison, A. W, Schiavon, M., Kettrup, A. Binding of s-Tri- azines to Dissolved Humic Substances: Electrophoretic Approaches Using Affinity Capillary Electrophoresis (ACE) and Micellar Electrokinetic Chromatography (MEKC). Chemosphere, 1997; 35:55. 232. Lausch, R., Reif, O.-W, Riechel, P, Schleper, T. Analysis of Immunoglobulin G Using a Cap- illary Electrophoretic Affinity Assay with Protein A and Laser-Induced Fluorescence Detec- tion. Electrophoresis, 1995; 16:636. 233. Heegaard, N. H. H. Determination of Antigen-Antibody Affinity by Immunocapillary Elec- trophoresis. J. Chromatogr, A, 1994; 680:405. 234. Baba, Y., Inoue, H., Tsuhako, M., Sawa, T., Kishida, A., Akashi, M. Evaluation of the Selective Binding Ability of Oligodeoxynucleotides to Poly(9-vinyladenine) Using Capillary Affinity Gel Electrophoresis. Anal. Sci., 1994; 10:967. 235. Chu, Y. H., Whitesides, G. M. Affinity Capillary Electrophoresis Can Simultaneously Measure Binding Constants of Multiple Peptides to Vancomycin. J. Org. Chem., 1992; 57:3524. 236. Dunayevskiy Y. M., Lyubarskaya, Y. V, Chu, Y.-H., Vouros, P, Karger, B. L. Simultaneous Mea- surement of Nineteen Binding Constants of Peptides to Vancomycin Using Affinity Capillary Electrophoresis-Mass Spectrometry. J. Med. Chem., 1998; 41:1201.
    • CHAPTER Capillary Isoelectric Focusing 5.1 5.2 5.3 5.4 5.5 5.6 5.7 5.8 5.9 5.10 5.11 5.12 5.13 Basic Concepts Separation Mechanism pH Gradient Formation Electrode Buffer Solutions Resolving Power Capillaries and Reagents Performing a Run Injection Focusing Mobilization Salt Effects Detection Applications References 5.1 BASIC CONCEPTS A fundamental parameter of electrophoresis is mobility. This is defined by the charge-to-mass ratio of a solute. Should a solute become neutral during the run, migration will cease. During the course of a run, modification of mobility can occur in a pH gradient generated online by a series of reagents known as carrier ampholytes. Therein lies the fundamental premise of isoelectric focusing (lEF). Conventional lEF is performed in an anticonvective medium such as the slab gel. The advantages and disadvantages of gels, discussed in Section 1.1, apply equally to lEE In contrast to the usual gel format, the pore size of an lEF gel should be sufficiently large to reduce the impact of molecular sieving, which otherwise would lengthen the run time. Agarose gels have an extremely large pore size, 500 nm for a 0.16% gel (1). Polyacrylamide gels with large pore sizes can be formulated as well. 209
    • 210 Chapter 5 Capillary Isoelectric Focusing Detection in the slab gel is time consuming and semiquantitative. The car- rier ampholytes must be washed out of the gel to avoid reaction with the stain- ing reagent. Small peptides are not detectable, since they are lost during the wash step (2). Gels are unnecessary in capillary isoelectric focusing (CIEF), since the ampholyte separation media is effectively supported and contained by the capillary walls. CIEF is performed in free solution. Mobilization represents an additional difference between capillary and con- ventional lEF. Since the focusing process produces electrically neutral solutes, some means of eluting the bands is required for detection. In the slab gel, mobi- lization is unnecessary, since detection is performed by staining. Hjerten and Zhu's original work (3) describes a scheme that forces the proteins to move past the detector window. Such a technique is known as mobilization. 5.2 SEPARATION MECHANISM Figure 5.1 illustrates the mechanism of CIEF A sample is mixed with a series of reagents known as carrier ampholytes. Characteristic of ampholytes is good buffering capacity at their individual p/ values to "carry" the pH (4). In other words, the pK^ of each ampholyte is very close to its pi. The capillary is filled with a sample-ampholyte blend, and a voltage is applied. Ampholyte concentrations of 0.5-2.0% are used for most applications. Under the influence of the applied electric field, carrier ampholytes have the capacity to generate a pH gradient along the length of the capillary Without considering at this stage how the gradient is formed, let us examine the behav- ior of a zwitterionic solute toward the pH gradient. There are two possible behaviors. At a pH below the solute's pi, the zwitterion is positively charged and migrates toward the cathode. As the solute migrates through the pH gradient, it encounters progressively higher pH values. At some point, the solute enters a region along the gradient where the ampholyte pH is equal to its own pi. At this point, the solute's net charge becomes zero, and migra- tion ceases. CATHODE /^^ ANODE '^^^^^^^^^^^^^M^M ^^^^^^^^^^^^^^^^^S. pH GRADIENT HIGH pH "^ LOW pH FIGURE 5.1 Illustration of the capillary isoelectric focusing process.
    • 5.2 Separation Mechanism 211 The second possible behavior occurs when the solute is negatively charged. This occurs along the pH gradient when the pH is greater than the solute's pi. The solute migrates toward the anode, encountering progressively lower pH val- ues. While the direction of migration through the pH gradient is opposite to the case just described, the net result is the same. Solute migration ceases whatever the direction of approach to the proteins pi. When a capillary is filled with a mixture of ampholytes and solutes, both behaviors occur, as shown in Figure 5.1. CIEF is a true focusing technique. If a solute diffuses into a buffer region where it becomes charged, it will migrate back to the region of zero charge. The CIEF system is substantially different from zone electrophoresis. In CZE, the buffer system is homogeneous throughout the length of the capillary and throughout the duration of the run. In CIEF, a heterogeneous pH gradient is cre- ated inside the capillary by applying voltage across the carrier ampholytes. The breadth of the pH gradient depends on which series of ampholytes is selected. Ampholytes are commercially available to cover both wide and narrow pH ranges, as shown in Figure 5.2.i The Ampholines (LKB-Pharmacia) are a series of polyamino-polycarboxylic acids. Servalytes (Serva) are polyamine-polysul- fonic acids. Pharmalytes (LKB-Pharmacia) are branched polyamino-polycar- boxylic acids. The mechanism of isoelectric focusing permits the separation of solutes based on their isoelectric points. Most reported applications are for proteins, 1Carrier ampholytes are available from Bio-Rad (Richmond, CA), Pharmacia LKB (Piscataway, NJ), Serva Biochemicals (Paramus, NJ), Sigma Chemical (St. Louis, MO), and Beckman Instru- ments (Fullerton, CA). pH 2 3 4 5 6 7 8 9 1 0 1 1 FIGURE 5.2 Carrier ampholyte pH ranges. Each horizontal hne represents the pH range covered by an ampholyte blend.
    • 212 Chapter 5 Capillary Isoelectric Focusing but any zwitterionic solute can be separated via this approach. Using CIEF, there is no need to develop a buffer system to separate solutes based on mobility. If the solutes have sufficiently different pJ values, they will separate. This mech- anism of separation contrasts sharply with CZE and CGE, where the bases for separation are respectively the charge-to-mass ratio and molecular size. Righetti's elegant textbook (1) is recommended for further background on con- ventional lEF methodology Many of the phenomena observed in the slab gel are directly related to occurrences in the capillary 5.3 PH GRADIENT FORMATION Before applying the voltage, the individual ampholytes are uniformly distrib- uted throughout the capillary The pH is uniform as well and represents the aver- age pH of the ampholyte blend (Figure 5.3). Individual ampholytes may be cationic or anionic at the start of the run, depending on their pi values. This is illustrated in Figure 5.4 (top), where charge is assigned to the individual ampholytes based on a starting pH of 7. When voltage is applied, the ampholyte mixture begins to separate into indi- vidual components (Figure 5.4, bottom). Complete separation of adjacent ampholytes should not be attained, since this would cause a discontinuity in the pH gradient. Either a step gradient would be observed, or in extreme cases, if the zones separate completely, a water zone would occur. At this point, the electric field strength becomes so high that the capillary sustains damage. pH pH GRADIENT AMPHOLYTE CONCENTRATIONS DISTANCE ALONG CAPILLARY FIGURE 5.3 Representation of a pH gradient and individual ampholyte concentrations before focusing.
    • 5.4 Electrode Buffer Solutions 213 CATHODE ANODE iOH-*-i a-^g* s-^s* 4-"*'io* 7 6-1 •H+| I ; *• •• •• _ • ! ! HIGHliH AVERAGE pH IS 7 L O W H CATHODE ANODE J0H-*.| 10 9 8 7 6 5 4 3 | •H* HIGH pH LOW ~pH FIGURE 5.4 The process of pH gradient formation. Positively charged (high-pl) ampholytes migrate toward the negative elec- trode, and negatively charged ampholytes toward the positive electrode. The migration of ampholytes causes the electrolyte pH to increase as the cathode is approached. Conversely, the pH in the anodic region begins to decline as the low-pI (negatively charged) ampholytes migrate in that direction. Eventually, migration will cease as each ampholyte encounters a pH where its net charge becomes zero. This occurs at the individual isoelectric point, or pi, of each ampholyte. If a solute such as a protein is present in the carrier ampholyte blend, it too migrates while charged, until it encounters a pH equivalent to its pi. The system does not distinguish between a protein and a carrier ampholyte; both behave as zwitterions and migrate according to their respective pi values. At steady state, the ampholyte distribution and resulting pH gradient are illustrated in Fig- ure 5.5. The measured current should approach but never reach zero, since no fur- ther movement from either ampholytes or solutes is expected, except diffusion. 5.4 ELECTRODE BUFFER SOLUTIONS The pH values of the respective electrode buffer solutions are critical in CIEE The anodic buffer, or anolyte, must have a pH that is lower than the pi of the most acidic ampholyte. Similarly, the cathodic buffer, or catholyte, must have a higher pH than the most basic ampholyte. If these conditions are not met, ampholytes will bleed into an electrode buffer reservoir. Diluted versions of elec- trode solutions used in conventional lEF are appropriate for CIEE Selection of the proper anolyte and catholyte serves as a barrier to prevent the migration of
    • 214 Chapter 5 Capillary Isoelectric Focusing pH pH GRADIENT DISTANCE ALONG CAPILLARY FIGURE 5.5 Representation of a pH gradient and individual ampholyte concentrations after focusing. ampholytes into the reservoirs. Should an acidic ampholyte migrate into the more acidic anolyte, its charge becomes positive, and it migrates back toward the neg- ative electrode. The corresponding process occurs at the negative electrode. It is important that fresh sodium hydroxide be used. Otherwise, uptake of carbon dioxide may lower the pH, causing a cathodic drift of the pH gradient (5). Sodium hydroxide (20 mM) and phosphoric acid (10 mM) solutions are fre- quently used as catholyte and anolyte solutions, particularly with the pH 3-10 gra- dient. The 2:1 ratio of hydroxideiacid is not coincidental. Studies have shown that this provides for the most stable pH gradient. Otherwise, anodic or cathodic drifts in the pH gradient are more likely to occur (4). The mechanism for drift is based on a phenomenon known as isotachophorsis (ITP). These drifts reflect the loss of ampholytes into the electrode reservoirs. The 2:1 ratio provides for symmetrical drift of the gradient. For narrow-range gradients such as pH 6-8, weaker acids and bases such as 40 mM glutamic acid (anolyte) and 40 mM arginine (catholyte) can be used (6). Avoiding alkaline pH prolongs the lifetime of the coated capillary While not studied by CIEF, ampholyte blends that are more acidic or basic than the carrier ampholytes have been used as the anolyte and/or catholyte in slab-gel lEF (1). The same holds true for Good's buffer solutions of the appropriate pi. HEPES (pJ 7.51) is used as the anolyte for narrow-range alkaline gradients (1). 5.5 RESOLVING POWER The resolving power, Apl, of CIEF is described by (1)
    • 5.6 Capillaries and Reagents 2 1 5 DCdpH/^)^ (5.1) ^E(dAt/dpH) where D is the diffusion coefficient, E is the field strength, ^ is the mobihty of the protein, and d/J^/d pH describes the mobihty-pH relationship. The term d pH/dx represents the change in the buffer pH per unit of capillary length. This adjustable parameter is controlled by selecting an appropriate ampholyte pH range as well as the capillary length. For highest resolution, a narrow-pH ampholyte range should be selected. To separate a wide pi range of proteins, although at lower resolution, select a broad-pH-range ampholyte blend. Under optimal conditions, resolution of 0.02 pH units can be achieved (1). 5.6 CAPILLARIES AND REAGENTS A. COATED CAPILLARIES The use of coated capillaries is preferred in CIEF, to suppress the EOF and min- imize protein adsorption (3, 7, 8). The reduction of EOF is desired in CIEF for several reasons: 1. The EOF may sweep the solutes past the detector before focusing is com- plete. This is another form of cathodic drift of the pH gradient. 2. Silanol ionization at the capillary wall is pH dependent. In the presence of a pH gradient, the degree of ionization will vary along with the pH. As a result, the measured EOF is the average value derived from the inte- grated contributions along the entire length of the capillary. This can generate an osmotic pressure throughout the capillary, causing a hydro- dynamic-like flow profile. However, the focusing effect from CIEF prob- ably overcomes this form of band broadening. 3. In the presence of EOF; the low-pH anolyte enters the capillary, since the net flow is directed toward the cathode. As more of the anolyte fills the capillary, the EOF declines as ionized silanol groups are protonated. This leads to nonlinearity of the pH gradient. Under nonlinear conditions, the migration time is not proportional to the pi. Calibration is difficult when this occurs, since multiple standards are required. In addition, the migra- tion time for acidic proteins becomes rather long. A wide variety of coated capillaries can be employed in CIEF This is illus- trated in Figure 5.6, where six different capillaries were investigated for the sep- aration of recombinant tissue plasminogen activator (rt-PA) (9). All of these capillaries except the DB WAX were considered equivalent. The success of these
    • 216 Chapter 5 Capillary Isoelectric Focusing o X u O I Pi o FIGURE 5.6 Effect of the capillary coating type on the resolution of rt-PA glycoforms. Capillary: 27 cm (20 cm to detector) x 50 |lm id coated as specified; ampholytes: 1.5% pH 3-10,1.5% pH 5-8, 0.1% HPMC, 0.75% TEMED, 4 M urea; anolyte: 10 mM phosphoric acid; catholyte: 20 mM sodium hydroxide; focusing: -500 V/cm; mobilization: one-step; detection: UV, 280 nm; temperature: 20°C. Reprinted with permission from J. Chromatogr, 717, 61 (1995), copyright © 1995, Elsevier Science Publishers. capillaries may be due to the presence of urea and hydroxypropylmethylcellu- lose (HPMC) in the ampholyte blend. The use of urea may eliminate solubility problems that the protein may have in and around its isoelectric point. When selecting a capillary, it is important to measure its stability, since many of the coatings are susceptible to degradation by alkaline reagents. It is usually necessary to change the capillary after 50-100 runs. Shortening the degree of contact with alkaline reagents is very effective in reducing this problem. If the
    • 5.6 Capillaries and Reagents 217 protein has a low pJ, then ehminating the alkaUne ampholytes via a narrow- range gradient is even more effective. Since the migration times may change with time and can be influenced by the solute concentration and salt concentration, the use of internal standards to calibrate the pH gradient is mandatory. B. INTERNAL STANDARDS Marker proteins or synthetic markers are generally employed to calibrate pi ver- sus time. Kits are available from many manufacturers. Typical lEF protein mark- ers are listed in Table 5.1. A good marker protein provides a single or several well-defined sharp peaks. Crude protein preparations often give broad bands due to impurities or microheterogeneity. The problem with proteins as internal standards is interference with the solutes of interest in complex separations. When this occurs, it is necessary to perform two runs: with and without the internal standards. Small zwitterionic molecules such as azo dyes are alternative choices. For example, methyl red (pi 3.8) does not absorb at 280 nm, the protein-monitoring wavelength. Using a diode array detector, it is possible to monitor simultaneously the methyl red absorbance at 500 nm and the protein absorbance at 280 nm. In this regard, methyl red is an ideal internal standard, but few such molecules have been identified. Aminomethylphenyl dyes absorb at 280 nm, although their maximum absorption is around 400 nm (10). Nevertheless, they have been employed as Table 5.1 Marker Proteins for lEF Protein Amyloglucosidase Glucose oxidase Trypsin inhibitor p-Lactoglobulin A Carbonic anhydrase II Carbonic anhydrase II Carbonic anhydrase I Myoglobin Lentil lectin Trypsinogen Source Aspergillus niger Aspergillus niger Soybean Bovine milk Bovine erythrocytes Bovine erythrocytes Human erythrocytes Horse heart Lens culinaris Bovine pancreas Pl 3.6 4.2 4.6 5.1 5.4 5.9 6.6 6.8, 7.2 8.2, 8.6, 8.8 9.3 Data excerpted from Sigma Chemical catalog 1998, p. 1985.
    • 218 Chapter 5 Capillary Isoelectric Focusing pi markers in CIEF (11). The advantage of synthetic markers is that their pi val- ues are not affected by the presence of denaturants such as urea. In complex protein separations, the use of 400-nm detection allows calibration of the sys- tem even if the peaks are obscured at 280 nm. C. PREPARATION OF METHYLCELLULOSE SOLUTION To further suppress the EOF and maintain a coated capillary wall, methylcellu- lose solutions are useful for preparing the anolyte and ampholyte solutions. If a partial-fill technique is employed (Section 5.8), the catholyte can be prepared in methylcellulose as well. The viscous media also helps suppress peak distor- tions during the subsequent mobilization steps. The following procedure works well for solubilizing this material (12). Alternatively, hydroxypropylmethylcel- lulose (HPMC) solutions can be used. For one-step CIEF, a 0.1% HPMC solu- tion lowers the EOF without completely suppressing it. This material is also more water soluble than methylcellulose. Heat 250 mM HPCE-grade water to 60-70°C. Add 0.9375 g (0.375%) methylcellulose (1500 cp for a 2% aqueous solution at 20°C, Sigma) and mix to form a suspension. After 5 min, place the suspension in ice-water and stir until the material enters solution and the mixture reaches 5-10°C. It is essen- tial to filter this material through a 0.45-|Lim filter prior to use. D. AMPHOLYTE BACKGROUND U V ABSORPTION Unfortunately carrier ampholytes contain some chemicals that absorb at 280 nm. These reagents were not originally designed for capillary electrophoresis. The ampholytes were created for the slab gel with detection by traditional staining methods using dyes such as Coomassie brilliant blue R-250. When running in the capillary format, it is essential to perform a blank run. For hydrophilic proteins with good absorbance at 280 nm, the ampholyte back- grounds are usually not a problem, since one can start with a solute concentra- tion of several hundred micrograms per milliliter. If the proteins are hydrophobic, then the protein concentration must be reduced to avoid precipitation. If the pro- tein is deficient in aromatic amino acids and absorbs poorly at 280 nm, interfer- ence from the ampholytes, even at 0.5% concentration, may be a problem. Figure 5.7 shows CIEF of rt-PA versus the blank for several ampholytes from various manufacturers (13). Substantial backgrounds are found for some of the reagents. Since successful separations were reported elsewhere for both Bio- Lytes and Servalytes, it is possible that batch-to-batch variation is occurring.
    • 5.6 Capillaries and Reagents 219 Time (minutts) FIGURE 5.7 Impact of carrier ampholytes on the blank (dashed line) and the rt-PA glycoform pro- file. Capillary: 27 cm (20 cm to detector) x 50 |im id eCAP neutral; ampholytes: 1.5% pH 3-10, 1.5% pH 5-8, 0.1% HPMC, 0.75% TEMED, 4 M urea; anolyte: 10 mM phosphoric acid; catholyte: 20 mM. sodium hydroxide; focusing: -500 V/cm; mobilization: one-step; detection: UV, 280 nm; temperature: 20°C; rt-PA concentration: 125 jLig/mL. Key: A) Pharmalytes, B) Ampholines, C) Bio- Lytes, D) Servalytes. Reprinted with permission from J. Chromatogr., 744, 279 (1996), copyright © 1996, Elsevier Science Publishers. When ampholyte interference is a problem, decolorizing activated carbon can be used to clean the ampholytes (14). Stop up a Pasteur pipet with a plug of glass wool and fill with some activated carbon. Add the ampholytes and, using a pipet bulb, push the material through the column. Hopefully the aro- matic ampholytes will adsorb on the activated carbon, thereby reducing the reagent background. All ampholyte blends are not created equal. If ampholytes from one source give a high background, try the same pH range from another manufacturer. Beware that since ampholytes are not tested for CIEF, batch-to-batch variation in the reagent background may occur when different lots, even from the same manufacturer, are employed.
    • 220 Chapter 5 Capillary Isoelectric Focusing E. PREPARATION OF NARROW-RANGE AMPHOLYTE MIXTURES Narrow-range pH gradients are advantageous for two reasons: 1. If the pH range is less basic, the capillary coating is better preserved. 2. The resolution is improved. The improvement in resolution is shown in Figure 5.8 for the separation of rt-PA using a blend of pH 4-8 and pH 3-10 ampholytes (9). The optimal blend is a 50:50 mixture of the two ampholyte solutions. The need for blended ampholyte solutions when running narrow-range gra- dients arises from the number of carrier ampholytes present. When the blends are manufactured, the narrow-range cuts contain fewer ampholyte species. While there are at least hundreds of ampholytes present per pH unit (1), the reduction in the total number of ampholyte species has consequences. This can lead to the production of step gradients or water zones within the capillary. The use of the ampholyte blend ensures an adequate number of ampholytes. The higher con- centration of the narrow-range material serves to improve the resolution. If more resolution is required at a particular pH range, it is possible to flat- ten the gradient at that point through the addition of a spacer or separator (15). For example, the separation of adult hemoglobin (Hb A) from its glycated form, Hb Ale, is difficult, because the ApJ is 0.03 pH units. The addition of 330 mM /3-alanine and 330 mM 6-aminocarproic acid to the narrow-range ampholyte blend (5% 6-8, 0.5% 3-10) provides a baseline separation (16). The trick is to MIGRATION TIME rMIN^ FIGURE 5.8 Effect of changing the ratio of ampholytes from 100% pH 5-8 to 100% pH 3-10. Other conditions as per Figure 5.7. Reprinted with permission fromJ. Chromatogr, 717, 61 (1995), copyright © 1995, Elsevier Science Publishers.
    • 5.6 Capillaries and Reagents 221 add a separator with a pJ nearly equal to the portion of the gradient to be flat- tened. The reason for the high concentrations of spacers is that they are poor ampholytes. That is, their pK^ values are far from their pi values. But there are no available good ampholytes that precisely hit the pH 6.9 region. Good ampholytes function well as spacers at the 15 mM level. Other good ampholytes that can serve as spacers include aspartic acid, pi 2.77; glutamic acid, pi 3.22; triglycine, pi 5.59; histidine, pi 7.47; and lysine, pi 9.74. Refer to reference (15) for a complete listing of ampholytes that can serve as spacers. F. ADDITIVES FOR HYDROPHOBIC PROTEINS The tendency of hydrophobic proteins to aggregate and precipitate is a major problem in lEF, whether in the slab-gel or capillary format. The focusing power of CIEF produces an increase in solute concentration by a factor of more than 200 (17). Proteins also readily precipitate as the pi is approached, since their charge and, thus, their electrostatic repulsion approach zero. The problem is exacerbated by the necessity of increasing protein concentration to visualize minor impurities (15). Protein precipitation is indicated first by spikes in the electropherogram, fol- lowed by clogging of the capillary Additives are required to suppress the aggre- gation of hydrophobic proteins to keep them in solution. Two excellent review articles describing solutions to this problem serve as the source for much of the material in the following discussion (18, 19). Urea has been a reagent of first choice, but it is not without problems. Urea can suppress protein aggregation by disrupting hydrogen bonds, the so-called "iceberg effect." At high concentrations, urea is not uniformly dispersed, but forms organized channels. These channels bind to linear alkyl chains, but not branched or cyclic molecules. The complexes, which are undefined, are actu- ally less soluble than the native protein. To better solubilize these solutes, sur- factants are often used in combination with urea. Unfortunately, the high ionic strength of SDS may cause heating problems in CIEF. Nonionic surfactants such as Brij-35, Triton X-100, Nonidet P-40, octyl glucoside, and lauryl maltoside or zwitterionic detergents such as sulfobetains (CHAPS, for example) can be used at concentrations of 0.1-5%. Not all of these surfactants have been used in the capillary format. The surfactant must not absorb at 280 nm, which necessitates the use of the reduced form of Triton X-100. Another important problem linked to the use of urea is carbamylation. In aqueous solution, urea is in equilibrium with ammonium cyanate, the level of which increases with increasing concentration and temperature. Cyanate can react with amines to produce substituted ureas. The use of ultrapure and fresh
    • 222 Chapter 5 Capillary Isoelectric Focusing urea and the use of low temperatures (20-25°C) minimizes the cyanate con- centration. The ampholytes themselves serve as good cyanate scavengers. Most of the reported work on CIEF has been on native proteins (we think), since the effects of solubilizers such as surfactants and urea have not been thor- oughly studied. Denaturing CIEF has been reported (20) wherein 5% mercap- toethanol and 8 M urea were added to the ampholyte blend. SDS was not used in the separation, and it is not known whether the sample was boiled prior to CIEE The state of denaturation of these and other proteins is not well known. Gentle detergents and other additives are more often used in lEF, and so it becomes more likely that native proteins are being separated. Polyols such as eth- ylene glycol, glycerol, sorbitol, or nonreducing sugars may be useful. A mixture of 20% sorbitol and 100 mM taurine in pH 6-8 ampholytes has been successful in separating thermamylase (21). Glycols do not keep thermamylase in solution, but 20% sucrose in taurine buffer works well. Thus, a strategy of mixing poly- ols and zwitterions proved successful in dealing with solubility problems. 5.7 PERFORMING A RUN There are three basic modes of operation of CIEF, which are distinguished by the process by which the focused bands are mobilized through the detector. These are: 1. Chemical (salt) mobilization 2. Electroosmotic (one-step) mobilization 3. Hydrodynamic mobilization The conditions for four separate protocols are summarized in Table 5.2. The mode of injection also serves to distinguish these methods. The capillary can be completely filled with sample-ampholyte blend or partially filled. In addi- tion, the sample can be injected sandwiched between segments of ampholytes, thereby avoiding the need to dissolve the sample in ampholytes (2). A. CAPILLARY CONDITIONING Various rinsing procedures can be employed to ensure a clean and reproducible capillary surface. To ensure that residual proteins are removed from the capil- lary, a postrun wash consisting of a 1-min high-pressure rinse with 100 mM phosphoric acid followed by 0.5 min with methanol and 0.5 min with deion- ized water is employed (22). An alternative procedure is to rinse for 1 min with 0.1 N hydrochloric acid, 1 min with 10 mM phosphoric acid, and 1 min with water (9).
    • 3.7PerformingaRun223 O u o 2 o u t oo w o B o in gs oX a ^o13 > o fN % O ^ O ^ X oc« z % ao(N X ow 2 ^ ao<N X oOS 2 S ao(N X oOJ 2 S ao(N o X o 1o uin oCQ O.-H- ^a a=^ uo 1^X a:s =ia ineg xl It 2B MH;_ .aS:J <USH >"^O-13 cjS C/5C*H ^2 Is °£
    • 224 Chapter 5 Capillary Isoelectric Focusing B. SAMPLE PREPARATION Dissolve the protein in 0.5-2% carrier ampholytes to give a final concentration of between 50 and 500 |ig/mL. Always start at the lower concentrations to min- imize the potential of precipitation upon focusing. Hydrophilic proteins can be run at the higher concentrations, hydrophobic proteins at lower concentrations. Note: It is useful to have a syringe handy to unclog the capillary. If the salt content of a protein sample is above 50 mM, the sample should be desalted or online desalting should be utilized (Section 5.11). One such desalt- ing method is as follows (23): 1. Add 5 parts cold methanol to 1 part sample. 2. Store at -80°C for 30 min. 3. Centrifuge at 15,000g. 4. Discard the supernatant. 5. Resuspend the sample pellet in the ampholyte solution. Dialysis, gel filtration, dilution, or solid-phase extraction are other common desalting techniques. These procedures are covered in Section 10.5. 5.8 INJECTION Since viscous liquids are being loaded, much time will be saved if the instru- ment can be operated in a high-pressure mode. At 200 psi, a 50-|Lim-i.d. capil- lary can be filled with 0.4% methylcellulose solution in 30 s. A. WHOLE-CAPILLARY INJECTION The entire capillary can be filled with sample-ampholyte blend. It is possible that material will focus on the blind side of the capillary beyond the detector window. In this case, add N,N,N,N-tetramethylenediamine (TEMED) to the ampholyte blend to block the blind side of the capillary This basic reagent is positively charged at most pH values, and so it migrates toward and occupies the space near the end of the capillary (6, 24). The concentration of TEMED can be as high as 7.5% (9), though 0.5-2% is most common. It is important to verify with markers that you are getting the expected pJ range. B. PARTIAL-CAPILLARY INJECTION The following protocol is designed for the Beckman P/ACE CE system (25) and must be adapted for other instruments as described subsequently
    • 5.9 Focusing 225 1. Fill the capillary (eCAP neutral), 27 cm (20 cm to detector) x 50 |iL with catholyte (20 mM sodium hydroxide in 0.4% methylcellulose) for 0.4 min at 20 psi. 2. Load the sample-ampholyte blend for 0.4 min at 20 psi. The length of the ampholyte section in the capillary is about 16 cm, or 80% of the cap- illary length to detector. It is simple to accurately calibrate the length of time it takes to fill the capil- lary with the sample-ampholyte blend. By following the following procedure, the method can be adapted to any instrument: 1. Set the detector to 200 nm. 2. Set the operating temperature of the system (usually 20-25°C). 3. Flush the capillary with water, anolyte or catholyte depending on protocol. 4. Inject sample-ampholyte blend, and note the time the detector signal increases. Decrease the measured time by 10-20%, and use that for the load time. C. PLUG INJECTION Another approach permits injection of proteins dissolved in water. This proce- dure is utilized for the no longer manufactured ABl 270A (2), but it can be adapted to any instrument. The pressures and timing are set for a 72 cm (50 cm to detector) x 50 jiim i.d. capillary. 1. Fill the capillary with catholyte (20 mM sodium hydroxide in 0.4% methylcellulose) for 8 min with 20" vacuum. 2. Load the ampholyte solution for 4.5 min with 20" vacuum. 3. Inject a sample and marker separately, each for 30 s with 5" vacuum. 4. Inject a plug of ampholyte solution for 6 s at 20" vacuum to insulate the sample. At this point, the leading edge of the ampholyte blend is near but not past the detector. The advantage of this method is the ability to inject aqueous samples, thereby sparing material that would otherwise have to be dissolved in ampholytes. The sensitivity of the method is reduced compared with the other injection techniques, since very little protein (20 nL) is injected into the capillary. Using whole-capillary injection with a 20 cm x 50 |im i.d. capillary, the injection size is 400 nL. 5.9 FOCUSING The next step in CIEF is focusing (see Figure 5.1). When the voltage is first acti- vated, the current is relatively high, since both ampholytes and solutes are
    • 2 2 6 Chapter 5 Capillary Isoelectric Focusing highly mobile at the start of the run. As the focusing proceeds, the pH gradient forms, along with solute migration to the appropriate position along the gradi- ent. When the ampholytes and solutes approach their respective pi values, their mobilities begin to slow, and as a result, the current declines. Focusing takes only a 2-5 min at 400-600 V/cm. Monitoring the current is a useful indicator for optimizing the focusing time. Typically, the current will decline to and level off at a few microamperes. Overfocusing results in protein precipitation, as shown by spikes on the electropherogram (24, 26). Underfo- cusing can result in split peaks for a single protein (19). Overfocusing can also cause damage to the capillary as a result of the for- mation of water zones. These zones tend to occur near the cathode and are more prevalent when acidic gradients are run. Repeated capillary fractures were observed when a field strength of 1200 V/cm was employed for 5 min. Reduc- ing the field strength to 600 V/cm resolved the problem without substantial changes in speed and resolution. Most runs are performed in the positive-polarity mode, where the more basic proteins elute first. To switch the order of elution, operate in the negative-polar- ity mode. The catholyte is placed on the inlet side and the anolyte on the out- let side of the capillary This is opposite to what is conventionally done. Under these conditions, the more acidic proteins elute first. This mode of operation is particularly important when one-step and chemical mobilization are used, since the acidic side of the capillary is not effectively mobilized. 5.10 MOBILIZATION With focusing complete, it is necessary to mobilize or elute the contents of the capillary past the detector to record the electropherogram. There are three ways to accomplish this: 1. Electrophoretic (salt) mobilization 2. Hydrodynamic mobilization 3. Electroosmotic (one-step) mobilization Methods 1 and 2 isolate focusing and mobilization into separate and discrete processes. For method 1, it is necessary to turn off the voltage when switching buffer reservoirs. In method 3, focusing and mobilization occur simultaneously. A. ELECTROPHORETIC (SALT) MOBILIZATION This form of mobilization uses salts (3) or zwitterions (27) as additives to a buffer reservoir to effect pH changes in the capillary when the voltage is applied. The direction of mobilization can be anodic or cathodic, as indicated in Figures 5.9 and 5.10, depending on which reservoir the salt is added to. Cathodic mobi-
    • 5.10 Mobilization 227 DETECTOR WINDOW CATHODE ANODE I PROTESNS AND AMPHOLYTES • NaOH OH" NaCI FIGURE 5.9 Anodic mobilization. lization is usually selected, unless very acidic proteins at the far end of the cap- illary need to be seen. As mobilization proceeds, the current always increases. Electrophoretic mobilization occurs by adding salt to one of the buffer reser- voirs (27). Since electroneutrality is required, this condition is satisfied by (5) C„. + IC.NH3+ C^u- + ZrfC^ (5.2) where CH% CQH-, CNH3% ^^^ ^coo' ^^e the concentrations in equivalents per liter of all charged species in the ampholyte-solute blend. If a salt (anion) is added to the catholyte, the expression becomes Cj^+ + 2Cj^„^ = Q H - + ^^-COO" + C^ (5.3) where C^^- represents an anion (m is the charge on that anion). The added salt, now the anion, competes with OH" for electromigration into the capillary. Since fewer hydroxyls enter the capillary, the pH declines. Proteins previously at their pi values become cationic and begin to migrate toward the cathode. For anodic mobilization, an expression equivalent to Eq. (5.3) is C^n^ + C^+ H- 2Cj^^^+ - CQ^- -H Z C ,"COO" (5.4) where Cx»* represents the cation added to the anolyte. The added anion is of no consequence, since it never migrates into the capillary. The same holds true for CATHODE / DETECTOR WINDOW ANODE ^^sSlEiSi^ I PROTEINS AND AMPHOLYTES i | NaOH NaC! OH - * cr—I •H^ H3PO4 FIGURE 5.10 Cathodic mobilization
    • 228 Chapter 5 Capillary Isoelectric Focusing the cation when using cathodic mobihzation. Increasing the concentration of salt speeds the mobihzation process at the expense of thermal deformation due to Joule heating. Examples of cathodic and anodic mobilization for human hemoglobin and transferrin are shown in Figure 5.11 (3). This early work employed 3-mm-i.d. capillaries that were rotated at 40 rpm to reduce convection. While the applied field strength is low and speed of separation relatively slow by today's standards, the fundamental aspects of CIEF are well illustrated. As expected, the electro- pherograms are approximate mirror images of each other. Better resolution is always seen during the early portions of the electropherograms. The relationship of the change in pH versus the distance from the end of a slab gel is shown in Figure 5.12 (27) for anodic mobilization. The pH changes are sub- stantial along the first 4 cm of the gel and then converge to no measurable differ- ences. This means the relationship between the migration time and pJ is not Unear. The loss of linearity is a consequence of mobilization, not of focusing. The failure to effectively mobilize solutes at the far end of the capillary is addressed in part with a zwitterionic mobilization reagent. When cathodic mobilization is employed, the problem occurs with acidic (low-pl) proteins. Adding to the catholyte a zwitterion (instead of salt) with a pi lower than the most acidic protein is effective in mobilizing the far end of the capillary (24). During mobilization, the low-p7 zwitterion migrates near the anode until it becomes neutral. Ampholytes and solutes with greater pi values all acquire a positive charge and mobilize toward the cathode. Zwitterionic mobilizers can eliminate unwanted peaks from the extremes of electropherograms. For example, performing cathodic mobilization with pi 6.9 Hb Tr (min.) 10 FIGURE 5.11 Chemical (salt) mobilization of human hemoglobin and transferrin by capillary CIEE Capillary: agarose-plugged, methylcellulose-coated 38 cm x 3 mm i.d. rotated at 40 rpm; ampholytes: 1% solution of Pharmalyte (pH 3-10); anolyte: phosphoric acid, 20 mM; catholyte: sodium hydroxide, 20 mM; focusing: 1200 V for 20 min; mobilization: (a) anolyte: 20 mM sodium hydroxide; catholyte: 20 mM sodium hydroxide; (b) anolyte I: 20 mM phosphoric acid; catholyte: II: 20 mM phosphoric acid; mobilization voltage: 3000 V; detection: Uy 280 nm. Reprinted with per- mission from J, Chromatogr., 346, 265 (1985), copyright © 1985, Elsevier Science Publishers.
    • 5.10 Mobilization 229 10 PH 2 4 8 DISTANCE (cm) FIGURE 5.12 The pH gradient at different mobilization times on a 2-mm slab gel (3%C, 6%T) cast in a 2.5% solution of Bio-Lyte (pH 3-10) on a water-cooled microscope slide. The pH mea- surements were made with a surface electrode. Focusing: with 20 mM sodium hydroxide as catholyte and 20 mM phosphoric acid as anolyte; mobilization: anodic with 20 mM phosphoric acid with 80 mM sodium chloride as the anolyte. Reprinted with permission from J. Chromatogr., 387, 127 (1987), copyright © 1987, Elsevier Science Publishers. zwitterion eliminates all bands with pi values below 6.9 (24). For anodic mobi- lization, all bands with pi values above that of the zwitterion will not be detected. B. HYDRODYNAMIC MOBILIZATION The problem of mobilization of proteins at the far end of the capillary is addressed by hydrodynamic mobilization (3). After focusing, the capillary con- tents are eluted using an HPLC pump. Hydrodynamic band broadening is reduced by applying the focusing voltage during elution. Chen and Wiktorowicz (2) and later Huang et al. (25) adapted this approach with modern instrumentation. Instead of pumping out the capillary contents, high-precision vacuum or pressure is used. The focusing voltage is applied dur- ing the mobilization step and need not be turned off as the pressure or vacuum is applied. A linear relationship between mobility and pi occurs over the full pH range. The technique works best when low pressure (0.5 psi, 50 mbs) or vac- uum (5" Hg) is used. C. ELECTROOSMOTIC MOBILIZATION In this technique, EOF mobilization occurs together with the focusing step (6, 26, 28-30). The EOF is reduced by adding 0.1% methylcellulose to the ampholyte blend. This is sufficient to ensure that focusing occurs before any solute migrates past the detection window. The advantage here is that buffers
    • 2 3 0 Chapter 5 Capillary Isoelectric Focusing do not need changing nor does the voltage have to be turned off and on. While bare silica capillaries have been employed here, it is better to use a coated cap- illary to produce a more linear pH gradient. The electropherograms shown in Figures 5.6-5.8 were generated using this technique. D. COMPARISON OF THE MOBILIZATION TECHNIQUES Figure 5.13 compares the three mobilization techniques for a series of standard proteins (20). The highest resolution is found for chemical mobilization at the expense of run time. The opposite is true for single-step CIEF Hydrodynamic mobilization represents the middle ground between the two other techniques and is simple to implement. Both chemical and hydrodynamic mobilization pro- duce linear pH gradients versus time. This is not the case for single-step CIEF The reproducibility of all three techniques is good, particularly when internal standards are used to compensate for capillary coating degradation and the vari- able salt content of the sample (20). E. BUFFER DEPLETION Since buffers are not generally added to the anolyte and catholyte, pH changes can occur during the course of repeated runs. This problem is solved by fre- quently changing these solutions. The use of a zwitterionic catholyte such as taurine, pH 8.8, also reduces this problem since the reagent has buffering capac- ity, but this Umits the operating range of the system to proteins with pJ values below 8.5 (31). 5.11 SALT EFFECTS In Figure 5.4, the formation of a pH gradient in the absence of salt is illustrated. The impact of added salt is now shown in Figure 5.14. The presence of salt ions is significant, since these ions are quite mobile and thus carry much of the cur- rent in the capillary. In this regard, they are competitive with the carrier ampholytes and delay the onset gradient formation. As Figure 5.14 (bottom) illustrates, a compression of the gradient occurs. Basic proteins exhibit longer migration times, whereas acidic proteins show shorter times. While desalting of samples is often necessary, the use of a voltage ramp per- mits the high-mobility salt ions to exit the capillary prior to the formation of the pH gradient (32, 33). A voltage gradient of 5-10 kV applied over 6 min, followed by focusing at 15-20 kV over 5-10 min, is effective to desalt protein samples
    • 0,10 0,05 Y 0,00 iO 05 LuLl 120 its WJHJL 10 # 00 10 20 30 nmt imn] 3 40 i 55 ^kK^ IS 10 < 3 0 0,04 p 1 I 0,02 i I o < 0,00 10 20 Time I'lmn] 30 1 HAJ 15 J - a — — j f c — — J — 2 4 6 Time [mini 8 10 FIGURE 5.13 Comparison of mobilization techniques. Chemical mobilization (top)—capillary: jLlSIL DB-1, 27 cm (20 cm to detector); 4% Pharmalyte 3-10, 1% Temed, 0.8% MC; anolyte: 20 mM phosphoric acid; catholyte: 20 mM sodium hydroxide (focusing) + 30 mM sodium chloride (mobi- lization); focusing: 5 min at 20 kV; cathodic mobililization at 20 kV. Hydrodynamic mohilization (middle)—capillary: [iSlL DB-I, 27 cm (20 cm to detector); ampholytes: 4% Pharmalyte 3-10, 1% Temed, 0.8% MC; anolyte: 10 mM phosphoric acid, 0.4% MC; catholyte: 20 mM sodium hydrox- ide; focusing: 10 min at 10 kV; mobilization: 0.5 psi at 10 kV One-step CIEF (bottom)—capillary: eCAP neutral 37 cm (30 cm to detector); ampholytes: 4% Pharmalyte 3-10, 1.5% Temed, 0.4% HPMC; anolyte, 10 mM phosphoric acid; catholyte 20 mM sodium hydroxide; voltage: -10 kV Key: (1) cytochrome c; (2) ribonuclease; (3) myoglobin; (4) carbonic anhydrase; (5) /^-lactoglobulin. The dotted line is the current. Reprinted with permission from Electrophoresis, 16, 2121 (1995), copyright © 1995 Wiley-VCH.
    • 232 CATHODE Chapter 5 Capillary Isoelectric Focusing ANODE Ml HIGFTPH ^ ^ ^ A G E pH IS 7 LOviT^ CATHODE ANODE lOH--^! Na* 10 9 8 7 6 5 4 3 Cl- 4- HIGH pH LOW pH FIGURE 5.14 Salt in the sample causes gradient compression. containing 200 mM sodium chloride. The vohage should be increased at such a rate to prevent the current from exceeding 15 |LlA, or resolution degrades. As Fig- ure 5.15 shows, the resolution appears to improve despite the presence of 200 mM salt (32). 5.12 DETECTION A. UV DETECTION Carrier ampholytes absorb UV light below 250 nm. For most modes of HPCE, the UV background is not a big problem, since the optical path length is short and the buffer is homogeneous. While a high-UV reagent background increases the noise of the system, the baseline can be zeroed. In CIEF, the electrolyte composition is continually changing during focus- ing and subsequent mobilization. Monitoring the electropherogram at 200 nm produces a substantial background, masking all but the most concentrated pro- teins in the sample (26). This problem precludes the use of 200 nm for detection, the most sensitive wavelength for proteins. Sufficient selectivity toward proteins is obtained at 280 nm. The loss of sensitivity at this wavelength compared with that at 200 nm depends on the aromatic amino acid composition of the protein. Proteins with few aromatic residues yield poor sensitivity. Limits of detection usually fall into the low micrograms per milliliter range. This is often limited by the reagent background signal from the carrier ampholytes themselves.
    • 5.12 Detection 233 a ipi^pi^ -M-xA/*—-H^ 0.00 2,00 4M 6.00 BM 10 00 12.00 14.(K3 16.00 T{fiit(Mfn) 55 45 35 4 125 4 15 Ly$0zym$ .6 CytochromdO .^A^^'-A/***''^*-**^ MyogloiMn tiypslo fnhiNlor ^fiydratd w L / V W v J u x ^ 0,00 2.00 4,00 6.00 BM WM 12.00 14.00 16,00 UM FIGURE 5.15 Online desalting using a voltage gradient, (a) Absence of salt; (b) sample in 200 mM sodium chloride. Capillary: 37 cm (30 cm to detector) x 50 |Xm i.d., PVA-coated (homemade); ampholytes: 2% 3-10; anolyte: 50:49:1 (methanol:water:acetic acid); catholyte: 50:49:1 (methanol:water:ammonium hydroxide); focusing: 20 kV for 10 min; mobilization anolyte: catholyte solution; detection: 280 nm. Reprinted with permission from Anal. Chem., 69, 2786 (1997), copyright © 1997 Am. Chem. Soc.
    • 234 Chapter 5 Capillary Isoelectric Focusing The use of the diode-array detector (DAD) in conjunction with coated cap- illaries may reduce the capillary lifetime. Since the DAD passes all wavelengths of light through the capillary, the coating may be damaged. An interference fil- ter that removes all but the 280-nm wavelength band should solve this problem. B. LASER-INDUCED FLUORESCENCE Laser-induced fluorescence (LIF) has been utilized in CIEF both for native flu- orescence of hemoglobins in single red blood cells (34) and for tetramethyl- rhodamine-derivatized anti-human growth hormone antibody (35). Limits of detection by LIF are in the sub-ng/mL range. C. MASS SPECTROMETRY The combination of CIEF and mass spectrometry is analogous to 2-D elec- trophoresis (36). In this case, the mass spectrometer provides the molecular weight information instead of SDS-PAGE. This information can be obtained by online CIEF-MS (37) or by using CIEF as a micropreparative technique (38, 39). For the online system, CIEF is performed conventionally in a 20-cm capil- lary mounted inside an electrospray probe. After focusing, the outlet reservoir (catholyte) is removed and the capillary tip set to 0.5 mm outside of the probe. A sheath liquid of 50% methanol, 49% water, and 1% acetic acid (pH 2.6) pumped with a syringe pump at 3 |xL/min produces a stable electrospray. Cathodic mobilization is produced by changing the inlet (anolyte) from 20 mM phosphoric acid to the sheath liquid. During mobilization, two power supplies are used, one for the capillary (10 kV) and another for the electrospray (5 kV). The ampholyte ions were observed up to m/z 800 and thus did not interfere with the protein signals. Increasing the ampholyte concentration caused a reduction in the protein ion counts, and this is protein dependent. Good results are found using 0.5% ampholytes. D. WHOLE-CAPILLARY IMAGING An instrument designed to image the entire capillary is available from Convergent Bioscience Ltd, Etobicoke, Ontario, Canada. The instrument employs UV detec- tion with imaging provided by a charge-coupled device. Since the entire capillary is continuously monitored, the mobilization step is no longer required (40-42). 5.13 APPLICATIONS Table 5.3 lists a variety of applications, buffer recipes, and operating conditions. The rest of this section will examine a few applications in more detail.
    • 5.13Applications235 o u o 2 ^ -^3 s o ex 1^O w o oinin m(Nxt- U PH I—I o d IC/5(/5Crt2>^- ^wcja;IN-^_, <^^ ^inin rA(5d _>>ini^S H2 1of^ QininON ^'^o<u Oxf'w.B ^'(J'^^ o ^ ^ ^o om n^-^c« >^ o m fi sin >^fi o^ .-Hin ^^ Oo^ ^B B< 2 ^^3^^^S < ^'^^^ inddd =L o in X Bu O as ^X (U 3 .2B •2-B <I< !-4 ^ ^3- in I-- X Bo O ON (75 o a 43 o < 00 U S ^o in X Bu o ^ >>u o 3 PS O >> c r2 43 O ^O PQ Q a3- O in X Bu O (N g ^ ^ O B E i2 .2 s3- in i^ Xp^ r-Hv!:/ 11 K
    • 236Chapter5CapillaryIsoelectricFocusing w u (/) 'o u O O o 3 l^ tn Xi B O w1-1 QJ C 3 oP3 z ^ B o in ^ ^ 'o S c o (N u :^ Cu X -P,^S ud-^ > o U .yo IBo I>^-r c o r3 ^ Cu < o g ^ OS a^K <N <U fo ;-i O w ^ ^ u ox Z 22 ^o ^^Q ^y2 f^^^ ^(N1^ r<id>d oPH D: S B ,—t ON <u ^ 'o < ;-i ^(-1-1 3 ,£5 4J c c« g ^u (U CQ _C o I—( I dJ^ CU5 O>-^ ^^ OPQo <.S(N o o^inin U ininin(N >S U >>>^ 5wss Sw^^ ^HPuPu .—I^^^ ,^ininin ^1^-H^' B 3- o in X B u O ,^^oin su W U g 3. o in X B u O ^ <i> C < u £ zi. o in X B (J o ^ <u C OH < U dL o o '"'X Bu in 00 ^ w cs O u (/5 (/5 C« B o in X B o '^M 5(U C u o^ -r:oa*^ o-5 P^C>0 ^- B^ X3^ W) 2M ^H oxJ o^ ^s P3 PS UQ
    • 5.13 Applications 237 A. HEMOGLOBINS Perhaps the most widespread apphcation of lEF in the slab gel is hemoglobin analysis. There are hundreds of variations of human hemoglobin that result from single-point amino acid mutations. Abnormal hemoglobin is found in 1 of 10,000 individuals with electrophoresis as the diagnostic test. CIEF is useful for performing a high-speed separation isolating some important variants such as hemoglobin S, the sickle cell variant that results from a 6 Glu —> Val replace- ment. Zhu et al. (24) resolve hemoglobins S, C, F, and A in 6 min using salt mobilization (Figure 5.16). The separation of hemoglobin A from F is remark- able, since the two proteins differ by only 0.05 pi units. The work of Zhu was improved on by Hempe et al. (22, 49) in several signif- icant ways. The combination of hydrodynamic mobilization and detection at 415 nm greatly simplified the experiments. Detection at 415 nm instead of 280 nm removes any potential interferences from carrier ampholytes or other endoge- nous proteins in blood serum. The use of a narrow-range pH 6-8 gradient improves resolution as well. Results were reported for a wide variety of hemo- globin mutations, a few of which are reproduced in Figure 5.17. A (7JO) <7.25>SF <X$0) C TIME (min) FIGURE 5.16 Separation of hemoglobin variants by CIEF in a 12 cm x 25 |Lim i.d. coated capil- lary using pH 3-10 ampholytes. Focusing and mobilization were carried out at 8 kV. Protein con- centration: 250 |lg/mL of each protein; detection: 280 nm; isoelectric points are: hemoglobin A, pi 7.1; F, pi 7.15; S, pi 7.25; and C, pi, 7.5. Reprinted with permission from J. Chromatogr., 559, 479 (1991), copyright © 1991 Elsevier Science Publishers.
    • 238 Chapter 5 Capillary Isoelectric Focusing 0.03 r 0.02 h ; 0.01 0.00 Hemoglobin C Trait f Age RBCxlO* Hgb,g/dL MCV.fL C/A, % I F H A/A,c% 1 c Urn 14.17 10.5 |73.2 F l 29.4 1 15.2 1 "•^ n 1 k h nj 1 ^ 1 ^ I ^ Kl—6 (-) 7 8 9 to Minutes 11 12 13 (+) 14 0.03 0.02 0.01 0.00 Nomm! Child i Age 9 y 1 RBCxlO* 4.71 1 Hgb.g/dL 13.5 ^ MCV.fL «8.2 i Aj H 2,7 A % 89.6 • A,c% 7.7 1 ^ A,c L6 (-) 7 8 9 10 11 Minutes 12 14 0.03 0.02 f 0.01 0.00 Hemoglobin S/C Disease Transfusion Dependent f Age *y RBCxIO* 5.83 Hgb, g/dL MCV.fL C/A, % S % I F % [ A/A,cH _ ^ 12.8 66.6 36J j 33.1 ; 2.3 ! 28.3 kLJ S A i 1 ui ^^ 6 (-) 9 10 Minutes 11 12 13 (+) 14 0.03 r 0.02 0.01 0.00 p Thalassemia r Age RBCxlO* Hgb.g/dL MCV.fL A, % A % A,c% lOy 5.93 11.0 59.0 5.2 86.6 8.2 ! L Erythrocytosis ; Anemia Microcytosii Elevated Hb AJ , _J 1 A t6 7 8 9 10 Minutes 11 12 13 14 0.03 on? U.01 0.00 HbC/p* Thalassemia r Age RBCxlO* Hgb,g^dL , MCV. fL C'Aj % 1 F % A % c J ( ^^j 5.50 Erythrocytosis 110.2 Anemia p^ 58.8 Microcytosii 67.2 11.6 j 21.2 LcwHbA F j 1 V" 1 /Uv> Hb S/p'' Thalassemia 5 6 7 8 9 10 11 12 13 14 Minutes (+) 0.03 0.02 U.U1 000 r Age l y RBCxlO* 5.12 Hgb, g/dL 9.Z j MCV. fL 59.9 Aj % 5.7 S % 65,4 F % iO.4 A % 18.5 I ilJ j S A Erythrocytosis F i i { VJU5 6 7 8 9 10 11 1 (.) Minules ,.4fle/n;o Microcyiosis Elevated Hb A} High Mb S High Mb F LowHbA k ,2 13 14 {^) FIGURE 5.17 Separation of hemoglobin variants by CIEF with detection at 415 nm. Capillary: JLISIL DB-1 coated 27 cm (20 cm to detector) x 50 im i.d.; ampholytes: Pharmalyte 2% of 6-8:3-10 (10:1) in 0.375% MC; anolyte: 100 mM phosphoric acid in 0.375% MC; catholyte: 20 mM sodium hydroxide; injection: 10-30 s ov^ pressure (<50 nL); focusing: 5 min at 30 kV; mobilization: lov^ pressure with 30 kV voltage. Courtesy ofJames Hempe, LSU School of Medicine.
    • 5.13 Applications 239 B. RiBONUCLEASES Chen and Wiktorowicz (2) separated, in part, RNase T^ (pj 2.9), RNase ab (pi 9.0), and site-directed mutants (pJ 3.1, 3.1, 3.3) of RNase T^ using the hydro- dynamic mobihzation method. The two mutants of pi 3.1 were not separable. If there are any differences between these two, a narrow-range acidic gradient may be required for separation. The separation, shown in Figure 5.18, includes the marker proteins RNase A (pi 9.5), carbonic anhydrase (pi 5.9), j8-lactoglobulin (pi 5.1), and CCK-Flank- ing protein (pi 2.75). The authors reported the DB-1 capillary was stable for at least 420 runs over a two-month period. The combination of the DB-1 capillary and the methylcellulose additive may account in part for this stability. If the coat- ing is harmed by base, the methylcellulose polymer may serve to recoat the dam- aged section. When using marker proteins for internal standardization, the pi measure- ment precision ranged from 0.5% to 3.3% RSD. A peak area calibration curve was linear versus injection time (volume) from 10 to 80 s (50 to 400 nL). Mobilixation Time iwcdn) FIGURE 5.18 Capillary CIEF of RNase ab, RNase T^, and RNase T^ site-directed mutants. Capil- lary: DB-1 coated 72 cm (50 cm to detector) X 50 |im i.d.; ampholytes: Servalyte 3-10, 0.5% with 0.4% methylcellulose; injection: 30 s vacuum (200 nL); focusing: 6 min at 30 kV; mobilization: vac- uum (5" Hg) with 30 kV voltage; detection: UV, 280 nm; solutes: 200 |ag/mL each (4 ng injected). Reprinted with permission from Anal Biochem., 206, 84 (1992), copyright © 1992 Academic Press.
    • 240 Chapter 5 Capillary Isoelectric Focusing C. RT-PA METHOD VALIDATION Moorhouse et al. (46), from Genentech, investigated the validation of a CIEF method for rt-PA. Separations have aheady been shown in Figures 5.6-5.8, and so no others will be given here. The analytical conditions employed are described in the caption of Figure 5.6. This method separates the glycoforms of rt-PA based on their sialic acid con- tent. Nine to 10 peaks are consistently resolved, with the profile dependent on the class of ampholyte used. The pJ of the glycoforms ranged from 6.5 to 7.5. Method validation involves a series of controlled experiments designed to measure a particular attribute of the method, such as accuracy, specificity, pre- cision, and ruggedness (see Section 10.7). Only those methods meeting accept- able criteria are deemed suitable to submit to regulatory authorities and to use in quality control to assess purity, potency, and identity. The pH gradient was characterized with synthetic markers that bracketed the pH range of rt-PA. Since one-step mobilization was used, the pH gradient was not linear with time, particularly for the acidic portion of the gradient. The migration times of the synthetic markers were affected by the presence of rt-PA, which means that calculated pi depends on the nuances of the particular sys- tem. Ideal markers would not be affected by the protein. Peak area linearity was examined from 25 to 1000 |ig/mL and found to be acceptable, with a correlation coefficient of 0.997. The limit of detection was 50 |ig/mL, which corresponds to 25 ng of protein. The limit of detection using Coomassie brilliant blue stain was 2 |Lig via the slab gel. Recovery was assessed by fraction collection, with the collected fractions measured by an ELISA method. A 110% recovery was found, which indicates no material was retained on the capillary. Run-to-run migration time precision ranged from 2.3% to 3.1%. Peak area precision ranged from 0.6% to 10.4%, with only the first two peaks giving RSDs of greater than 3%. Day-to-day peak migration time precision was 6-8%, and peak area precision ranged from 1% to 14%, with peak 1 being poor once more. Migration times decreased with each passing day, which was a func- tion of the deterioration of the coating. Since the EOF provides for mobiliza- tion, the use of hydrodynamic mobilization might remedy this problem. It is also possible that the DB-1 coating might prove superior. Ruggedness was assessed by examining five different lots of capillaries and three capillaries from the same lot. Two lots of capillaries showed prolonged run times. This is a consequence once again of one-step mobilization, since it depends on the EOF Increasing the voltage from 400 to 600 V/cm gave shorter migration times but essentially the same pattern. Varying the temperature from 15°C to 30°C also affected the migration times but not the patterns. Increasing the TEMED concentration from 0.38% to 1.5% lengthened the run but did not alter the pattern. Pharmalytes and ampholines gave different patterns by CIEF but also did the same on the slab gel.
    • References 241 Since the only troublesome criteria was the day-to-day precision, the authors of this work are considering using hydrodynamic mobiUzation (with complete EOF suppression) so as not to be hampered by changes in the EOF of the sys- tem. Recently, a validated method for identification of a monoclonal antibody has been implemented at Genentech (50). REFERENCES 1. Righetti, R G., Isoelectric Focusing: Theory, Methodology and Applications. Laboratory Techniques in Biochemistry and Molecular Biology, Ed. T. S. Work and R. H. Burdon. 1983, Elsevier Bio- medical Press. 386. 2. Chen, S. M., Wiktorowicz, J. E. Isoelectric Focusing by Free Solution Capillary Electrophore- sis. Anal. Biochem., 1992; 206:84. 3.Hjerten, S., Zhu, M.-D. Adaptation of the Equipment for High-Performance Electrophoresis to Isoelectric Focusing. J. Chromatogr, 1985; 346:265. 4. Liu, X., Sosic, Z., Krull, I. S. Capillary Isoelectric Focusing as a Tool in the Examination of Anti- bodies, Peptides and Proteins of Pharmaceutical Interest. J. Chromatogr, A, 1996; 735:165. 5.Hjerten, S. Isoelectric Focusing in Capillaries, in Capillary Electrophoresis Theory and Practice, Eds. P. D. Grossman and J. C. Colburn. 1992, Academic Press. 191. 6.Mazzeo, J. R., Krull, 1. S. Capillary Isoelectric Focusing of Proteins in Uncoated Fused-Silica Capillaries Using Polymeric Additives. Anal. Chem., 1991; 63:2852. T.Hjerten, S., Elenbring, K., Kilar, E, Liao, J. L., Chen, A.J. C, Siebert, C. J., Zhu, M. D. Carrier- Free Zone Electrophoresis, Displacement Electrophoresis and Isoelectric Focusing in a High- Performance Electrophoresis Apparatus. J. Chromatogr, 1987; 403:47. 8.Bolger, C. A., Zhu, M., Rodriguez, R., Wehr, T. Performance of Uncoated and Coated Capillar- ies in Free Zone Electrophoresis and Isoelectric Focusing of Proteins. J. Liq. Chromatogr, 1991; 14:895. 9.Moorhouse, K. G., Eusebio, C. A., Hunt, G., Chen, A. B. Rapid One-Step Capillary Isoelectric Focusing Method to Monitor Charged Glycoforms of Recombinant Human Tissue-Type Plas- minogen Activator. J. Chromatogr, A, 1995; 717:61. lO.Caslavska, J., Molteni, S., Chmelik, J., Slais, K., Matulik, E, Thormann, W. Behaviour of Sub- stituted Aminomethylphenol Dyes in Capillary Isoelectric Focusing with Electroosmotic Zone Displacement. J. Chromatogr, A, 1994; 680:549. 11. Kilar, E, Vegvari, A., Mod, A. New Set-up for Capillary Isoelectric Focusing in Uncoated Capil- laries. J. Chromatogr, A, 1998; 813:349. 12.Hempe, J. M., Granger, J. N., Warrier, R. P, Ode, D. L., Craver, R. D. Capillary Isoelectric Focus- ing oj Hemoglobin Variants in the Pediatric Clinical Laboratory, in liVCE98. 1998. 13. Chen, A. B., Rickel, C. A., Flanigan, A. H. G., Moorhouse, K. G. Comparison of Ampholytes Used for Slab Gel and Capillary Isoelectric Focusing of Recombinant Tissue-Type Plasminogen Activator Glycoforms. J. Chromatogr, A, 1996; 744:279. 14. Pritchett, T. Personal communication. 1998. 15.Righetti, P G., Bossi, A., Gelfi, C. Capillary Isoelectric Focusing and Isoelectric Buffers: An Evolving Scenario. J. Capillary Electrophor, 1997; 4:47. 16. Conti, M., Gelfi, C, Bosisio, A. B. Quantitation of Glycated Hemoglobins in Human Adult Blood by Capillary Isoelectric Focusing. Electrophoresis, 1996; 17:1590. 17. Yowell, G. G., Fazio, S. D., Vivilecchia, R. V Analysis of a Recombinant Granulocyte Macrophage Colony Stimulating Hormone by Capillary Electrophoresis, Capillary Isoelectric Focusing and High-Performance Liquid Chromatography. J. Chromatogr, 1993; 652:215. 18. Rabilloud, T. Solubilization of Proteins for Electrophoretic Analysis. Electrophoresis, 1996; 17:813.
    • 242 Chapter 5 Capillary Isoelectric Focusing 19.Rodriguez-Diaz, R., Wehr, T., Zhu, N. Capillary Isoelectric Focusing. Electrophoresis, 1997; 18:2134. 20.Schwer, C. Capillary Isoelectric Focusing: A Routine Method for Protein Analysis. Elec- trophoresis, 1995; 16:2121. 21. Conti, M., Galassi, M., Bossi, A., Righetti, R G. Capillary Isoelectric Focusing: The Problem of Protein SolubiUty J. Chromatogr, A, 1997; 757:237. 22.Hempe, J. M., Granger, J. N., Warrier, R. R, Graver, R. D. Analysis of Hemoglobin Variants by Capillary Isoelectric Focusing. J. Capillary Electrophor, 1997; 4:131. 23.Reif, O. W, Freitag, R. Control of the Cultivation Process of Antithrombin III and Its Charac- terization by Capillary Electrophoresis. J. Chromatogr, A, 1994; 680:383. 24. Zhu, M., Rodriguez, R., Wehr, T. Optimizing Separation Parameters in Capillary Isoelectric Focusing. J. Chromatogr, 1991; 559:479. 25. Huang, T.-L., Shieh, P C. H., Cooke, N. Isoelectric Focusing of Proteins in Capillary Elec- trophoresis with Pressure-Driven Mobilization. Chromatographia, 1994; 39:543. 26.Thormann, W, Caslavska, J., Molteni, S., Chmelik, J. Capillary Isoelectric Focusing with Elec- troosmotic Zone Displacement and On-Column Multichannel Detection. J. Chromatogr, 1992; 589:321. 27.Hjerten, S., Liao, J.-L., Yao, K. Theoretical and Experimental Study of High-Performance Elec- trophoretic Mobilization of Isoelectrically Focused Protein Zones. J. Chromatogr, 1987; 387:127. 28.Mazzeo, J. R., Krull, I. S. Examination of Variables Affecting the Performance of Isoelectric Focusing in Uncoated Capillaries. J. Microcol. Sep., 1992; 4:29. 29.Mazzeo, J. R., Krull, I. S. Improvements in the Method Developed for Performing Isoelectric Focusing in Uncoated Capillaries. J. Chromatogr, 1992; 606:291. 30.Mazzeo, J. R., Martineau, J. A., Krull, I. S. Performance of Isoelectric Focusing in Uncoated and Commercially Available Coated Capillaries. Methods, 1992; 4:205. 31.Rodriguez-Diez, R., Zhu, M., Wehr, T. Strategies to Improve Performance of Capillary Isoelec- tric Focusing. J. Chromatogr, A, 1997; 772:145. 32. Clarke, N. J., TomUnson, A. J., Schomburg, G., Naylor, S. Capillary Isoelectric Focusing of Phys- iologically Derived Proteins with Online Desalting of Isotonic Salt Concentrations. Anal. Chem., 1997; 69:2786. 33. Clarke, N. J., Tomlinson, A. J., Naylor, S. Online Desalting of Physiologically Derived Fluids in Conjunction with Capillary Isoelectric Focusing-Mass Spectrometry J. Am. Soc. Mass Spectrom., 1997; 8:743. 34.Lillard, S. J., Yeung, E. S. Analysis of Single Erythrocytes by Injection-Based Capillary Isoelec- tric Focusing with Laser-Induced Native Fluorescence Detection. J. Chromatogr, B: Biomed. Appl, 1996; 687:363. 35. Shimura, K., Kasai, K.-i. Fluorescence-Labeled Peptides as Isoelectric Point (pi) Markers in Cap- illary Isoelectric Focusing with Fluorescence Detection. Electrophoresis, 1995; 16:1479. 36. Tang, Q., Harrata, A. K., Lee, C. S. Two-Dimensional Analysis of Recombinant E. Coh Proteins Using Capillary Isoelectric Focusing Electrospray Ionization Mass Spectrometry. Anal Chem., 1997; 69:3177. 37. Tang, Q., Kamel Harrata, A., Lee, C. S. Capillary Isoelectric Focusing-Electrospray Mass Spec- trometry for Protein Analysis. Anal. Chem., 1995; 67:3515. 38. Grimm, R. Micropreparative Capillary Isoelectric Focusing of Protein and Peptide Samples Fol- lowed by Protein Sequencing. J. Capillary Electrophor, 1995; 2:111. 39.Foret, F, Muller, O., Thorne, J., Gotzinger, W, Karger, B. L. Analysis of Protein Fractions by Micropreparative Capillary Isoelectric Focusing and Matrix-Assisted Laser Desorption Time-of- Flight Mass Spectrometry. J. Chromatogr, A, 1995; 716:157. 40. Wu, J., Pawliszyn, J. Application of Capillary Isoelectric Focusing with Adsorption Imaging Detection to the Quantitative Determination of Human Hemoglobin Variants. Electrophoresis, 1995; 16:670.
    • References 243 41. Wu, J., Pawliszyn, J. Protein Analysis by Isoelectric Focusing in a Capillary with an Absorption Imaging Detector. J. Chromatogr., B: Biomed. Appl, 1995; 669:39. 42. Palm, A., Lindh, C, Hjerten, S., Pawliszyn, J. Capillary Zone Electrophoresis in Agarose Gels Using Absorption Imaging Detection. Electrophoresis, 1996; 17:766. 43.Schnabel, U., Fischer, C.-H., Kenndler, E. Characterization of Colloidal Gold Nanoparticles According to Size by Capillary Electrophoresis. J. Microcolumn Sep., 1997; 9:529. 44.Kundu, S., Fenters, C. Isoelectric Focusing of Monoclonal Antibodies by Capillary Elec- trophoresis. J. Capillary Electrophor, 1995; 2:273. 45.Thorne, J. M., Goetzinger, W. K., Chen, A. B., Moorhouse, K. G., Karger, B. L. Examination of Capillary Zone Electrophoresis, Capillary Isoelectric Focusing and Sodium Dodecyl Sulfate Cap- illary Electrophoresis for the Analysis of Recombinant Tissue Plasminogen Activator. J. Chro- matogr, A, 1996; 744:155. 46. Moorhouse, K. G., Rickel, C. A., Chen, A. B. Electrophoretic Separation of Recombinant Tissue- Type Plasminogen Activator Glycoforms: Validation Issues for Capillary Isoelectric Focusing Methods. Electrophoresis, 1996; 17:423. 47.Kilar, F, Hjerten, S. Separation of the Human Transferrin Isoforms by Carrier Free High-Per- formance Zone Electrophoresis and Isoelectric Focusing. J. Chromatogr, 1989; 480:351. 48. Schmitt, P, Poigner, T, Simon, R., Freitag, D., Kettrup, A., Garrison, A. W. Simultaneous Deter- mination of Ionization Constants and Isoelectric Points of 12 Hydroxy-s-Triazines by Capillary Zone Electrophoresis and Capillary Isoelectric Focusing. Anal. Chem., 1997; 69:2559. 49.Hempe, J. M., Granger, J. N., Craver, R. D. Capillary Isoelectric Focusing of Hemoglobin Vari- ants in the Pediatric Clinical Laboratory. Electrophoresis, 1997; 18:1785. 50. Hunt, G., Hotaling, T, Chen, A. B. Validation of a Capillary Isoelectric Focusing Method for the Recombinant Monoclonal Antibody C2B8. J. Chromatogr, A, 1998; 800:355.
    • CHAPTER 6 Size Separations in Capillary Gels and Polymer Networks 6.1 Introduction 6.2 Separation Mechanism 6.3 Materials for Size Separations 6.4 Size Separations with Nonreplaceable Polyacrylamide 6.5 Size Separations with Replaceable Agarose 6.6 Introduction to Polymer Networks 6.7 Operating Characteristics of Polymer Networks 6.8 Additional Materials for Polymer Networks 6.9 Detection 6.10 Operating Hints Using Polymer Networks 6.11 Applications and Methods Development 6.12 Reducing the Problem of Biased Reptation References 6.1 INTRODUCTION Slab-gel electrophoresis is the predominant technique for the separation of pep- tides, proteins, and polynucleotides. The slab-gel format provides mechanical stability for the separation, reduces solute dispersion from convection and dif- fusion, and permits handling for detection, scanning, storage, and so forth, as described in Section 1.1. Unlike lEF gels, w^hich exist solely for these functions, slab gels also provide the mechanism for separation. Gels are porous matrices comprising polymeric materials dissolved in a sol- vent, usually an aqueous buffer. The pore size of the gel is determined by the concentration of the polymeric reagent and the three-dimensional structure of the matrix. Chemical crosslinkers further influence structural rigidity and pore size of the gel w^hen incorporated during the polymerization process. The porous structure of the gel provides effective separations of macromolecules based on molecular size. 245
    • 246 Chapter 6 Size Separations in Capillary Gels and Polymer Networks True gels are composed of lyophilic (solvent-loving) colloidal particles, the best known of which is polyacrylamide. Lyophobic (solvent-hating) colloidal materials such as agarose are known as sols. Agarose solutions must be prepared in boiling aqueous buffer to dissolve sufficient material to form the gel matrix. The transition from the slab-gel to the capillary format began in 1983 (1) when Hjerten filled a 150-|im-i.d. tube with polyacrylamide. Later, the first reports of SDS-PAGE appeared (2, 3). Though many applications have been reported using rigid crosslinked gels, usually polyacrylamide, the separations were not robust owing to repeated gel failure. In slab-gel electrophoresis, a gel is poured and polymerized just before use.^ The gel must be sufficiently viscous to eliminate flow and permit handling. Tackiness of the material must also be avoided. The gel is generally designed to be used once in the slab-gel format. The field strength is kept relatively low to minimize problems with heat dissipation, even for ultrathin and cooled gels. In the capillary format, high-viscosity gels are prepared by crosslinking them in situ (4--6) or by pumping into the capillary under high pressure (7). The crosslinked gels must be stable enough to tolerate multiple runs, as the entire capillary must be replaced if the gel deteriorates. Unfortunately, the high applied field strength used in HPCE can cause abrupt and unpredictable failures. Gen- eration of air bubbles and/or cracking of the gel matrix results in the loss of elec- trical continuity and the termination of the separation. It became clear that a pumpable matrix is required for the capillary format. The advantage of these replaceable gels is that a fresh matrix can be employed for each run. This required the development of high-pressure pumping systems to blow the material into the capillary. For example, the PE Biosystems Prism 310 employs a high-pressure syringe to pump the viscous reagent at pressures as high as 1800 psi. All of the commercial capillary-array DNA sequencers now use replaceable polymer networks. It was recognized early on that noncrosslinked polymeric materials such as methylcellulose derivatives, polyethylene glycols, linear polyacrylamide, and dextrans can also define molecular pores. These systems are best described as polymer networks, entangled polymers, or physical gels. Despite the physical differences between rigid crosslinked gels and polymer networks, the mecha- nisms of separation appear to quite similar. 6.2 SEPARATION MECHANISM The size separation mechanism is illustrated in Figure 6.1 for a series of oligonucleotides (or oligosaccharides). Driven by the electric field, solutes iRehydratable gels are also commercially available, but these have no role in HPCE.
    • 6.2 Separation Mechanism 247 migrate toward the appropriate electrode through the gel (polymer) matrix. Small molecules pass through the pores unimpeded. Larger biopolymers may travel a tortuous path, moving through the pores in a snakelike fashion. Under properly controlled conditions, the solute's mobility is inversely pro- portional to its size. Several mechanisms for the migration of macromolecules through polymer networks have been described (8). As shown in Figure 6.2, the Ogsten model treats a molecule as a nondeformable sphere, with the migration velocity deter- mined by a solute's mobility modified by the probability of an encounter with a restricting pore. Solutes with a radius of gyration less than or equal to the aver- age pore size (such as SDS-proteins) behave in this manner. Large biopolymers do not necessarily follow the Ogston model. These mol- ecules can deform during transit through the porous network. The movement of a long strand of DNA wriggling reptilelike through the polymer matrix is known as reptation. It is also observed that fragment resolution decreases with the size of the molecules. Large molecules such as DNA and oligosac- charides align with the electric field in a size-dependent manner that is biased toward the larger strands. The dependence of mobility on the molecular size is obscured by this process, which is known as biased reptation. This effect limits the size of DNA molecules that can be separated using conventional slab-gel techniques. Beyond 20,000 base pairs (bp), separations become dif- ficult and pulsed-field electrophoretic techniques are usually employed (9, 10) This equipment is not presently available for commercial capillary elec- trophoresis instrumentation. A further level of complexity in the mechanism of separation is the interac- tion of the macromolecule with the polymers used to form the porous network. DIRECTION OF MIGRATION FIGURE 6.1 Pictorial description of the mechanism of size separation by HPCE.
    • 248 Chapter 6 Size Separations in Capillary Gels and Polymer Networks OGSTEN MODEL REPTATION FIGURE 6.2 Comparison of the size separation mechanism for proteins (Ogsten model) and for DNA or oligosaccharides (reptation). It has been shown that separations can occur at polymer concentrations far below what is required to define pores (11). Gels and polymer networks separate the analyte based on molecular size. To correlate mobility to molecular weight, the macromolecule must be denatured to ensure that all solutes have the same charge-to-mass ratio. DNA and RNA are usually denatured by heating in formamide at 90°C for a few minutes. This improves both the separation and sizing accuracy. For proteins, denaturation entails reduction of disulfide bonds and unfold- ing by heating with a solution composed of sodium dodecyl sulfate (SDS) and a reducing agent, /J-mercaptoethanol or dithiothreitol (DTT). After these processes, most proteins have roughly the same shape and charge density. SDS binds to and denatures proteins via electrostatic and hydrophobic interactions; about 1.4 g SDS is bound per gram of protein. Also, SDS is anionic, so that all proteins become negatively charged and migrate toward the anode. Under these conditions, a protein's mobility is proportional to its molecular weight, and the system can be calibrated with a sizing standard. SDS-PAGE is the standard method for determining size of proteins. When the molecular weight of a pro- tein is less than 10 kDa, the SDS-binding stoichiometry may change, resulting in errors when calculating molecular weight (12). 6.3 MATERIALS FOR SIZE SEPARATIONS A variety of reagents can be employed to develop a microporous network within the capillary. Classical reagents such as polyacrylamide and agarose have been adapted to the capillary format. Other low-viscosity solutions not suitable for slab gels, including linear polyacrylamide, polyethylene oxide, and methylcel- lulose, work well in capillaries. Both crosslinked and linear polymers can define
    • 6.4 Size Separations with Nonreplaceable Polyacrylamide 249 pores in solution (Figure 6.3), either through covalent bonding or polymeric entanglement. These materials are classified as chemical and physical gels or polymer networks, respectively The rigid, crosslinked chemical gels are now only rarely used in HPCE. When using low-viscosity materials, a coated capillary is frequently required to suppress the EOF. Otherwise, solutes may elute in a reverse order—that is, large molecules elute before small ones. Migration time imprecision and wall effects may also occur when using untreated capillaries. In other cases, the high viscosity of the polymer network suppresses the EOF, and a bare silica capillary can be used. This is usually the preferable choice. The materials used for size separations can be considered either nonre- placeable or replaceable. It is clearly advantageous to replace the material in the capillary with each run. There are still a few capillaries containing nonreplace- able media that are commercially available.^ 6.4 SIZE SEPARATIONS WITH NONREPLACEABLE POLYACRYLAMIDE First introduced in 1959 by Raymond and Weintraub with later work by Orenstein and Davis, polyacrylamide has become a standard material for slab- gel electrophoresis (13). For capillary electrophoresis, the gel absorbs in the low-UV portion of the spectrum, resulting in detection problems when applied to proteins. 2J&W Scientific, Folsom, CA. CHEMICAL GEL PHYSICAL GEL FIGURE 6.3 Illustration of the differences between chemical and physical gels. Pores in chem- ical gels are defined via covalent bonds. In physical gels, polymeric entanglement defines the porous network.
    • 250 Chapter 6 Size Separations in Capillary Gels and Polymer Networks The gel composition of this electrically neutral material is defined by %T, the total amount of acrylamide, and %C, the amount of crosslinker. Percent T is calculated by o/T, acrylamide (g) + bisacrylamide (g) lOOmL Percent C is o/oC = bisacrylamide(g) ^ ^^^ ^^^^ bisacrylamide(g) + acrylamide(g) Bisacrylamide is frequently the crosslinker, though there are many alternatives. The pore size of the gel is controlled by both %T and %C. Highly crosslinked gels are usually employed to increase the pore size. A 30%C gel has a pore size of 200-250 A (14). The preparation of a stable, bubble-free gel-filled capillary is a complex undertaking. Bubble production and gel shrinkage during polymerization are often confounding problems that do not occur in the open environment of the slab gel. The integrity of the polymerized gel often fails due to the high field strengths that are employed in HPCE. Gel failure can occur without warning, a significant problem during automated unattended runs. On the other hand, spectacular separations of oligonucleotides, such as that illustrated in Figure 6.4, have been reported. Table 6.1 lists some applications using rigid gels. How- ever, it is anticipated that few users will opt for these materials. 6.5 SIZE SEPARATIONS WITH REPLACEABLE AGAROSE Agarose is a complex group of polysaccharides extracted from the agarocytes of Rhodophyceae, a marine algae found predominately in the Pacific and Indian Oceans. Neutral, pyruvated, and sulfated fractions have been isolated, though all fractions contain some charged groups. The material is insoluble in cold water and slowly soluble in hot water. A 1% solution forms a stiff gel upon cooling. In 1961, Hjerten first employed agarose as a support for zone electrophoresis. Righetti (14) summarized the properties of this remarkable material. The polysaccharide is a double helix with a pore structure more rigid than a poly- acrylamide strand. Even in dilute concentrations, the agarose structure has high mechanical strength. Pores with diameters of 500-800 nm have been reported. It is not surprising that agarose is useful in separating large segments of DNA. Even more remarkable is the low viscosity of this material; it is pumpable, a sig-
    • 6.5 Size Separations with Replaceable Agarose 251 20 25 30 35 Ttfiie {mm) FIGURE 6.4 CGE of poly((iA)2o and poly(dA)4o_6o on a 9%T linear polyacrylamide gel. Capillary: 60 cm (45 cm to detector) X 75 im i.d.; field strength: 308 V/cm; current: 8.8 jiA; buffer: 100 mM Tris-borate, pH 8.3, 2 mM EDTA, 7 M urea; injection: electrokinetic, 10 kV for 0.5 s; detection: UV, 260 nm. Reprinted with permission from J. Chromatogr., 516, 33 (1990), copyright © 1990 Else- vier Science Publishers. nificant advantage in HPCE. Among the advantages of agarose are UV trans- parency and lower toxicity than that of polyacrylamide. Work still continues using agarose, though it is unlikely that the material will find widespread use due to the superior results found using polymer networks. In recent developments, low-melting, low-gelling agarose was used to separate DNA fragments in a pulsed-field system (23) and in a conventional system (24). A mixture of hydroxyethylcellulose and agarose has also been reported (25).
    • 252 Chapter 6 Size Separations in Capillary Gels and Polymer Networks Table 6.1 Applications with Polyacrylamide Crosslinked Gels in CGE Application Gel Composition Buffer 0.1 M Tris-borate, 2.5 mM EDTA, 7 M urea, pH 7.6 90 mM Tris, 90 mM boric acid, 2.5 mM EDTA, 1.3 mM Temed, pH8.3 0.1 M Tris, 0.25 M boric acid, 7 M urea, pH 7.6 50 mM Tris, 50 mM boric acid. 7 M urea 0.1 M Tris, 0.25 M borate. 2 mM EDTA, pH 8.48 89 mM Tris, 69 mM boric acid, 7 M urea, 2 mM EDTA, pH 8.6 0.1 M Tris, 0.1 M boric acid. 7 M urea, pH 8.8 0.1 M Tris, 0.25 M borate, 7 M urea, pH 7.5 90 mM Tris-phosphate, 0.1% SDS, 8 M urea, pH 8.61 Reference 15 16 17 18 19 20 21 22 2 DNA sequencing 3%T, 5%C DNA sequencing 4%T, 5%C Oligonucleotides 6%T, 5%C Oligonucleotides 7.5%T, 3.3%C Oligosaccharides 25.5%T, 3%C Oligothymidylic acids 2.5%T, 3.3%C Polyadenylates 5%T, 5%C Polydeoxycytidines 6%T, 3%C Proteins 10-12.5%T, 3.3%C 6.6 INTRODUCTION TO POLYMER NETWORKS Methylcellulose (MC) and its derivatives are the prototypical polymer networks. Following the first reports by Hjerten et a. (26) and Zhu et al. ill), much work with polymer networks has been accomplished using this material or its deriv- atives. Grossman and Soane (28) found that the pore size in these polymer net- works depends on the polymer concentration and the radius of the mesh-forming polymer chain. When the polymer concentration is low, the polymers are isolated from one another and exhibit no overlap (Figure 6.5). In this example, 0 is the polymer concentration, and 0* is the overlap or entanglement threshold. As the poly- mer concentration is increased, the chains begin to overlap. Finally, at yet higher polymer concentration, the entangled network is formed. The overlap threshold can be evaluated experimentally by monitoring the viscosity of the polymeric solution. A plot of viscosity versus <P* becomes non- linear at a concentration of 0.29% hydroxyethylcellulose (28), indicating the onset of polymer overlap. Pore sizes of 223-350 A are obtained with polymeric solutions of 0.4% hydroxyethylcellulose. These size pores are sufficient for sep-
    • 6.7 Operating Characteristics of Polymer Networks 253 Dilute Semi-Dilute Entangled 0<<l)* # - 0 * (D>a)* FIGURE 6.5 Schematic representation of the entanglement process in polymer solutions, where 0 is the polymer concentration and 0* is the entanglement threshold. Reprinted with permission from Electrophoresis, 18, 2243 (1997), copyright © 1997 Wiley VCH. arating DNA restriction fragments and polymerase chain reaction products (29), but they are too large for the separation of all but the largest proteins. For com- parison, the pore size of 8%T linear polyacrylamide is in the range of 100-200 A. The broad distribution of pore sizes may contribute to the wide range of size selectivity of the polymer network (30). It was calculated that polymer networks can provide narrow pores with short-chain polymers and larger pores with longer chain polymers, in both cases operating at a concentration near the overlap threshold (28). The polymer net- work systems in the aforementioned reference yield a resolution of 3 bp of DNA. With the advent of high-pressure pumping systems, unit base resolution is read- ily accomplished using a variety of high-viscosity networks. Table 6.2 presents a list of polymers employed in size separations. 6.7 OPERATING CHARACTERISTICS OF POLYMER NETWORKS A. POLYMER CONCENTRATION Optimizing the polymer concentration is a process of adjusting the molecular weight range and polymer concentration. Figure 6.6 shows the variation in migration time versus the number of base pairs for a 1-kbp DNA sizing ladder at methylcellulose concentrations of 0.2-0.6% (30). At the higher concentra- tions, high pressure should be used to reduce the load time. Separation between 1000 and 10,000 bp can be achieved with 0.2% MC. At 0.6% MC, resolution occurs below 100 bp. Refer to Section 5.6C for procedures to prepare low- solubility methylcellulose solutions.
    • 254 Chapter 6 Size Separations in Capillary Gels and Polymer Networks Table 6.2 Materials for Replaceable Polymer Networks Material Reference Dextran Galactomannan Glucomannan Hydroxyethylcellulose Hydroxymethylcellulose Hydroxypropylcellulose Hydroxypropylmethylcellulose Methylcellulose Linear polyacrylamide Polyethylene glycol Polyethylene oxide Polyvinyl alcohol Polyvinylpyrrolidone Pluronics (mixture of PEO, PPO) Pullulan 31 32 33 28,34 27 35 29 36 37 31,32 38 32 39 40,41 42 B. INJECTION When performing high-efficiency separations, the amount of sample injected is often the hmiting factor for resolution. The minimum amount of sample con- sistent with the required sensitivity should be injected. Electrokinetic injection (Section 8.3) using stacking buffers (Section 8.6) provides the best limits of detection and resolution. A comparison between electrokinetic injection and hydrodynamic injection is shown in Figure 6.7 (29). In the absence of the poly- mer network, all DNA or SDS-protein molecules should have the same mobil- ity, so that electrokinetic injection is nondiscriminatory. It is critical to desalt the sample when using electrokinetic injection (Section 8.3). The traditional means of salt removal—ethanol precipitation with recon- stitution in 50% formamide, 0.5 M EDTA—is not reproducible in terms of DNA recovery (43). Desalting is better accomplished using spin columns, at least for DNA sequencing. For many applications, simply diluting the sample is suffi- cient. Refer to Section 10.5 for more details. C. FIELD STRENGTH AND TEMPERATURE Optimization of the field strength can be performed via an Ohm's law plot (Sec- tion 2.7); however, as with polyacrylamide gels, beware of biased reptation
    • 6.7 Operating Characteristics of Polymer Networks 255 m CD 4»» =3 03 E H- c .9•*ri ai%m. C^ ^ 25- 20- 15- — ' — " — I 1 2 3 4 6 Log,o Number of Base Pairs FIGURE 6.6 Variation of the DNA fragment migration time with the log of the number of base pairs of a 1-kbp ladder using 0.2%, 0.4%, and 0.6% methylcellulose in 100 mM Tris-borate, 2 mM EDTA, pH 8, on a polyacrylamide-coated capillary. Capillary: 100 cm (80 cm to detector) x 75 |im i.d.; voltage: -30 kV; detection: UV, 260 nm. Reprinted with permission from J. Liq. Chromatogr., 15, 1063 (1992), copyright © 1992 Marcel Dekker. effects for DNA fragments larger than 15 kbp (44). Temperature can affect DNA structure and alter mobility. For this reason, temperatures of 45°C and above are often employed to ensure denaturation. Since DNA is negatively charged at pH 8, the voltage must be set to negative polarity. MacCrehan et al. (30) found optimal resolution of the 506/517 bp fragments in 0.4% methylcellulose at 250 V/cm. The optimal efficiency was at 350 V/cm; however, the mobility differen- tial (A/i) was superior at the lower field strength. As described by Eq. (2.17), A;U has more significance in controlling resolution. D. USE WITH COATED CAPILLARIES Suppression of the EOF is important when using polymer networks. While the cellulose additives do this to some extent, the EOF may still be sufficiently strong so that the solute's electrophoretic flow is overcome and larger fragments are detected first. The use of coated capillaries (Figure 6.8) reduces the EOF and provides for the normal order of migration, with smaller fragments followed by the larger ones (29, 30). The need to control the EOF in bare silica increased the complexity of the buffers and experimental conditions. In particular, the bare silica capillary requires careful washing with hydroxide followed by equilibration with buffer. Phenylmethyl-coated
    • 256 Chapter 6 Size Separations in Capillary Gels and Polymer Networks Electroidiietk It^te^n 1353 A 118 BP N*hB Miiiloii piates/ni 1078 872 194 234 72 118 271/281 310 LI 603 ^ys^^ttyy^iiStii^^y^iv^^^ S f t ^ K m ^ J M U W¥i»o.»y<^> B Pressure Iiljectioii «<^;<M*<Wl^n<(f%wi.%wy^»^V<V FIGURE 6.7 Separation of a Haelll restriction digest of 0X174 DNA. Capillary: 57 cm (50 cm length to detector) x 100 |im i.d. coated with 0.1-|im-thick OV-17; buffer: 89 mM Tris-borate, 2 mM EDTA (pH 8.5), and 0.5% HPMC-4000; voltage: 10 kV; temperature: 25 °C; detection: UV, 260 nm; sam- ple concentration: 25 |ig/mL. Key: (A) injection: electrokinetic, 5 s at 2 kV; (B) pressure injection: 60 s at 3.44 MPa. Reprinted with permission from J. Chromatogr., 559, 267 (1991), copyright 1991 Elsevier Science Publishers. capillaries require only flushing with distilled water and methanol. When using very high viscosity polymers, the coated capillary is often unnecessary E. PRECISION Migration time precision (29), expressed as % relative standard deviation (%RSD), ranged from 0.09% to 0.24%. Peak height precision was 1-7%, and peak
    • 6.8 Additional Materials for Polymer Networks 257 Migration Time in Minutes FIGURE 6.8 Separation of a 1-kbp DNA ladder using 0.4% methylcellulose. Conditions described in Figure 6.6. Key (bp): (1) 75; (2) 134; (3) 154; (4) 201; (5) 220; (6) 298; (7) 344; (8) 396; (9) 506; (10) 517; (11) 1018; (12) 1636; (13) 2036; (14) 3054; (15) 4072; (16) 5090; (17) 6108 (18) 7126; (19) 8144; (20) 9126; (21) 10,180; (22) 11,198; (23) 12,216. Reprinted with permission fromJ. Liq. Chromatogr., 15, 1063 (1992), copyright © 1992 Marcel Dekker. area precision ranged from 2% to 9%, all at DNA concentrations of 10-25 |lg/mL. At 5 |Lig/mL, precision began to deteriorate as the limit of detection was approached. Using polyacrylamide-coated capillaries (45), migration time pre- cision was run-to-run, 0.4%; day-to-day, 0.5%; and capillary-to-capillary, 0.9%. The polyacrylamide-treated capillaries^ lasted for 50 injections before the coating deteriorated with the pH 8.0 buffer. In more recent work, a precision of 0.2 bp in 200 bases (0.1%) was found using hydroxyethylcellulose, 7 M urea, and a phenyl- methyl-coated capillary (46, 47). 6.8 ADDITIONAL MATERIALS FOR POLYMER NETWORKS A. LINEAR POLYACRYLAMIDE The use of linear, or uncrosslinked, polymer solutions of polyacrylamide (LPA) or dimethyIpolyacrylamide has had profound effects, particularly in DNA sequencing. While LPA absorbs in the UV, this is not a problem for DNA sepa- rations, since LIF is usually employed. ^Bio-Rad, a manufacturer of polyacrylamide capillaries, claims to have stabilized the surface. Hun- dreds of injections have reportedly been obtained on a single capillary with an alkaline buffer.
    • 258 Chapter 6 Size Separations in Capillary Gels and Polymer Networks Both the polymer concentration and molecular weight are important for extending the read length when sequencing. The admixture of 2% LPA (9 mDa) and 0.5% LPA (50 kDa) is used to separate DNA-sequencing reaction products of up to 1000 bases in less than 1 h (48). The viscosity of this polymer is 30,000 cps. The solution exhibits non-Newtonian properties as the viscosity drops upon the initiation of flow. The use of 2% 16-mDa LPA and 0.5% 250 kDa at 125 V/cm extends the read length to 1300 bases in 2 h (49). The lower field strength extends the read length by minimizing the biased reptation effect. Linear polyacrylamide has also been used for antisense DNA separations where the matrix was 18%T (50), genetic analysis (51), and plasmid mapping (52). B. DEXTRANS Dextrans are branched polysaccharides produced by bacteria growing on a sucrose substrate. They form viscous slimy solutions when dissolved in water. Unlike agarose, which is helical in structure, dextran pores are defined by poly- meric entanglement. This material overcomes many limitations of polyacrylamide for the separa- tion of proteins. Besides being pumpable and replaceable, the solution has a low absorbance in the low Uy permitting sensitive detection (31). Polyacrylamide- filled capillaries are usually monitored at higher wavelengths—260 nm for DNA and oligonucleotides, 280 nm for proteins. While these wavelengths are suitable for oligonucleotides, the molar absorbtivities are poor for proteins at 280 nm. Proteins can be size separated using an electrolyte containing 0.1% SDS, 10% dextran 2 M (molecular weight 2 mDa) in 60 mM 2-amino-2-methyl-l,3- propanediol (AMPD)-cacodylic acid (CACO), pH 8.8 (Figure 6.9) (31). Small peptides can be separated in dextran matrices as well. Using an elec- trolyte containing 12% dextran 2 M, 400 mM Tris-borate, 0.1% SDS, and 10% glycerol, pH 8.3, resolved myoglobin fragments ranging in molecular weight from 2515 to 16,949 on bare siUca (53). Lower concentrations of dextrans provided less-adequate resolution. Using dextran 70 K, a lower molecular weight fraction, succeeded in separating the small peptides but was inadequate for the larger frac- tions. The addition of glycerol increased viscosity and thus lowered the diffusion coefficients of the peptides. This is important for the smaller peptides in particu- lar. Buffer concentrations below 200 mM Tris gave inadequate resolution. A calibration plot of log Mj. (molecular weight) versus the migration time deviated from linearity below molecular weight 6000. This was probably due to the poor SDS-binding capacity of the small peptides. In any event, separation was achieved and was consistent with the slab gel. Aminodextran (AD) has been used in conjunction with linear polyacrylamide (LPA) to enhance the separation of oligosaccharides (54). In this example, ion pairing between the AD (10 kDa) and negatively charged oligosaccharide
    • 6.8 Additional Materials for Polymer Networks 259 0.012 0.0081 C o is < 0.004 0,000 0.00 4.00 flm« (mln) 8,00 FIGURE 6.9 Separation of standard SDS-protein complexes in a dextran polymer network. Cap- illary: dextran-grafted, polyacrylamide-coated 23 cm (18 cm length to detector) x 75 JLim i.d.; buffer: 60 mM AMPD-CACO, pH 8.8, 1% SDS, with 10% w/v dextran 2 M; field strength: 400 V/cm; current: 30 jiA; injection: 2 s at 300 V/cm; detection: UV, 214 nm. Key: (1) myoglobin; (2) carbonic anhydrase; (3) ovalbumin; (4) bovine serum albumin; (5) ^-galactosidase; (6) myosin. Reprinted with permission from And. Chem., 64, 2665 (1992), copyright © 1992 Am. Chem. Soc. enhances the separation. The concentration of AD is quite low, 50 mM, so that the sieving is provided by the LPA. C. POLYETHYLENE GLYCOL Polyethylene glycol (PEG), a linear polymer, can also be employed as a poly- mer network. A 3% solution of PEG (MW 100,000) can separate SDS-proteins from 14 to 94 kDa, with detection at 214 nm (31). Protein separations are com- parable with those by PEG, but the run times are somewhat longer compared with those of dextrans (Figure 6.10). Migration time RSDs of 0.4-0.5% are found when the PEG solution is replaced after each run. Ferguson plots (Sec- tion 6.1 IF) are linear and intercept they axis at the CZE mobihty values. This indicates a true size separation. More than 300 injections were performed with- out degradation in performance.
    • 260 Chapter 6 Size Separations in Capillary Gels and Polymer Networks ^ 2 OG IAJ ] L OJ FIGURE 6.10 Separation of low-molecular-weight standard SDS-proteins with a PEG polymer net- work. Capillary: dextran-grafted, polyacrylamide-coated 46 cm (40 cm length to detector) x 100 |im i.d.; buffer: 100 mM Tris-Ches, 0.1% SDS, pH 8.8, with 3% w/v PEG 100,000; field strength: 300 V/cm; injection: pressure (0.5 psig) for 20 s; detection: UV, 214 nm. Key: OG (internal standard, Orange G); (1) a-lactalbumin; (2) ovalbumin; (3) carbonic anhydrase; (4) ovalbumin; (5) bovine serum albumin; (6) phosphorylase B. Reprinted with permission from Anal. Chem., 64, 2665 (1992), copyright © 1992 Am. Chem. Soc. D. OTHER POLYMERIC REAGENTS It seems amazing that so many polymers can provide for size separations. Short tandem repeats have been separated using a mixture of polyethylene glycol 8 M and 350 K in TBE containing 3.5 M urea (55). Polyethylene glycols have also been used for DNA sequencing (56, 57) and protein separations (38, 58). Polyvinylpyrrolidone (39) and Pluronics (41) have been utilized for DNA
    • 6.9 Detection 261 sequencing and oligonucleotide separations, respectively. Polyvinyl alcohol has been used for SDS-proteins (59). It is only a matter of time before designer poly- mers engineered for separation and detection become available. E. COMMERCIALLY AVAILABLE GELS AND POLYMER NETWORK REAGENTS Both gel-filled capillaries and reagents for polymer network separations are com- mercially available. Table 6.3 contains a compilation of available material. Unfortunately, due to the competitive marketplace, many manufacturers choose not to reveal their specific recipes. It is likely, though, that many of these for- mulas are composed from reagents that have been described in this chapter. 6.9 DETECTION The details concerning detection are covered in Chapter 9. For proteins, UV detection at the lowest possible wavelength is best. This is determined by the UV cutoff of the polymer network. For this reason, polyacrylamide is not very useful for separating SDS-proteins. When using the Bio-Rad SDS-protein matrix, a wavelength of 220 nm is best. DNA molecules absorb strongly at 260 nm. For high sensitivity, LIF detec- tion is always employed. Fluorophores are provided either by a fluorescent label, by a fluorescently labeled primer, by a fluorescently labeled dideoxynucleotide triphosphate, or through the use of intercalating reagents. Intercalating reagents^ are additives to polymer network or gel systems that form complexes with specific solutes, usually DNA. These additives are employed to alter selectivity and improve detection. For example, the bands comprising 271 and 281 bp are not resolved using the buffer recipe given in Figure 6.7. If 10 |iM ethidium bromide (FtBr) is added to the buffer, the bands are completely resolved, as shown in Figure 6.11, though the run time increases by 40% (29). Ethidium bromide is an intercalating reagent that inserts between base pairs of the DNA double helix. Since the reagent is cationic, the mobility of the DNA-EtBr complex decreases due to the reduction of the ionic charge. Incor- poration of 1 |ig/mL of EtBr into a linear polyacrylamide matrix improves the separation and also the detector sensitivity (60). The UV absorbance values in the presence of EtBr are enhanced two- to threefold because of the stronger absorptivity of the DNA-EtBr complex. Since EtBr intercalates between the base ^Intercalating agents are usually toxic.
    • 262Chapter6SizeSeparationsinCapillaryGelsandPolymerNetworks 2 O e o U ^ ffII d TJ Uw< Pi u sw Cu ^ 6 S :^ ^1—J ess CQmX o o o PuX d.pti OU CUPH m W O g a < Z P;/5 X5 PH < u <iJ Q -T3 O ^ 5 ^ as on^ ^,12 oZ QQ c«00 oX -9ci. X sSiss I—Irv|rHh>. t=3 O U ^ <ah—,PQ cs o s W PH o o < z Q I/) C/5 PH <ulU Is o^ .2?^ O^ lO W o <p^ 3. oo Q cy-) PH <U <u w u 12S 8 P S 2 o in fN in '<4- X ex PS o 6 o o ro 00 PC CI. s st^ LO d I/) .2 o U *2 O ^9 o^. ^o )-> 05 J >N 3 fO ro J^ 00J 3% 1- OScri ;_ Cl- i-i OS J ^ ns J ^<u u, C3 <u C J D- CTS ro "^ u o oJ 00 3 C5 o TO CJ^ CU00 M )-l C3 <L> C2 ZJ >s1 in5u inc«<ic MU 'o'o &.PH )-i!-< e:p! ZJ^ ;H s "o &H ^OS ^ 00 _cu c <Z Q XJ <D TJ C OS tn ^3 O Q U Pu <Z Qa^"^
    • 6.9 Detection 263 Z71 2C1 / .^.^.ju,,,,,,^^ »ynMw»,lll-<»Wi*1 >ir«t|.ilWllW»»» S*****"***"****UuL •rt »ft v0 d ««# TliBe (miit) «^ *^ &* H rt . fM IM f« « FIGURE 6.11 Effect of ethidium bromide on DNA restriction fragment resolution. Conditions as per Figure 6.7, except sample concentration: 10 }Xg/mL; injection: 2 kV for 10 s; buffer: as per Fig- ure 5.8 with the addition of 10 jig/mL EtBr. Reprinted with permission from J. Chromatogr., 559, 267 (1991), copyright © 1991 Elsevier Science Publishers. pairs of double-stranded DNA, there is no improvement in the separation of sin- gle-stranded oligonucleotides. Ethidium bromide becomes planar and fluoresces strongly when intercalated in the DNA matrix. In the bulk aqueous buffer, residual fluorescence is quenched through collisions with solvent molecules. EtBr is not often used any- more in HPCE, because the absorption spectrum of EtBr does not match the emission lines of the low-cost and reliable argon-ion laser. Separations of restriction fragments and PCR products using thiazole orange as the intercalator with 0.5% HPMC in a buffer consisting of 89 mM Tris-borate, 2 mM EDTA, pH 8.5, and 0.1-1 |Lig/mL thiazole orange resolves this problem
    • 264 Chapter 6 Size Separations in Capillary Gels and Polymer Networks (61). Since the dye absorbs strongly at 488 nm, the argon-ion laser is an opti- mal excitation source. The limit of detection is improved by a factor of 400 com- pared with that of UV detection. Unlike EtBr complexes, the DNA-thiazole orange complex is sensitive to the DNA-dye concentration ratio. Good peak shapes are found when a 9:1 molar ratio of DNA:dye is employed. Other dyes such as YO-PRO (62), 9-aminoacridine, YOYO (oxazole yellow homodimer), TOTO (thiazole yellow homodimer), and propidium also inter- calate between the base pairs (63). The use of bis intercalators (homodimers) can give rise to artifact peaks from the formation (presumably) of intermolecu- lar dimers not seen when using the monomer dyes (63). SYBR Green 1 was used in conjunction with 0.3% HEC for mutation screening (64). The dye YO-PRO-1 with 0.75% HEC permitted sensitive detection of restriction fragments and PCR- amplified short tandem repeats (65). It was also shown that the accuracy of mol- ecular weight measurements is improved when intercalators are used (66). In a related development, hydrophobic dyes can be used to enhance detection of proteins (67). While the reported separations were by CZE, it is likely that such a scheme can be employed in polymer networks. Dyes such as 1-anilino- naphthalene-8-sulfonate (ANS) and 2-p-toluidinonaphthalene-6-sulfonate (TNS) fluoresce only when bound to a protein. Incorporation of 200 |LiM TNS in the run buffer optimized the sensitivity for conalbumin with helium-cadmium laser- induced fluorescence detection. A limit of detection of 360 nM was reported. 6.10 OPERATING HINTS USING POLYMER NETWORKS A. FILLING THE CAPILLARY WITH POLYMER SOLUTION Unlike a conventional BGE, the polymer networks are extremely viscous solu- tions. It is generally best to backfill the capillary with the polymer network to avoid coating the outside of the inlet portion of the capillary with a solution dif- ficult to remove. If your instrument has the capability, place the polymer solu- tion at the outlet side and pressurize the outlet vial. Operation at few hundred pounds per square inch will speed the filling of the capillary. If you must forward-fill the capillary, then designate several rinse steps to cleanse the outer capillary wall. A rinse step should be designated even if the capillary is backfilled. B. INJECTION Electrokinetic injection will provide the best sensitivity and resolution, pro- vided the salt concentration in the sample is low. If the sample contains more than 50 mM salt, hydrodynamic injection should prove superior.
    • 6.11 Applications and Methods Development 265 C. RUN BUFFERS The inlet and outlet reservoirs contain buffer, but there is no need for the poly- mer reagent to be present here. This permits the designation of one vial to con- tain the polymer network. That vial can be reused many times, saving valuable reagent. The same holds true when using DNA intercalators. If purchased in kit form, these reagents are expensive. Determine experimentally how often the inlet and outlet buffers need to be changed. Refer to Section 2.1 for a discussion on buffer depletion. D. ELECTRIC FIELD Operate using reversed polarity. Both SDS-proteins and DNA are anionic under typical conditions and migrate toward the positive electrode. The EOF is usu- ally nullified by the viscosity of the polymer network. E. OPERATION AT ELEVATED PRESSURE Occasional problems with outgassing have been observed when using viscous polymer networks. Operation of the instrument in the capillary electrochro- matography (CEC) mode permits the pressurization of the entire capillary. The use of 2-bar pressure eliminated the outgassing problem (68). The impact on migration time precision has not be adequately studied. E CAPILLARY REGENERATION PROCEDURE If bare silica capillaries are employed, 0.1 N sodium hydroxide and/or 0.1 N hydrochloric acid can be used as interrun washes, after which the capillary is refilled with polymer network. If a coated capillary is used, the base and usu- ally the acid wash should be omitted. Acid washes have been used to reduce the EOF in bare silica capillaries. 6.11 APPLICATIONS AND METHODS DEVELOPMENT The manufacturers' kits and protocols provide an appropriate starting point for most methods. The purpose of this section is to provide a basis for methods devel- opment for those wishing to develop their own separations or to adapt the kits for specific appUcations. Key apphcations will be surveyed as well. Table 6.4 presents a variety of applications and recipes that employ replaceable polymer networks.
    • 266Chapter6SizeSeparationsinCapillaryGelsandPolymerNetworks ONO>-H(Nrn 00 o o oTt-r-H^ U PH X ;3 o X '^^ 1^ oo rsl^,—IrH^ 3 B o 3 e PS £ w PQ CQ ^m CQ m 00 re X OPQ 1 g00H in:i:X§ (NCu^I—I (Urn CS00 oX C3 o^ V U W X «o(N 6 OH ^ro <tf in 2 ^in 6 W Ou ^ S00 6wCU ^in 1—I o o vO 6wpL, ^ ^-—I :sin in <&: ^in o S^ d 6w Cu ^'t; --H S00 6wOH ^in I—I o 1 h- d ^ ^(N nj OS *->TS ^nJ U w X ^r^ d S ^ ^ o-g u w X 2 o ^^^O>—I(N(N0^ 3 CQ ^ ^ _2 i5 2 Pu 00 <-* Q Ow1/5 c<u _c« C < S'u <-t3V5 << zzPQSo
    • 6.11ApplicationsandMethodsDevelopment267 ro X (N in (N 00 <—i m ,__i ro^00^00 N- m in 00 vo 00 OS (N h~ 00 00 00 C^ 00 o a^ o ^ tu u3 HJ VH" W eX r—1 wPQ H X fN w H X 1—1 J^o (0 2 t o 'B OS 1o^ lyi Q d 00*" 00 ^ s'a oU OS U U^ Q LO 2 d x" 00 u 1 So oI—I x" 00 3: Q d sin m oa W) Pi ^ID 1—1 oo'~ 00 X d B in m o X (N 1—5 3 U o ^ o :§ d 1—1 C3 PH CD o PH s o(N OD (N PH 4:3 S- iPH W H X >—1 00 X o-^ w u p .-4 4 P W s6 (NPi mfN.—Io>—I X p. Q w in 0 0 U w (N < (N u p 0 PH g (N P(73 (J T3 0 0 0 1—1 6w<< <PH (N o 0 0^ ^ ^ ^ ^ sPH X in u OrO-—Ivo^O o ^o^ < Q 'B •B-Sp4; i I—I(N i ^ P 5U 0 <ZPi gP < 5pi T3 2 0 c>^ I,^
    • 268 Chapter 6 Size Separations in Capillary Gels and Polymer Networks A. METHODS DEVELOPMENT USING POLYMER NETWORKS—ANTISENSE D N A The development of DNA therapeutics or gene therapy has been burdened by the rapid decomposition of the drug substances by exonucleases, enzymes that function to rid the bloodstream of foreign DNA. To overcome the biological response, research in the field is based on the development of compounds that will bind to target DNA or mRNA but are not recognized by the body's natural defenses. These are known as antisense oligonucleotides (ODNs). The most widely study ODNs are phosphothioates, which are modified by substituting a single sulfur atom for one oxygen on the phosphate group (70, 91). During the course of synthesis of these compounds, failure sequences may occur. In the blood stream, catabolites may be formed. These fragments may still have biological activity; therefore, methods to separate the parent com- pound and its fragments are required. The method must use a replaceable poly- mer network, suppress the formation of secondary structures, and provide unit base resolution of mixtures of 15- to 20-mer ODNs. A scheme for methods development that maps the pathway to the final method is given in Figure 6.12 (70). Among the parameters to be studied are: 1. Polymer type, molecular weight, and concentration 2. Buffers and denaturants 3. Capillary coating 4. Operational parameters, voltage, temperature, and so forth Polymer Mesh size Viscosity PEG.HEC.etc. polymer cone. Column Wail ads. EOF Low pH Derivatized column —^ Derivatized column Buffer composition! SODN . secondary l/l structure n Hi pH Denaturant Hi Temp, Buffer capacity pH-pKa Urea Formamide 50r Tris-borate pH=9.0 Formamide 13% PEG Derivatized column 30% Formamide sot lOOmM Tris- borate, pH=9.0 FIGURE 6.12 Methods development scheme employing a polymer network for the separation of antisense DNA. Reprinted with permission from Electrophoresis, 19, in press (1999), copyright 1999 © Wiley-VCH.
    • 6.11 Applications and Methods Development 269 The selection of the polymer solution is based in part on the viscosity of the reagent blend. It must be pumpable with the instrument at hand. Figure 6.13 shows the separation in various amounts of PEG 20,000 (70). As the reagent con- centration is increased, separation improves, with 13% being optimal. Above 13%, peak splitting is observed for no apparent reason. The entanglement threshold, 0*, is estimated at 1.7%, and the pore size is 20 A at 13% concentration. A denaturing buffer system under alkaline conditions is best to suppress inter- or intramolecular hydrogen bonding of ODNs, but a pH of greater than 10 was not considered because of complications from the ionization of the T and G bases, which have pK^ values of around 10. Urea was not useful as a denaturant, but the impact of formamide, shown in Figure 6.14, is substantial (70). With the selec- tion of pH 9 for the buffer, the potential for capillary coating degradation is sig- nificant. While good capillary stability was reported, a homemade capillary was employed, and identical results may not be found on other capillaries. The effect of temperature is illustrated in Figure 6.15 (70). By elevating the temperature, shorter run times occur, since the viscosity of the polymer net- work is decreased. This in turn increases the solute mobility in the same man- ner as in CZE. Note the improvement in resolution at the higher temperatures. This is related to maintaining a more denaturating environment. These results i& S 1§ 1 1< g I 1 1.7% A Mi 1 j / Jjd Wo 8% Av „ ..-^ L _,yvvMAA_ TimeCmio) FIGURE 6.13 Impact of PEG concentration on the separation of 15- to 20-mer antisense DNA. Capillary: polyacrylamide-coated 67 cm (60 cm length to detector) x 50 |Lim i.d.; buffer: 100 mM Tris-borate, pH 9.0, 30% formamide with the indicated amounts of PEG; voltage: -30 kV; injec- tion: pressure (0.5 psig) for 40 s; detection: UV, 254 nm. Reprinted with permission from Elec- trophoresis, 19, in press (1999), copyright 1999 © Wiley-VCH.
    • 270 Chapter 6 Size Separations in Capillary Gels and Polymer Networks < > 10%(v/v) fMTisankle 20%(v/v) formamidc 3{>5)(v/v) formamidc 40%(v/v) formami* 'W««((WVtH(iM«SA«*'**' 21 23 25 Time (min) 27 29 FIGURE 6.14 Effect on the formamide concentration on resolution. Conditions as per Figure 6.13. PEG concentration: 13%; formamide concentrations as indicated. Reprinted with permission from Electrophoresis, 19, in press (1999), copyright 1999 © Wiley-VCH. are all consistent with the experimental requirements for long read lengths in DNA sequencing. B. SDS-PROTEINS The advantages of separating SDS-proteins by capillary electrophoresis are compelling: 1. SDS solubilizes all proteins, even hydrophobic ones (13). 2. SDS-protein complexes are highly charged and very mobile (13).
    • 6.11 Applications and Methods Development 271 3. Since the complexes are always negatively charged, they always move toward the anode (13). This holds true even if bare sihca capillaries are employed, since the SDS-protein complex is repelled from the negatively charged wall. 4. The proteins are unfolded and stretched by SDS binding (13). 5. Separation is based only on molecular weight (13). 6. Glycoforms and isoenzymes appear as a single peak, as microhetero- geneity is not visualized (13). 7. Separation in the viscous polymer network limits diffusion, thereby opti- mizing band broadening. 1. Preparing the SDS-Protein Complex Before performing electrophoresis, all proteins must be converted into SDS-pro- teins. This process masks individual charge differences between proteins, cleaves hydrogen bonds, cancels hydrophobic interactions, prevents aggregation, and removes secondary structure by unfolding (13). The binding buffer usually contains 0.1% SDS and Tris, pH 9.2,5 though pH 6.8 can also be used. At this surfactant concentration, the protein concentration 5Bio-Rad SDS Sample buffer. 23t: 35T TimeCmin) FIGURE 6.15 Impact of temperature on resolution and speed of analysis. Conditions as per Fig- ure 6.13. PEG concentration: 13%; formamide concentration: 30%; temperature as indicated. Reprinted with permission from Electrophoresis, 19, in press (1999), copyright 1999 © Wiley-VCH.
    • 272 Chapter 6 Size Separations in Capillary Gels and Polymer Networks should be less than 1 mg/mL to ensure complete binding. The salt concentra- tion in the sample should be kept as low as practical, especially if electrokinetic injection is employed. Hydrodynamic injection is less sensitive to salt, though band broadening may occur at concentrations above 100 mM. If the sample con- tains potassium, precipitation may occur through ion exchange with SDS. Denaturation occurs by heating the protein-SDS solution in a water bath maintained at a temperature near boiling for 5-10 min. For proteins subject to fragmentation, both the time and temperature may have to be reduced. In a nonreducing environment, the sample can be left for 30 min at room tempera- ture to minimize fragmentation. If the proteins are to be separated in the reduced forms, either 15 mM dithiothreitol (less odorous) or mercaptoethanol should be added to the buffer prior to heating to cleave the disulfide bonds. Some proteins exhibit nonideal behavior during SDS-PAGE. Glycoproteins and lipoproteins do not bind the same amounts of SDS per gram of protein. The correlation of mobility to molecular weight falls apart under those circum- stances. Aggressive denaturing conditions may be required to alleviate this prob- lem (92). For glycoproteins, a Tris-borate-EDTA buffer increases the negative charge on the carbohydrate moiety, which does not bind SDS (13). While not studied by HPCE, it was reported that acidic and very basic nucleoproteins do not bind SDS. Alternatively, a cationic surfactant such as CTAB can be used for binding proteins at pH 3-5 (13). 2. Gels and Polymer Networks While there have been reports on the use of rigid gels for size separation of SDS-proteins, all modern work uses replaceable polymer networks. Some of this early work established the potential of HPCE to replace the traditional slab gel. For example, the relationship between the mobiUty of each fragment and the log molecular weights was found to be linear (2). Larger proteins such as pepsin (MW 34,700) are better separated on a more porous 10%T, 3.3%C gel. Proteins always migrate faster in more porous (lower %T) gels. The same effects are observed in polymer networks. The limitations of rigid gels are overcome by using UV-transparent and pumpable denaturing polymer networks. Proprietary formulations are being marketed by Bio-Rad and Beckman. The Beckman process has been correlated with conventional slab-gel electrophoreis for more than 50 proteins. The linear dynamic range is from a few |ig/mL to 1 mg/mL, and the molecular weight lin- ear range is from 14 to 205 kDa. In addition, Beckman has shown migration time RSD of 0.28-0.38% and peak area RSDs of 0.87-7.0%, externally stan- dardized. The Bio-Rad Kit provides similar specifications. Validation of the size separation is assessed with a Ferguson plot (see Section 6.1 IF for more details). These plots are difficult to perform by HPCE with rigid gels, since at least three different %T gels in separate capillaries are required. In
    • 6.11 Applications and Methods Development 273 the capillary format using pumpable reagents, the process is simple to imple- ment (38). When properly denatured, all proteins should have identical charge- to-mass ratios. This is confirmed, since the Ferguson plot (data not shown) indicates all of the myoglobin proteins converging to the same point on the y axis at 0%T (2). Data comparing HPCE with the slab gel have been reported for 65 proteins with polyethylene oxide as the polymer network (93). It was concluded that both techniques yielded similar separations results and precision. The applicability of polymer networks for performing size separations is illus- trated in Figure 6.16. Data generated from the separation of a crude catalyse i iiWll |SS • • ft as a 1 a 1 t4^^««t'«iiiii [ w^:BJhm.<^imsm.mmnM 1 DeBsiixieMe Scaxi (5 iig) ^ FIGURE 6.16 Size separation of a crude denatured (boiled for 15 min in 1% SDS and 1% mercap- toethanol) catalyse preparation (1 mg/mL) by HPCE (upper trace) and slab-gel electrophoresis (lower trace). The lower trace is densimetric scan of a 10%T, 2.6%C gel. Courtesy of Applied Biosystems.
    • 274 Chapter 6 Size Separations in Capillary Gels and Polymer Networks preparation are compared for runs by HPCE and a densitometer scan of a slab gel. With the x axis approximately normalized for molecular weight, a remark- able correlation between these two techniques is observed. Identification of pro- tein dimers, trimers, and so forth, deglycosylation, and other size-modifying chemistries are the usual applications for this technique. Many of the polymers used for size separations can bind SDS (12). When this occurs, it is possible that the polymer will compete with the protein for the sur- factant or that the SDS-protein may bind to the polymer. Both polyethylene oxide and polyvinyl alcohol bind the SDS-protein in a similar fashion to their binding of the unfolded protein. In this regard, polyacrylamide and dextran are optimal, with dextran being favored because of its low UV cutoff (12). 3. Detection Since UV detection is less sensitive than silver staining on a slab gel, there have been a few applications employing LIF detection to improve the sensitivity of SDS-protein separations. These include precapillary derivatization (94, 95) and detection of the immunoconjugate of a monoclonal antibody, v^th the naturally fluorescing drug doxorubicin (96). 4. Native Separations There have been even fewer reported applications employing nondenaturing conditions (97). It is possible in practice to use polymer networks with ampho- teric buffers such as HEPES, MES, or MOPS in the absence of SDS to observe native proteins. C. OLIGONUCLEOTIDES Oligonucleotides are single-stranded fragments of DNA and, as a result, do not bind to intercalators. Unless the molecules are tagged, UV detection at 260 nm is usually employed. Spectacular separations of synthetic oligonucleotides yield- ing millions of theoretical plates have been reported on linear polyacrylamide as well as on crosslinked gels (18, 20, 98-102). The separation shown in Figure 6.4 of poly(dA)2o and poly(dA)4o_6o run in a 9%T linear polyacrylamide filled capillary yields unit base resolution and shows partial separation of the phosphorylated and dephosphorylated oligonu- cleotides. This can be important when performing drug stability studies, since dephosphorylation is one of the modes of DNA degradation. These polymer net- works are prepared in situ, and today a pumpable viscous network would be
    • 6.11 Applications and Methods Development 275 used instead. HPCE is particularly valuable for identifying failure sequences that occur during the synthesis of oligonucleotides. Both native and denaturing gels for the separation of oligonucleotides have been studied (98). In native gels, the relative migration order is not constant for homooligomers; it depends on the base number. For base numbers less than 14, the migration order is A > C > G > T; for greater than 18 bases, the order becomes G > A > C > T. The authors suspect this discrepancy is caused by molecular bending due to self-association of guanosine. In denaturing systems, the order of migration is the same regardless of the oligonucleotide sequence. A comparison between HPLC and HPCE for poly(dA) standards showed compelling advantages for capillary electrophoresis (21). By HPCE on a mixed- mode Neosorb-LC-N-7R column, 1-70 mer were separated with unit base res- olution by a gradient run of 150 min, generating 10,000 theoretical plates. By HPCE, on a 5%T, 5%C gel at 200 V/cm, 6-255 mer were separated in 62 min, generating 2,300,000 plates (7 million plates/meter). For oligonucletides con- taining less than 30 bases, HPLC generally provides adequate speed and reso- lution. For larger oligonucletides, HPCE provides substantial separation advantages. The data in Table 6.5 provide an effective means of selecting either HPLC or HPCE as the separation tool (21). Table 6.5 Comparative Performance of HPLC and CGE Method Ion-exchange HPLC Partisil SAX Nucleogen-DMA-60 MonoQ Gen-Pak FAX TSK gel DEAE-NPR Reversed-phase LC Zorbax ODS jiBondapak C^g Mixed-mode LC Neosorb-LC-N-7R CGE Separated Polynucleotides 1-30 mer 1-37 mer 1-27 mer 40-60 mer 20-70 mer 2-10 mer 1-19 mer 1-75 mer 20-160 mer 19-330 mer 19-300 mer 19-340 mer 1-430 mer Analysis Time (min) 50 110 15 39 17 25 60 95 25 70 115 70 130 Reprinted in part from J. Chromatogr., 1991; 558:273.
    • 276 Chapter 6 Size Separations in Capillary Gels and Polymer Networks D. BLOTTING Blotting involves the electrophoretic transfer of material from the gel matrix onto a membrane. Hybridization reactions using DNA probes can be used to identify the blotted material. As an alternative to traditional blotting, it is pos- sible to perform a precapillary hybridization, with subsequent separation of the reaction products by HPCE (79). Figures 6.17A-C show electropherograms of Joe-labeled 17-mer sequencing primer (GTAAAACGACGGCCAGT), complementary pC2 34-mer (TCGAATTCACTGGCCGTCGTTTTACAACGTCGTC), and a mixture of the two annealed at 65°C for 10 min, then slowly cooled to room temperature in 30 min (79). The third peak in Figure 6.17C was identified as a hybrid of the two reagents by laser fluorescence as well as by thermal dissociation (Figure 6.17D). Faster and more complete hybridization is possible by incubating in dry ice, possibly due to the lack of salt in the annealing process. Salt was eliminated from the annealing process because of the deleterious impact on injection response and reproducibility. The profound impact of salt's effect is given in Table 6.6 (79). Failure to control the salt (ionic strength) concentration causes serious quantitative problems—in this case, an inverse calibration curve. E. DNA SEQUENCING The human genome initiative (HGI) is a project designed to sequence the entire human genome. HGI will, according to Leroy Hood, "profoundly change the study of biology and the treatment of disease" (103). HGI proposes to map and sequence the 24 different human chromosomes, which contain approximately 100,000 genes and 3 billion bases. The project goals are as follows (104) (resolution given in parentheses): 1. Complete a detailed human genetic map (2 Mbp). 2. Complete a physical map (0.1 Mbp). 3. Acquire the genes as clones (5 kbp). 4. Determine the complete sequence (1 bp). Capillary electrophoresis is now the predominant technique employed in step 4 of this project. Commercially available, fully automated instruments con- taining 96-capillary arrays, laser-induced fluorescence detection, and sophis- ticated base-calling computer programs are now available. The front-end sample preparation is accomplished using robotics systems. The task at hand is to extend the read length of the sequencer to the great- est number of DNA bases possible. This will result in reduced costs, fewer sequencing reactions, higher throughput, and easier assembly of the sequenced fragments. Among the factors required to maximize the read length are the
    • 6.11 Applications and Methods Development 277 lo© B pC2 Joe:: |C2 .-..w^-'^^ Joe Jl pC2 ,w«^^«J^A-w/ Joe:: pC2 Mill 13 FIGURE 6.17 Identification of a DNA molecule by hybridization with a fluorescence-tagged oligonucleotide probe using CGE. (A) Joe-labeled 17-mer alone [5 jiig/mL in 10 mM Tris-borate-EDTA (TBE)]; (B) pC2 alone (5iig/mL in 10 mM TBE); (C) equal amounts ofJoe-labeled primer and pC2 in 10 mM TBE, driven to complete hybridization by incubation in dry ice; (D) mix- ture in C heated to 65°C for 5 min. Capillary: 45 cm (25 cm to detector) x 75 |im i.d. filled with a 9%T nondenaturing linear polyacrylamide gel; buffer: 25 mM Tris-borate-EDTA, pH 8.0; injection: electrokinetic, 13.5 kV for 5 s; field strength: 300 V/cm; detection: Uy 260 nm. Reprinted with per- mission from J. Chromatogr., 559, 295 (1991), copyright © 1991 Elsevier Science Publishers. proper polymer blend (48), high temperature (105), appropriate field strength, and sample cleanup including desalting and template removal (106).
    • 278 Chapter 6 Size Separations in Capillary Gels and Polymer Networks Table 6.6 Effect of Buffer Concentration on Electrokinetic Injection Restriction digest, 0X174 Hae III was separated on a 9%T nondenaturing gel. The peak heights cor- responding to 234, 271, and 603 base pairs (bp) fragments were compared. More DNA was injected when the sample was diluted with distilled water. A nearly 500-fold increase in peak height was observed when the sample was diluted 1000-fold. Injection was done electrokinetically at 15 kV for 5 s. DNA Concentration (pg/mL) 1000 500 100 20 5 Tris-HCl Concentration (mM) 10 5 1 0.2 0.05 Fragment 234 bp 1 5 33 139 436 Relative Peak Height Fragment 271 bp 1 6 27 139 442 Fragment 603 bp 1 5 24 119 364 Reprinted with permission from J. Chromatogr., 1991; 559:295. F. DOUBLE-STRANDED DNA This application area involves restriction digests, PCR products, genetic and mutational screening, and short tandem repeat (STR) separations. The advan- tage of separating double-stranded material is the ability to use intercalating dyes to enhance detection. 1. Restriction Digests Restriction digests are mixtures of DNA fragments produced by the reaction of DNA and a restriction enzyme, an enzyme that cuts at specific base sequences. These enzymes are used for the creation of genetic maps prior to sequencing. An HPMC polymer network system can be used to monitor a PCR-amplified human immunodefieciency virus (HIV) infected cell line (Ul.l) (29). The cell line contains one copy of HIV-1 provirus and two copies of HLA-DQ-a, which is normally present in all healthy cells. Using specific primers, a 115-bp region of HIV-1 and a 242-bp region of HLA-DQ-a were coamplified by 35 cycles of PCR. Separations with and without ultracentrifugation are shown in Figure 6.18. The ultracentrifuge simultaneously desalts and concentrates the DNA in the sample. Since the concentration of the polymeric additive is easily varied, generation of a Ferguson plot (log JJ. vs. %T) is simple. Plotting the HPMC-4000 concen- tration versus log mobility for a 0X174 Hae III restriction digest (Figure 6.19) shows imperfect convergence at 0% polymer (29).
    • 6.11 Applications and Methods Development 279 No CrafarltSfHi ffl?-I Tttm (mln) FIGURE 6.18 Separation of a PCR-amplified cell line containing HlV-1 provirus. Voltage: 20 kV; injection: electrokinetic, 10 kV for 10 s. Other conditions as per Figure 6.7. (A) no ultracentrifu- gation; (B) Ix ultracentrifugation; (C) 2x ultracentrifugation; (D) 3x ultracentrifugation; (E) 0X174 DNA standard. Reprinted with permission from J. Chromatogr., 359, 267 (1991), copyright © 1991 Elsevier Science Publishers. There are four types of behavior expected in the Ferguson plot (13): 1. The hues are parallel. The molecules have the same size but different mobilities (e.g., isoenzymes). 2. The slopes are different, but the lines do not cross. The molecule giving the upper curve is smaller and has a higher net charge. 3. The lines cross at high polymer concentration. The larger molecule has the higher charge density. 4. Several lines cross at low polymer concentration, or they converge when extrapolated to 0% polymer. These molecules are all similar.
    • 280 Chapter 6 Size Separations in Capillary Gels and Polymer Networks -3.4 -a5 4 ? -3.6-1 -a.7H -as 0.0 0.8 % (w/w) HPMC-4000 FIGURE 6.19 Ferguson plot (log ju vs. % w/w HPMC) for a buffer containing HPMC-4000 as the polymer network. Mobihties of selected 0X174 Hue 111 digest fragments were used to generate the plot. Key:0 = 118bp;A = 194bp;n = 310bp;+ = 603 bp; A = 872bp;# = 1353 bp. Reprinted with permission from J. Chromatogr., 559, 267 (1991), copyright © 1991 Elsevier Science Publishers. For the Ferguson plot illustration, case 4 provides the best fit. Imperfect con- vergence does not necessarily mean errors will occur when calculating molec- ular weight. If the data for a molecule are nonlinear, this is indicative of problems such as experimental errors or adhesion of the molecule to the gel. 2. Short Tandem Repeats (STRs) DNA is now employed for human identification for forensic and military pur- poses. In the early 1990s, a technique known as restriction fragment length polymorphism (RFLP) was the method of choice. The technique works based on the presence or absence of restriction sites. Problems with the technique
    • 6.11 Applications and Methods Development 281 include the need for large amounts of intact DNA (20-100 ng) and the need for radioactive isotopes (107), although chemiluminescence is now used. The tech- nique is time-consuming and labor-intensive. The large number of alleles that differ by only a few sequences can be difficult to separate (107). The RFLP procedure is being replaced by a PCR method known as short tan- dem repeats (STRs) (46, 47, 90,108-112). Otherwise known as microsatellites, short tandem repeats are repetitive sequences where 2-7 nucleotides of DNA are repeated over and over again. Unlike DNA found in a gene, short tandem repeats are especially prone to DNA replication errors known as slip-strand mis- pairing (113). As a result, the lengths of these DNA satellites vary from one per- son to the next, and thus, they provide the potential for DNA fingerprinting. The use of LIF detection provides for the high sensitivity of the method. A separation of the HUMTHOl allelic ladder in a 1% HEC network using TBE buffer and 500 ng/mL YO-PRO-1 as fluorescent intercalator in shown in Figure 6.20 (90). The size of each fragment is calculated based on the migration times of the 150-bp and 300-bp internal standards. The need to extract more information from a sample and to preserve DNA has led to an approach known as multiplex PCR. The procedure involves adding more than one set of PCR primers in order to amplify multiple locations throughout the genome. The probability of finding identical alleles in individ- uals decreases as the number of loci examined are increased. Since fluorescent labeling with different dyes is used, detection of STRs with the same size range is readily accomplished. Multiple dyes also permit the simultaneous separation of a standard along with the unknown (89). This is the approach employed using the ABI Prism 310 Genetic Analyzer (110). The instrument has four-dye capability, one for the standard and three for the samples. Using that instrument, fragments of less than 350 bp can be separated in 30 min. It is expected that capillary arrays will play a huge role in STR analysis, since high throughput is required due to the expected sample load. Microfabricated devices that integrate the PCR step with separation and detection may play a role here as well (114). Capillary electrophoresis is an ideal technology for forensic DNA analysis, since the process is completely automated. There is no need to manually pour the gel or pipet the sample. Because of issues concerning validation, virtually all forensic laboratories will opt for a commercial instrument and protocol. 3. Genetic Analysis Allele-specific amplification can be employed to detect a single base-pair muta- tion through the use of a specially designed primer complementary to the mutated DNA (64, 78). PCR amphfication only takes place if the mutation is present. HPCE of the now double-stranded material takes place in a 4% LPA matrix on an 8-cm DB-1 capillary with a buffer containing Tris-TAPS, 2 mM
    • 282 Chapter 6 Size Separations in Capillary Gels and Polymer Networks <5.00 ^ 40.00 35.00 -J 30.00 -J 25.00 115.00 liO.OO 105.00 ~J 100.00 8.00 150 bp HUMTHOl Alleles 300 bp Ca»cylatg<i gizg 183.52 187.66 191.72 195.70 199.77 202.89 207.81 1.00 o.bo Minutes FIGURE 6.20 Separation of short tandem repeats in a HUMTHOl allehc ladder. Capillary: DB-17 coated 27 cm (20 cm effective length) x 50 |Lim i.d.; buffer: 1% HEC, 100 mM Tris-borate, 2 mM EDTA, pH 8.2, with 500 ng/mL YO-PRO-1; temperature: 25°C; injection: electrokinetic: 1 kV for 5 s; voltage: 5 kV; detection: LIF; excitation at 488 nm, emission at 520 nm. Reprinted with permission from J. Chromatogr., B: Biomed. Appl 658, 271 (1994), copyright © 1994 Elsevier Science Publishers. EDTA, pH 8.3, carrying 0.5 |Ig/mL EtBr,using LIF with a doubled Nd-YV04 laser (78). The most widely used genetic screening technique, PCR-RFLP, detects a mutation by the availability of a specific restriction endonuclease cleavage site at the mutation locus (115). The products can be separated with a polymer net- work containing an intercalator. The products from other techniques such as ARMS (amplification refractory mutation system), SSCP (single-strand confor- mational polymorphism) (116, 117), HPA (heteroduplex polymorphism) (118), and CDCE (constant denaturant capillary electrophoresis) (119) are all amenable to polymer networks.
    • 6.11 Applications and Methods Development 283 In CDCE, separation occurs takes place in a heated portion of the capillary, where faster moving, unmelted DNA fragments are in equilibrium with slower moving partially melted forms (120). Depending on the temperature range, the melting equilibrium and the average mobility of each mutant gene is different, and single base-pair point mutations can be resolved. The mobility is highest when DNA is in its double-stranded form at lower temperatures (e.g., 45°C), the exact temperature depending on the DNA sequence. Mutants are not resolved under these conditions. At high temperatures (e.g., 51°C), the now sin- gle-stranded mutants are not well separated. At intermediate temperatures, sep- arations with unit base resolution can be observed. A typical BGE is 5% LPA in 1 X TBE using an LPA-coated capillary. G. PLASMIDS Plasmids are circular bacterial DNA fragments that can exist in twisted super- coiled forms. They have the properties of a virus, but without the outer protein membrane. Several reports describing plasmid separations by HPCE have appeared in the literature (121, 122). Polymer networks are best used for plas- mid separations. Separations using 0.1% HEC, 0.1% HPMC, or 0.15% PEO all in 1 X TBE provide good separations using coated capillaries (123). H. RNA RNA separations are performed to determine RNA mass and conformation in the determination of gene expression, in the identification of microorganisms including retroviruses and bacteria (124), and from paraffin-embedded post- mortem tissue specimens amplified by PCR (125). To minimize RNA degrada- tion, material should be kept at -70°C until analysis (125). In some cases, RNA is detected via PCR that provides cDNA, which is further amplified, separated, and detected (125). For high-sensitivity detection of cDNA, the use of interca- lators and laser-induced fluorescence (LIE) is indicated. A Beckman dsDNA 1000 Kit, which contains a 10% LPA capillary in TBE and 0.4 |Lig/mL EnhanCE intercalator (125) or 1% HEC in TBE with 1 |iM YO-PRO on a DB-17 capillary (125), can be used in conjunction with the argon-ion laser. Since RNA is single-stranded, the use of intercalators is not possible, and UV detection must be employed. Many of the same polymer networks used for DNA are appUcable to RNA. The migration behavior of RNA is similar to single-stranded DNA, though RNA becomes slightly less mobile at lengths over 1000 bases. A typ- ical electrolyte system is 0.3-0.7% HPCE (4000 cp, 2% solution) in TBE buffer containing 8 M urea. Separations are best performed at high temperatures (50°C
    • 284 Chapter 6 Size Separations in Capillary Gels and Polymer Networks or higher) to shorten the run time and maintain the denaturing environment. Res- olution is lost when the field strength is over 300 V/cm. Sample preparation involves, at a minimum, dissolving in 80% formamide and heating to 95°C for 3 min to ensure denaturation (124). 6.12 REDUCING THE PROBLEM OF BIASED REPTATION Biased reptation limits the DNA fragment size that can be separated using a con- tinuous electric field. In the absence of the field, DNA and large oligosaccha- rides as well are tightly coiled. When the voltage is applied, the molecule lengthens as it aligns with the field. Beyond 20 kbp, fragments are no longer resolved by constant-field electrophoresis. Two techniques can be used to extend the range of separation for molecules following the biased reptation mechanism: voltage gradients (126) and pulsed- field electrophoresis (127-129). Voltage gradients can be performed on most HPCE instruments. No pulsed-field instruments are commercially available. A. VOLTAGE GRADIENTS At a constant field of 200 V/cm, all 0X174 restriction fragments are separated, but the run time is 27 min (Figure 6.21A). Increasing the field strength speeds the separation at the expense of resolution for the larger fragments. By running a voltage ramp starting at 400 V/cm and decreasing to 100 V/cm over 10 min, all fragments are resolved in less than 10 min (Figure 6.2IB) (126). The small fragments are not strongly aligned with the field and thus can be exposed to the high field strength. By the time the larger fragments are ready to elute, the field strength is sufficiently low that separation occurs. This method is not employed in DNA sequencing instruments, since the tim- ing of peak elution would change with time. While it would probably extend the read length, the additional complexity added in the algorithms may decrease the reliability of the base calling. The technique has not been widely utilized for other applications, since the reproducibility may be worse than with constant voltage. B. PULSED-FlELD ELECTROPHORESIS Pulsed-field electrophoresis has been used for some time for the separation of large DNA fragments in the slab gel (130). In its simplest format, the electric field driving the separation is pulsed. During the off cycle, the DNA molecules
    • 6.12 Reducing the Problem of Biased Reptation 285 mm S FIGURE 6.21 Separation of 0X174 DNA restriction fragments by CGE using (A) a constant applied electric field of 200 V/cm and (B) a linear field strength gradient ramping from 400 to 100 V/cm in 20 min. Capillary: polyacrylamide gel-filled DB-225 coated 40 cm (length to detector, 27 cm) X 100 |xm i.d.; buffer: 100 mM Tris-borate, 2 mM EDTA, pH 8.35. Key (bp): (1) 72; (2) 118; (3) 194; (4) 234; (5) 271; (6) 281; (7) 310; (8) 603; (9) 872; (10) 1078; (11) 1353. Reprinted with permission from Anal Chem., 64, 2348 (1992), copyright © Am. Chem. Soc. relax. Upon return of the field, molecules begin migration in a partially deformed state, since alignment with the field is a kinetic process. This mech- anism provides additional selectivity for the separation of large fragments.
    • 286 Chapter 6 Size Separations in Capillary Gels and Polymer Networks Alternatively, multiple-electrode systems that provide two electric fields can be employed. For example, electrodes can be positioned at angles of 90 or 120°. The applied voltage can be alternated between the electrode sets at frequencies designed to enhance selectivity for various size ranges. Upon application of the pulse, DNA molecules reorient in the gel. Longer fragments reorient slowly, and their migration through the gel is hindered. Isolation and mapping of large seg- ments of genomic DNA is an important application of this technique. Separa- tions of several million base pairs are possible using pulsed-field techniques. Adaptation of this technique to HPCE is in its infancy. An instrument was developed to deliver the pulsed field in either the unidirectional (single-polar- ity) or field-inversion (polarity-reversed pulse) formats, which position the elec- trodes at a relative angle of 180° (9, 37). Other angular placements used in slab-gel electrophoresis are not compatible in capillaries. Waveform distortion due to the high resistance of the gel-buffer system limited the pulse frequency to less than 100 Hz. While this problem may be solved by increasing ionic strength and using active cooling to remove heat, commercialization of this technique is probably years away. REFERENCES 1. Hjerten, S. High-Performance Electrophoresis: The Electrophoretic Counterpart of High Per- formance Liquid Chromatography. J. Chromatogr., 1983; 270:1. 2. Cohen, A. S., Karger, B. L. High-Performance Sodium Dodecyl Sulfate Polyacrylamide Gel Capillary Electrophoresis of Peptides and Proteins. J. Chromatogr., 1987; 397:409. 3. Hjerten, S., Elenbring, K., Kilar, E, Liao, J. L., Chen, A. J. C, Siebert, C. J., Zhu, M. D. Car- rier-Free Zone Electrophoresis, Displacement Electrophoresis and Isoelectric Focusing in a High-Performance Electrophoresis Apparatus. J. Chromatogr, 1987; 403:47. 4. Dolnik, V, Cobb, K. A., Novotny, M. Preparation of Polyacrylamide Gel-Filled Capillaries for Capillary Electrophoresis. J. Microcolumn Sep., 1991; 3:155. 5. Chen, Y., Holtje, J.-V, Schwartz, U. Preparation of Highly Condensed Polyacrylamide Gel- Filled Capillaries. J. Chromatogr, A, 1994; 680:63. 6. Wang, T., Bruin, G. J., Kraak, J. C, Poppe, H. Preparation of Polyacrylamide Gel-Filled Fused- Sihca Capillaries by Photopolymerization with Riboflavin as the Initiator. Anal. Chem., 1991; 63:2207. 7. Sudor, J., Foret, E, Bocek, P Pressure Refilled Polyacrylamide Columns for the Separation of Oligonucleotides by Capillary Electrophoresis. Electrophoresis, 1991; 12:1056. 8. Grossman, R D., Capillary Electrophoresis in Entangled Polymer Solutions, in Capillary Elec- trophoresis: Theory and Practice, Eds. P D. Grossman and J. C. Colbum. 1992, Academic Press. 215. 9. Heiger, D. N., Carson, S. M., Cohen, A. S., Karger, B. L. Wave Form Fidelity in Pulsed-Field Capillary Electrophoresis. Anal. Chem., 1992; 64:192. 10. Kim, Y., Morris, M. D. Pulsed Field Capillary Electrophoresis of Multikilobase Length Nucleic Acids in Dilute Methyl Cellulose Solutions. Anal. Chem., 1994; 66:3081. 11. Barron, A. E., Blanch, H. W, Soane, D. S. A Transient Entanglement Coupling for DNA Sep- aration by Capillary Electrophoresis in Ultradilute Polymer Solutions. Electrophoresis, 1994; 15:597.
    • References 2 8 7 12. Takagi, T. Capillary Electrophoresis in the Presence of Sodium Dodecyl Sulfate and a Sieving Medium. Electrophoresis, 1997; 18:2239. 13. Westheimer, R., Barnes, N., Gronau-Czybalka, Habeck, C, Electrophoresis in Practice: A Guide to Methods and Applications ofDNA and Protein Separations, 2nd ed. 1997, Wiley. 350. 14. Righetti, R G., Isoelectric Focusing: Theory, Methodology and Applications. Laboratory Tech- niques in Biochemistry and Molecular Biology, Eds. T. S. Work and R. H. Burdon. 1983, Else- vier Biomedical Press, p. 163. 15. Cohen, A. S., Najarian, D. R., Karger, B. L. Separation and Analysis of DNA Sequence Reac- tion Products by Capillary Gel Electrophoresis. J. Chromatogr, 1990; 516:49. 16. Zagursky, R. J., McCormick, R. M. DNA Sequencing Separations in Capillary Gels on a Mod- ified Commercial DNA Sequencing Instrument. BioTechniques, 1990; 9:74. 17. Yin, H. E, Lux, J. A., Schomburg, G. Production of Polyacrylamide Gel Filled Capillaries for Capillary Gel Electrophoresis (CGE): Influence of Capillary Surface Pretreatment on Perfor- mance and Stabihty HRC & CC, 1990; 13:624. 18. Paulus, A., Ohms, J. L. Analysis of Oligonucleotides by Capillary Gel Electrophoresis. J. Chro- matogr, 1990; 507:113. 19. Liu, J., Dolnik, V, Hsieh, Y.-Z., Novotny, M. Experimental Evaluation of the Separation Effi- ciency in Capillary Electrophoresis Using Open Tubular and Gel-Filled Columns. Anal. Chem., 1992; 64:1328. 20. Paulus, A., Gassman, E., Field, M. J. Calibration of Polyacrylamide Gel Columns for the Sep- aration of Oligonucleotides by Capillary Electrophoresis. Electrophoresis, 1990; 11:702. 21. Baba, Y., Matsuura, T., Wakamoto, K., Tsuhako, M. Comparison of High-Performance Liquid Chromatography with Capillary Gel Electrophoresis in Single-Base Resolution of Polynu- cleotides. J. Chromatogr., 1991; 558:273. 22. Lux, J. A., Yin, H. E, Schomberg, G. A Simple Method for the Production of Gel-Filled Cap- illaries for Capillary Gel Electrophoresis. HRC & CC, 1990; 13:436. 23. Chen, N., Wu, L., Palm, A., Srichaiyo, T., Hjerten, S. High-Performance Field Inversion Cap- illary Electrophoresis of 0.1-23 kbp DNA Fragments with Low-Gelling, Replaceable Agarose Gels. Electrophoresis, 1996; 17:1443. 24. Palm, A., Hjerten, S. The Resolution of DNA Fragments in Capillary Electrophoresis in Replaceable Agarose Gels. J. Capillary Electrophor, 1996; 3:173. 25. Siles, B. A., Anderson, D. E., Buchanan, N. S., Warder, M. F. The Characterization of Com- posite Agarose/Hydroxyethylcellulose Matrixes for the Separation of DNA Fragments Using Capillary Electrophoresis. Electrophoresis, 1997; 18:1980. 26. Hjerten, S., Valtcheva, L., Elenbring, K., Eaker, D. High-Performance Electrophoresis of Acidic and Basic Low-Molecular Weight Compounds and of Proteins in the Presence of Polymers and Neutral Surfactants. J. Liq. Chromatogr, 1989; 12:2471. 27. Zhu, M., Hansen, D. L., Burd, S., Gannon, E Factors Affecting Free Zone Electrophoresis and Isoelectric Focusing in Capillary Electrophoresis. J. Chromatogr, 1989; 480:311. 28. Grossman, P. D., Soane, D. S. Capillary Electrophoresis of DNA in Entangled Polymer Solu- tions. J. Chromatogr, 1991; 559:257. 29. Schwartz, H. E., Ulfelder, K., Sunzeri, EJ., Busch, M. P, Brownlee, R. G. Analysis of DNA Restric- tion Fragments and Polymerase Chain Reaction Products towards Detection of the AIDS (HIV- 1) Virus in Blood. J. Chromatogr., 1991; 559:267. 30. MacCrehan, W. A., Rasmussen, H. T., Morthrop, D. M. Size-Selective Capillary Electrophore- sis (SSCE) Separation of DNA Fragments. J. Liq. Chromatogr, 1992; 15:1063. 31. Ganzler, K., Greve, K., Cohen, A. S., Karger, B. L., Guttman, A., Cooke, N. C. High Perfor- mance Capillary Electrophoresis of SDS-Protein Complexes Using UV Transparent Separat- ing Polymer Networks. Anal. Chem., 1992; 64:2665. 32. Dolnik, V, Novotny, M. Capillary Electrophoresis of DNA Fragments in Entangled Polymer Solutions: A Study of Separation Variables. J. Microcolumn Sep., 1992; 4:515.
    • 288 Chapter 6 Size Separations in Capillary Gels and Polymer Networks 33. Izumi, T., Yamaguchi, M., Yoneda, K., Isobe, X, Okuyama, T., Shinoda, T. Use of Glucomannan for the Separation of DNA Fragments by Capillary Electrophoresis.J. Chromatogr., 1993; 652:41. 34. Grossman, P. D., Soane, D. S. Experimental and Theoretical Studies of DNA Separations by Capillary Electrophoresis in Entangled Polymer Solutions. Biopolymers, 1991; 31:1221. 35. Baba, Y, Ishimaru, N., Samata, K., Tsuhako, M. High-Resolution Separation of DNA Restric- tion Fragments by Capillary Electrophoresis in Cellulose Derivative Solutions. J. Chromatogr., A, 1993; 653:329. 36. Roed, L., Arsky, 1., Lundanes, E., Greibrokk, T. Rapid and Reproducible Capillary Elec- trophoretic Separation of Double-Stranded DNA Fragments in a Simple Methylcellulose Siev- ing System. Chromatographia, 1998; 47:125. 37. Heiger, D. N., Cohen, A. S., Karger, B. L. Separation of DNA Restriction Fragments by High Performance Capillary Electrophoresis with Low and Zero Crosslinked Polyacrylamide Using Continuous and Pulsed Electric Fields. J. Chromatogr., 1990; 516:33. 38. Guttman, A., Shieh, P, Lindahl, J., Cooke, N. Capillary Sodium Dodecyl Sulfate Gel Elec- trophoresis of Proteins. II. On the Ferguson Method in Polyethylene Oxide Gels. J. Chro- matogr, A, 1994; 676:227. 39. Gao, Q., Yeung, E. S. A Matrix for DNA Separations. Genotyping and Sequencing Using Poly(vinylpyrrolidone) Solution in Uncoated Capillaries. Anal. Chem., 1998; 70:1383. 40. Wu, C, Liu, T., Chu, B. A New Separation Medium for DNA Capillary Electrophoresis: Self- Assembly Behavior of Pluronic Polyol EggP^gEgg in Ix Buffer. J. Non-Cryst. Solids, 1998; 235- 237:605. 41. Liu, Y, Locke, B. R., Van Winkle, D. H., Rill, R. L. Optimizing Capillary Gel Electrophoretic Separations of Oligonucleotides in Liquid Crystalline Pluronic F127. J. Chromatogr, A, 1998; 817:367. 42. Nakatani, M., Shibukawa, A., Nakagawa, T. Separation Mechanism of Pullulan Solution-Filled Capillary Electrophoresis of Sodium Dodecyl Sulfate-Proteins. Electrophoresis, 1996; 17:1584. 43. Ruiz-Martinez, M. C, Salas-Solano, O., Carrilho, E., Kolter, L., Karger, B. L. A Sample Purifi- cation Method for Rugged and High-Performance DNA Sequencing by Capillary Elec- trophoresis Using Replaceable Polymer Solutions. A. Development of the Cleanup Protocol. Anal. Chem., 1998; 70:1516. 44. Nathakamkitool, S., Oefner, R J., Bartsch, G., Chin, M. A., Bonn, G. K. High-Resolution Cap- illary Electrophoretic Analysis of DNA in Free Solution. Electrophoresis, 1992; 13:18. 45. Strege, M., Lagu, A. Separation of DNA Restriction Fragments by Capillary Electrophoresis Using Coated Fused Silica Capillaries. Anal. Chem., 1991; 63:1233. 46. Isenberg, A. R., Allem, R. O., Keys, K. M., Smerick, J. B., Budowle, B., McCord, B. R. Analy- sis of Two Multiplexed Short Tandem Repeat Systems Using Capillary Electrophoresis with Multiwavelength Fluorescence Detection. Electrophoresis, 1998; 19:94. 47. Mansfield, E. S., Robertson, J. M., Vainer, M., Isenberg, A. R., Frazier, R. R., Ferguson, K., Chow, S., Harris, D. W, Barker, D. L., Gill, R D., Budowle, B., McCord, B. R. Analysis of Mul- tiplexed Short Tandem Repeat (STR) Systems Using Capillary Array Electrophoresis. Elec- trophoresis, 1998; 19:101. 48. Salas-Solano, O., Carrilho, E., Kolter, L., Miller, A. W, Goetzinger, W, Sosic, Z., Karger, B. L. Routine DNA Sequencing of 1000 Bases in Less than One Hour by Capillary Electrophoresis with Replaceable Linear Polyacrylamide Solutions. Anal. Chem., 1998; 70:3996. 49. Karger, B. L. Advances in DNA Analysis by Capillary Array Electrophoresis: Sequencing and Frac- tion Collection, presented at HPCE '99, Palm Springs, CA. HPCE'99. 1999. 50. Gelfi, C, Perego, M., Morelh, S., Nicolin, A., Righetti, P G. Analysis of Antisense Oligonu- cleotides by Capillary Electrophoresis, Gel-Slab Electrophoresis and HPLC: A Comparison. Antisense Res. Dev., 1996; 6:47. 51. Hebenbrock, K., Wilhams, P M., Karger, B. L. Single Strand Conformational Polymorphism Using Capillary Electrophoresis with Two-Dye Laser-Induced Fluorescence Detection. Elec- trophoresis, 1995; 16:1429.
    • References 289 52. Maschke, H. E., Frenz, J., Belenkii, A., Karger, B. L., Hancock, W. S. Ultrasensitive Plasmid Mapping by High Performance Capillary Electrophoresis. Electrophoresis, 1993; 14:509. 53. Zhang, Y., Lee, H. K., Li, S. E Y. Separation of Myoglobin Molecular Mass Markers Using Non- gel Sieving Capillary Electrophoresis. J. Chromatogr, A, 1996; 744:249. 54. Stefansson, M., Sudor, J., Hong, M., Chmelikova, J., Chmelik, J., Novotny, M. V. Aminodex- tran as a Migration Moderator in Capillary Gel Electrophoresis of Charged Polysaccharides. Anal. Chem., 1997; 69:3846. 55. Zhang, N., Yeung, E. S. Simultaneous Separation and Genetic Typing of Four Short Tandem Repeat Loci by Capillary Electrophoresis. J. Chromatogr, A, 1997; 768:135. 56. Madabhushi, R. S., Vainer, M., Dolnik, V, Enad, S., Barker, D. L., Harris, D. W., Mansfield, E. S. Versatile Low-Viscosity Sieving Matrixes for Non-denaturing DNA Separations Using Cap- illary Array Electrophoresis. Electrophoresis, 1997; 18:104. 57. Chang, H. T., Yeung, E. S. Poly(ethyleneoxide) for High-Resolution and High-Speed Separa- tion of DNA by Capillary Electrophoresis. J. Chromatogr, B: Biomed. Appl, 1995; 669:113. 58. Guttman, A., Shieh, P, Hoang, D., Horvath, J., Cooke, N. Effect of Operational Variables on the Separation of Proteins by Capillary Sodium Dodecyl Sulfate-Gel Electrophoresis. Elec- trophoresis, 1994; 15:221. 59. Simo-Alfonso, E., Conti, M., Gelfi, C, Righetti, P G. Sodium Dodecyl Sulfate Capillary Elec- trophoresis of Proteins in Entangled Solutions of Poly(vinyl alcohol). J. Chromatogr, A, 1995; 689:85. 60. Guttman, A., Cooke, N. Capillary Gel Affinity Electrophoresis of DNA Fragments. Anal. Chem., 1991; 63:2038. 61. Schwartz, H. E., Ulfelder, K. J. Capillary Electrophoresis with Laser-Induced Fluorescence Detection of PCR Fragments Using Thiazole Orange. Anal. Chem., 1992; 64:1737. 62. Evens, M. D., Wolfe, J. T., Perrett, D., Lunec, J., Herbert, K. E. Analysis of Internucleosomal DNA Fragmentation in Apoptotic Thermocytes by Dynamic Sieving Capillary Electrophore- sis. J. Chromatogr, A, 1995; 700:151. 63. Kim, Y, Morris, M. D. Separation of Nucleic Acids by Capillary Electrophoresis in Cellulose Solutions with Mono- and Bis-Intercalating Dyes. Anal. Chem., 1994; 66:1168. 64. Carrera, P, Barbieri, A. M., Ferrari, M., Righetti, P G., Perego, M., Gelfi, C. Rapid Detection of 21-Hydroxylase Deficiency Mutations by Allele-Specific In Vitro Amplification and Capil- lary Zone Electrophoresis. Clin. Chem., 1997; 43:2121. 65. McCord, B. R., McClure, D. L., Jung, J. M. Capillary Electrophoresis of Polymerase Chain Reaction-Amplified DNA Using Fluorescence Detection with an Intercalating Dye. J. Chro- matogr, 1993; 652:75. 66. Berka, J., Pariat, Y E, O., M., Hebenbrock, K., Heiger, D. N., Foret, E, Karger, B. L. Sequence Dependent Migration Behavior of Double-Stranded DNA in Capillary Electrophoresis. Elec- trophoresis, 1995; 16:377. 67. Swaile, D. E, Sepaniak, M. J. Laser-Based Fluorimetric Detection Schemes for the Analysis of Proteins by Capillary Zone Electrophoresis. J. Liq. Chromatogr, 1991; 14:869. 68. Weinberger, R. Separations Solutions. Amer Lab., 1999; 31:31(20)69. 69. Saevels, J., Van Schepdael, A., Hoogmartens, J. Phosphodiesterase Susceptibility of Modified Oligonucleotides Studied in an Integrated Capillary Electrophoresis System. J. Capillary Elec- trophor, 1997; 4:167. 70. Chen, S.-H., Tzeng, R.-T. Polymer Solution-Filled Column for the Analysis of Antisense Phos- phorothioates by Capillary Electrophoresis. Electrophoresis, 1999; 20:in press. 71. Guszczynski, T., Pulyaeva, H., Tietz, D., Garner, M. M., Chramback, A. Capillary Zone Elec- trophoresis of Large DNA. Electrophoresis, 1993; 14:523. 72. Menchen, S., Johnson, B., Winnik, M. A., Xu, B. Flowable Networks as DNA Sequencing Media in Capillary Columns. Electrophoresis, 1996; 17:1451. 73. Tan, H., Yeung, E. S. Integrated Online System for DNA Sequencing by Capillary Elec- trophoresis: From Template to Called Bases. Anal. Chem., 1997; 69:664.
    • 290 Chapter 6 Size Separations in Capillary Gels and Polymer Networks 74. Carrilho, E., Ruiz-Martinez, M. C, Berka, J., Smirnov, I., Goetzinger, W, Miller, A. W, Brady, D., Karger, B. L. Rapid DNA Sequencing of More than 1000 Bases per Run by Capillary Elec- trophoresis Using Replaceable Linear Polyacrylamide Solutions. Anal. Chem., 1996; 68:3305. 75. Kim, Y., Yeung, E. S. Separation of DNA Sequencing Fragments up to 1000 Bases by Using PolyCethylene Oxide)-Filled Capillaries. J. Chromatogr., A, 1997; 781:315. 76. Katsuragi, K., Kitagishi, K., Mizuguchi, T., Nagashima, T., Kinoshita, M., Kumada, H. Method for Detection of Epsilon-Secondary Structure in the Precore Region of Human Hepatitis B Virus DNA Using a Fluorescence-Based Polymerase Chain Reaction-Single-Strand-Conformation Polymorphism Technique with Capillary Electrophoresis. J. Chromatogr., A, 1997; 781:307. 77. Lehmann, R., Koch, M., Pfohl, M., Voelter, W, Haring, H.-U., Liebich, H. M. Screening and Identification of Familial Defective Apolipoprotein B-lOO in CHnical Samples by Capillary Gel Electrophoresis. J. Chromatogr, A, 1996; 744:187. 78. Barta, C, Sasvari-Szekely M., Guttman, A. Simultaneous Analysis of Various Mutations on the 21-Hydroxylase Gene by Multi-allele Specific Amplification and Capillary Gel Elec- trophoresis. J. Chromatogr, A, 1998; 817:281. 79. Chen, J. W., Cohen, A. S., Karger, B. L. Identification of DNA Molecules by Pre-column Hybridization Using Capillary Electrophoresis. J. Chromatogr, 1991; 559:295. 80. Mansfield, E. S., Vainer, M., Harris, D. W, Gasparini, P, Estivill, X., Surrey S., Fortina, P Rapid Sizing of Polymorphic Microsatellite Markers by Capillary Array Electrophoresis. J. Chro- matogr, A, 1997; 781:295. 81. Cordier, Y., Roch, O., Cordier, R, Bischoff, R. Capillary Gel Electrophoresis of Oligonu- cleotides: Prediction of Migration Times Using Base-Specific Migration Coefficients. J. Chro- matogr, A, 1994; 680:479. 82. Hammond, R. W, Oana, H., Schwinefus, J. J., Bonadio, J., Levy, R. J., Morris, M. D. Capillary Electrophoresis of Supercoiled and Linear DNA in Dilute Hyrdoxyethyl Cellulose Solution. Anal. Chem., 1997; 69:1192. 83. Rill, R. L., Liu, Y., Van Winkle, D. H., Locke, B. R. Pluoronic Copolymer Liquid Crystals: Unique Replaceable Media for Capillary Gel Electrophoresis.J. Chromatogr, A, 1998; 817:287. 84. Tsuji, K. High-Performance Capillary Electrophoresis of Proteins. Sodium Dodecyl Sul- phate-Polyacrylamide Gel-Filled Capillary Column for the Determination of Recombinant Biotechnology-Derived Proteins. J. Chromatogr, 1991; 550:823. 85. Kleemiss, M. H., Gilges, M., Schomburg, G. Capillary Electrophoresis of DNA Restriction Fragments with Solutions of Entangled Polymers. Electrophoresis, 1993; 14:515. 86. McGregor, D. A., Yeung, E. S. Detection of DNA Fragments Separated by Capillary Electrophoresis Based on Their Native Fluorescence inside a Sheath Flow. J. Chromatogr, A, 1994; 680:491. 87. Katsivela, E., Hofle, M. G. Low-Molecular-Mass RNA Fingerprinting of Bacteria by Capillary Electrophoresis Using Entangled Polymer Solutions. J. Chromatogr, A, 1995; 717:91. 88. Stanta, G., Bonin, S. RNA Quantitative Analysis from Fixed and Parraffin-Embedded Tissues: Membrane Hybridization and Capillary Electrophoresis. BioTechniques, 1998; 24:271. 89. Wang, Y, Ju, J., Carpenter, B. A., Atherton, J. M., Sensabaugh, G. E, Mathies, R. A. Rapid Siz- ing of Short Tandem Repeat Alleles Using Capillary Array Electrophoresis and Energy-Trans- fer Fluorescent Primers. Anal. Chem., 1995; 67:1197. 90. Butler, J. M., McCord, B. R., Jung, J. M., Wilson, M. R., Budowle, B., Allen, R. O. Quantita- tion of Polymerase Chain Reaction Products by Capillary Electrophoresis Using Laser Fluo- rescence. J. Chromatogr B: Biomed. Appl, 1994; 658:271. 91. Maier, M., Fritz, H., Gerster, M., Schewitz, J., Bayer, E. Quantitation of Phosphorothioate Oligonucleotides in Human Blood Plasma Using a Nanoparticle-Based Method for Solid-Phase Extraction. Anal. Chem., 1998; 70:2197. 92. Dunn, M. J. Electrophoresis in Polyacrylamide Gels, in New Directions in Electrophoretic Meth- ods, Eds. J. W Jorgenson and M. Phillips. 1987, American Chemical Society. 20. 93. Guttman, A., Nolan, J. Comparison of the Separation of Proteins by Sodium Dodecyl Sul- fate-Slab Gel Electrophoresis and Capillary Sodium Dodecyl Sulfate-Gel Electrophoresis. Anal. Biochem., 1994; 221:285.
    • References 291 94. Wise, E. T., Singh, N., Hogan, B. L. Argon-Laser-Induced Fluorescence Detection in Sodium Dode- cyl Sulfate-Capillary Gel Electrophoretic Separations of Proteins.J. Chromatogr, A, 1996; 746:109. 95. Gump, E. L., Monnig, C. A. Pre-column Derivatization of Proteins to Enhance Detection Sen- sitivity for Sodium Dodecyl Sulfate Non-gel Sieving Capillary Electrophoresis.J. Chromatogr., A, 1995; 715:167. 96. Liu, J., Abid, S., Lee, M. S. Analysis of Monoclonal Antibody Chimeric BR96-Doxorubicin Immunoconjugate by Sodium Dodecyl Sulfate-Capillary Gel Electrophoresis with Ultravio- let and Laser-Induced Fluorescence Detection. Anal. Biochem., 1995; 229:221. 97. Zhu, M., Levi, V, Wehr, T. Size-Based Separations of Native Proteins and SDS-Protein Com- plexes Using Nongel Sieving Capillary Electrophoresis. Amer. Biotech. Lah., 1993; 11:26. 98. Guttman, A., Nelson, R. J., Cooke, N. Prediction of Migration Behavior of Oligonucleotides in Capillary Gel Electrophoresis. J. Chromatogr., 1992; 593:297. 99. Cohen, A. S., Najarian, D. R., Paulus, A., Guttman, A., Smith, J. A., Karger, B. L. Rapid Sepa- ration and Purification of Oligonucleotides by High-Performance Capillary Gel Elec- trophoresis. Proc. Natl. Acad. Set, 1988; 85:9660. 100. Guttman, A., Cohen, A. S., Heiger, D. N., Karger, B. L. Analytical and Micropreparative Ultra- high Resolution of Oligonucleotides by Polacrylamide Gel High-Performance Capillary Elec- trophoresis. Anal. Chem., 1990; 62:137. 101. Dubrow, R. S. Analysis of Synthetic Oligonucleotide Purity by Capillary Gel Electrophoresis. American Lah, 1991; March:64. 102. Yin, H.-E, Kleemis, M. H., Lux,J. A., Schomburg, G. Diffusion Coefficients of Oligonucleotides in Capillary Gel Electrophoresis. J. Microcolumn Sep., 1991; 3:331. 103. Newman, A. R. The Human Genome Initiative: First Steps. Anal. Chem., 1990; 62:1260. 104. Mapping and Sequencing the Human Genome. http:www.ornl.gov/TechResourcesMummij3enome/piMicat/primer/pnrn2.html, 1999; 105. Klepernik, K., Foret, E, Berka, J., Goetzinger, W, Miller, A. W, Karger, B. L. The Use of Ele- vated Column Temperature to Extend DNA Sequencing Read Lengths in Capillary Elec- trophoresis with Replaceable Polymer Matrices. Electrophoresis, 1996; 17:1860. 106. Salas-Solano, O., Ruiz-Martinez, M. C, Carrilho, E., Kolter, L., Karger, B. L. A Sample Purifi- cation Method for Rugged and High-Performance DNA Sequencing by Capillary Elec- trophoresis Using Replaceable Polymer Solutions. B. Quantitative Determination of the Role of Sample Matrix Components on Sequencing Analysis. Anal. Chem., 1998; 70:1528. 107. Williams, P E., Marino, M. A., Del Rio, S. A., Turni, L. A., Devaney J. M. Analysis of DNA Restriction Fragments and Polymerase Chain Reaction Products by Capillary Electrophore- sis. J. Chromatogr, A, 1994; 680:525. 108. Deforce, D. L. D., Millecamps, R. E. M., Van Hoofstat, D., Van den Eeckhout, E. G. Compar- ison of Slab Gel Electrophoresis and Capillary Electrophoresis for the Detection of the Fluo- rescently Labeled Polymerase Chain Reaction Products of Short Tandem Repeats. J. Chromatogr, A, 1998; 806:149. 109. Dimo-Simonin, N., Grange, E, Kratzer, A., Brandt-Casadevall, C, Mangrin, P Forensic Vali- dation of the Short Tandem Repeat HUMACTBP2 Using Capillary Electrophoresis. Elec- trophoresis, 1998; 19:256. 110. Lazaruk, K., Walsh, P S., Oaks, E, Gilbert, D., Rosenblum, B. B., Menchen, S., Scheibler, D., Wenz, H. M., Holt, C, Wallin, J. Genotyping of Forensic Short Tandem Repeat (STR) Systems Based on Sizing Precision in a Capillary Electrophoresis Instrument. Electrophoresis, 1998; 19:86. HI. Mansfield, E. S., Vainer, M., Enad, S., Barker, D. L., Harris, D., Rappaport, E., Fortina, P Sen- sitivity, Reproducibility, and Accuracy in Short Tandem Repeat Genotyping Using Capillary Array Electrophoresis. Genome Res., 1996; 6:893. 112. Vainer, M., Enad, S., Dolnik, V, Xu, D., Bashkin, J., Marsh, M., Tu, O., Harris, D. W, Barker, D. L. Short Tandem Repeat Typing by Capillary Array Electrophoresis: Comparison of Sizing Accuracy and Precision Using Different Buffer Systems. Genomics, 1997; 41:1. 113. Moxon, E. R., Wills, C. DNA MicrosateUites: Agents of Evolution. Scientific Amer, 1999; 280:94.
    • 292 Chapter 6 Size Separations in Capillary Gels and Polymer Networks 114. Woolley, A. T., Hadley D., Landre, P., deMello, A. J., Mathies, R. A. Functional Integration of PCR Amplification and Capillary Electrophoresis in a Microfabricated DNA Analysis Device. Anal. Chem., 1996; 68:4081. 115. Mitchelson, K. R., Cheng, J. Point Mutation Screening by High-Performance Capillary Elec- trophoresis. J. Capillary Electrophor., 1995; 2:137. 116. Kuypers, A. W. H. M., Willems, P M. W, van der Schans, M. J., Linssen, P C M . , Wessels, H. M. C, de Bruijn, C. H. M. M., Everaerts, E M., Mensink, E.J. B. M. Detection of Point Muta- tions in DNA Using Capillary Electrophoresis in a Polymer Network. J. Chromatogr., B: Bio- med.Appl, 1993; 621:149. 117. Baba, Y. Analysis of Disease-Causing Genes and DNA-Based Drugs by Capillary Elec- trophoresis. Towards DNA Diagnosis and Gene Therapy for Human Diseases. J. Chromatogr., B: Biomed. Appl, 1996; 687:271. 118. Cheng, J., Kasuga, T., Mitchelson, K. R., Lightly E. R., Watson, N. D., Martin, W. J., Atkin- son, D. Polymerase Chain Reaction Heteroduplex Polymorphism Analysis by Entangled Solu- tion Capillary Electrophoresis. J. Chromatogr, A, 1994; 677:169. 119. Khrapko, K., Hanekamp, J. S., Thilly W. G., Belenkii, A., Foret, E, Karger, B. L. Constant Denaturant Capillary Electrophoresis (CDCE): A High Resolution Approach to Mutational Analysis. Nucleic Acids Res., 1994; 22:364. 120. Khrapko, K., CoUer, H., Thilly, W. Efficiency of Separation of DNA Mutations by Constant Denaturant Capillary Electrophoresis Is Controlled by the Kinetics of DNA Melting Equilib- rium. Electrophoresis, 1996; 17:1867. 121. Nackerdien, Z., Morris, S., Choquette, S., Ramos, B., Atha, D. Analysis of Laser-Induced Plas- mid DNA Photolysis by Capillary Electrophoresis. J. Chromatogr, B: Biomed. Appl, 1996; 683:91. 122. Courtney, B. C, Williams, K. C, Bing, Q. A., Schlager, J. J. Capillary Gel Electrophoresis as a Method to Determine Ligation Efficiency Anal. Biochem., 1995; 228:281. 123. Mao, D. T., Yu, L., Lautamo, M. A. High Resolution CE Separation of Supercoiled Plasmid DNAs and Their Conjormers in Dilute Polymer Solutions Containing No Intercalator, presented at the Frederick Conference on Capillary Electrophoresis. 1997. 124. SkeidsvoU, J., Ueland, P M. Analysis of RNA by Capillary Electrophoresis. Electrophoresis, 1996; 17:1512. 125. Borson, N. D., Strausbauch, M. A., Wettstein, R J., Oda, R. P, Johnston, S. L., Landers, J. P Direct Quantitation of RNA Transcripts by Competitive Single-Tube RT-PCR and Capillary Electrophoresis. BioTechniques, 1998; 25:130. 126. Guttman, A., Wanders, B., Cooke, N. Enhanced Separation of DNA Restriction Fragments by Capillary Gel Electrophoresis Using Field Strength Gradients. Anal. Chem., 1992; 64:2348. 127. Kim, Y, Yeung, E. S. DNA Sequencing with Pulsed-Field Capillary Electrophoresis in Poly(eth- ylene oxide) Matrix. Electrophoresis, 1997; 18:2901. 128. Kim, Y., Morris, M. D. Ultrafast High Resolution Separation of Large DNA Fragments by Pulsed-Field Capillary Electrophoresis. Electrophoresis, 1996; 152. 129. Ueda, M., Oana, H., Baba, Y, Doi, M., Yoshikawa, K. Electrophoresis of Long DNA Molecules in Linear Polyacrylamide Solutions. Biophys. Chem., 1998; 71:111. 130. Anand, R., Southern, E. M. Pulsed Field Gel Electrophoresis, in Gel Electrophoresis of Nucleic Acids: A Practical Approach, Eds. D. Rickwood and B. D. Hames. 1990, IRL Press. 101.
    • CHAPTER 7 Capillary Electrochromatography 7.1 Introduction 7.2 Modes of CEC 7.3 Electroosmotic Flow in CEC 7.4 Efficiency of CEC 7.5 Operating Characteristics of Packed CEC 7.6 Applications 7.7 CEC Microfluidic Devices References 7.1 INTRODUCTION At HPCE'95, the Seventh International Symposium on Capillary Electrophore- sis, the Hewlett-Packard Corporation sponsored a workshop on capillary elec- trochromatography (CEC). A 15' X 25' room was reserved for the workshop. When 400 conferees appeared, two things became obvious: 1. A larger room was needed. 2. Separation scientists were intrigued or at least curious by the potential of CEC. To quote Professor Csaba Horvath, "We are back to doing chro- matography again." Technological advances over the last century have governed the means of dri- ving the mobile phase in chromatographic separations. Classical column chro- matography relied on gravity, paper and thin-layer chromatography employed capillary action, HPLC used hydraulic pressure, and finally, MECC and CEC depend on the EOF to drive the mobile phase (1). The first report describing CEC appeared in 1974, when Pretorius et al. (2) demonstrated the possibility of using the EOF to drive methanol.water 293
    • 294 Chapter 7 Capillary Electrochromatography through a 1-mm glass tube packed with 75-125 JLiin octane-coated Partisil. In this pre-Jorgenson era paper, the lack of injection and detection mech- anisms prevented actual separations from being performed, but a concept was born. In 1981, Jorgenson and Lukacs (3) produced an electrically driven separa- tion of 9-methylanthracene from perylene in a 170-|Llm-i.d. Pyrex tube packed with 10-|im Ci8 particles. The separation efficiencies were modest—for exam- ple, 31,000 theoretical plates for perylene—and the authors said that "the per- formance of these columns appears to offer a modest improvement over conventional [pressure-driven] flow, but may not justify the increased difficulty in working with electroosmotic flow." Despite the early difficulties, the prospects for employing an electroosmotic pumping system for liquid chromatography are tantalizing. The characteristics of EOF have three potential advantages over pressurized flow: 1. The facile generation of very low flow rates. The need for such low flows is established in Table 7.1, both for packed and for open tubular capil- laries. Generation of EOF-pumped low flow rates is simple and can be controlled by selection of the packing material, the mobile phase, and the applied electric field. 2. The plug flow characteristics of the electrodriven system should prove advantageous compared with the laminar profile of the pressure-driven system (Section 2.3). 3. The EOF-driven system operates at atmospheric pressure and is pulse- free, an advantage when interfaced to the mass spectrometer. The distinguishing feature separating electrophoresis from chromatography is retention. In HPLC, retention is the driving force for separation. In HPCE, Table 7.1 Column Diameters and Nominal Flow Rates for LC and CEC Category Column i.d. Nominal Flow Rate (pL/min) Analytical LC Small bore LC Micro bore LC Packed capillary LC Packed capillary CEC Open tubular LC Open tubular CEC Open tubular CEC Open tubular CEC 4.6 mm 2.0 mm 1.0 mm 350 pm 170 pm 50 pm 25 pm 10 pm 5 pm 1000 189 47 5.8 1.4 0.12 0.029 0.0047 0.0012
    • 7.2 Modes of CEC 2 9 5 retention must be avoided at all costs, or the theoretical maximum efficiency as predicted by Eq. (2.15) will never be obtained. Retention in CEC is based on solute partitioning between the mobile and stationary phases. Charged solutes can also migrate via electrophoresis as well providing a multimechanistic retention scheme. In Chapter 4, the use of sec- ondary equilibrium with micelles and/or cyclodextrins (CDs) for separation of neutral or charged molecules was described. The advantages CEC over MECC are: 1. Much of the vast HPLC literature may be applicable to CEC. 2. Interface to the mass spectrometer is more robust due to the absence of surfactant. 3. Sensitivity in laser fluorescence is improved due to the lower reagent background. 4. The ability to easily separate water-insoluble compounds. 5. The injection solvent is compatible with the mobile phase when sepa- rating hydrophobic solutes. 6. High loading capacity compared with that of CZE. On the other hand, MECC has some significant advantages over CEC. These include: 1. The ability to use inexpensive and rugged bare silica capillaries. 2. Rapid equilibration of the capillary. 3. Powerful tools for the adjustment of selectivity. 7.2 MODES OF CEC The are three major classes of CEC: open tubular, packed capillary, and CEC with replaceable media. A. OPEN TUBULAR CEC The use of a capillary coated with a stationary phase was reported in 1982 by Tsuda et al. (4). The immediate advantage of the open tubular format is the rel- ative ease of manufacture of the capillaries. Well-understood surface chemistries can be applied, and frits are unnecessary. Difficulties in packing small-diameter capillaries are avoided as well. Bubble formation, a problem with packed capil- laries, does not occur. Tubing diameters of 5- to 50-|lm i.d. are used. Since solute diffusion to the capillary coating is required for retention, retention and efficiency both increase as the tubing diameter is decreased. On the other hand, detection
    • 296 Chapter 7 Capillary Electrochromatography and loading capacity become problematic as the capillary diameter becomes narrow. In 50-|Lim capillaries, relatively small k' values are found (5), since the solute spends much of its time in the mobile phase. It appears that open tubular CEC works best for charged solutes, since they can electrophorese as well. The purpose of the chromatographic interaction is utilized to affect the selectivity of the separation. Separations for aromatic hydro- carbons were reported using 10-|im capillaries, but the V values were less than 0.2 (6). Better results were found for chiral separations using immobilized cyclodextrins (7, 8), but superior separations are often found when simply adding CDs to the BGE. Separation of the enantiomers of a binaphthyl deriva- tive is shown in Figure 7.1 (8). Capillaries derivatized with Cjg, diol and cholesterol functionality are available from Silicon Valley Separation Media, c/o Dr. J. Pesek, San Jose State University (San Jose, CA). '^-^ JA-JU U- 8 12 16 20 24 FIGURE 7.1 Separation of the enantiomers of l,l'-binaphthyl-2,2'-diyl-hydrogen phosphate at different apphed vokages. Capillary: Chiralsil-Dex, 80 cm effective length x 50 |Lim i.d.; buffer: borate-phosphate, pH 7; detection: UV, 220 nm; temperature: 20°C. Reprinted with permission from J. High Res. Chromatogr., 15, 129 (1992) copyright © 1992 Dr. Alfred Heuthig Publishers.
    • 7.2 Modes of CEC B. PACKED CEC 297 The majority of reported work has employed packed CEC. The advantages of this mode have been described Section 7.1. An illustration of a packed capillary is shown in Figure 7.2. The total migration time t^ is (9) (7.1) V 1 . V packed open where L^ = the length of the capillary to the detector, L^^^cked = the length of the chromatographic packing, L^pen = the unpacked portion of the capillary lead- ing to the detector, Vp^cked = migration velocity through the packing, and ^open = migration velocity in the open segment of the capillary. For neutral solutes, v^^^^ is defined by the EOF On the other hand, charged solutes may show differential migration in the open segment. If this occurs, the open segment may be lengthened to take advantage of this effect. Thus, the com- bination of chromatography and electrophoresis may improve selectivity over what is found in either mode alone (9). Among the disadvantages of CEC are the newness of the technique, prob- lems with the production of capillaries, frit manufacture, bubble formation in the mobile phase, the lack of gradient elution equipment on some instruments, and the tendency of amines to stick to the packing material (10). Some of these issues are being addressed. New instruments from Unimicro Technologies (San Francisco, CA) and Micro-Tech Scientific (Sunnyvale, CA) designed for CEC were introduced at HPCE'99. The ultimate instrument would be a gradient system capable of CZE, CEC, and |i-HPLC. The use of 2 |iL/mL of hexylamine as a mobile-phase additive reduces peak tailing from the interaction of basic compounds with silanols. Meanwhile, this additive only modestly decreases the EOF (11). Detection Window Frit Frit FIGURE 7.2 Diagram of a packed CEC capillary
    • 298 Chapter 7 Capillary Electrochromatography The problem of frits can be addressed by eliminating them. The development of "monolithic" technology permits the immobilization of chromatographic media within the capillary in a fritless environment (12-14). Since the CEC packing has such a large surface area, bubbles tend to form on the packing surface. This problem is minimized by running with both the inlet and outlet pressurized to 10 bar, the so-called "CEC mode." C. CEC WITH REPLACEABLE MEDIA A pumpable entangled polymer solution has been used for separation of neutral solutes using conventional HPCE instrumentation (15). The polymer was com- posed of 40% ethyl acrylate, 50% methacrylic acid, and 10% lauryl methacrylate. Typically, the capillary would be refilled daily, but with the advent of high-pressure instrumentation, the capillary could be refilled prior to each run if necessary. A high- speed separation of polycycHc aromatic hydrocarbons in shown in Figure 7.3 (15). In a related development, separations of small molecules have been demon- strated in 10%T linear polyacrylamide gels (16) as well as in crosslinked gels (17). While these gels were not considered replaceable at the time, the 10%T gel can be replaced at high pressure. While few papers have been published in this field and much work remains, it is easy to envision that this mode of CEC will become important. Consider- FIGURE 7.3 High-speed separation of aromatic hydrocarbons using a replaceable stationary phase. Capillary: 25 cm x 50 |im (total length 33 cm) bare silica filled with 4% polymer; mobile phase: 40% acetonitrile, 10 mM borate, pH 9.2; voltage: 30 kV; injection: 1 kV for 30 s; tempera- ture: 25°C; detection: UV, 200 nm. Key: (1) benzene; (2) unknown; (3) naphthalene; (4) fluorene; (5) anthracene; (6) pyrene; (7) chrysene; (8) benzo(e)pyrene; (9) benzo(ghi)perylene. Redrawn with permission from Anal. Chan., 70, 4985 (1998) copyright © 1998 Am. Chem. Soc.
    • 7.3 Electroosmotic Flow in CEC 299 ing what has happened in the area of size separations, replaceable media have effectively displaced the use of rigid gels. 7.3 ELECTROOSMOTIC FLOW IN CEC In CEC, the EOF drives the mobile phase through the capillary. The generation of EOF in CEC is similar to what was described in Section 2.3, except now the packing material and the capillary wall both contribute to the total flow Since the EOF depends on the free silanols in the column packing, the type of packing is very important. The porosity of the media plays a crucial role here as well. Nonporous packings yield a higher EOF than porous packings of the same particle diameter (1). Table 7.2 lists a variety of chromatographic media along with values for the generated EOF Table 7.2 Electroosmotic Mobilities on Some Chromatographic Materials Stationary Phase Material Electroosmotic Mobility (x 10""^ cmWs) Setl CEC Hypersil Cis 2.26 ODSHypersil 1.47 BDS-ODS Hypersil 0.99 Sperisorb ODS 1 2.26 Sperisorb ODS II 1.79 Set 2 Nucleosil 5 Cig 1-56 LiChromospher RP-18 1.45 Sperisorb Dial 0.80 Zorbax BP-ODS 0.68 Sperisorb 55 ODS2 0.50 Hypersil ODS 0.14 Partisil 5 ODS3 <0.01 Purospher RP-18 <0.01 Data from (18), which consisted of data from (19, 20). Conditions: thiourea used as unretained marker; set 1: 80:20 acetonitrile: Tris-HCl, 50 mM, pH 8, 20°C; set 2: 70:30 acetonitrile: 3-cyclohexylamino-2-hydroxy-l-propane-sulfonic, 25 mM.
    • 3 0 0 Chapter 7 Capillary Electrochromatography The electroosmotic velocity is described by the Smoluchowsi model (1), where riL Here e^ is the permittivity of vacuum, £^ is the dielectric constant of the BGE, ^ is the zeta potential, and 7] is the viscosity These factors are identical to the con- trolling forces in CZE. Changes in temperature, pH, viscosity organic solvents, and ionic strength all affect the EOF This model considers the column in CEC as a bundle of capillaries. In this regard, the magnitude of the EOF would not depend on the particle size, as long "double-layer overlap"^ does not occur. A. EFFECT OF VOLTAGE At field strengths above 100 V/cm, the EOF exhibits a positive deviation from linearity This may be due to Joule heating effects, but it also could result from polarization of the double layer. In this case, the particles become more con- ductive than the surrounding electrolyte (1, 22). In any event, the higher than expected EOF might be advantageous in speeding the separation, although reproducibility might be lost. B. EFFECT OF BUFFER CONCENTRATION The addition of a buffer to the BGE is necessary to adjust pH and maintain elec- trical conductivity, although there has been a report on CEC in salt-free media (23). The zeta potential and, thus, the EOF are inversely proportional to the square root of the buffer concentration. C. EFFECT OF ORGANIC MODIFIER CONCENTRATION In CZE, the organic modifier concentration can alter the EOF based on changes of the viscosity of the BGE. Acetonitrile effects only modest changes in EOF, whereas linear alcohols reduce the EOF as the concentration is increased. In CEC, depending on the experimental conditions, the EOF may increase or decrease as the acetonitrile concentration is raised from 0% to 60% (1). iThis is defined as the overlap of the electrical double layer that gives rise to the EOF. It results in a reduction in EO¥, but this is not observed until the particle size of the packing is well below 1 /im (21).
    • 7.4 Efficiency of CEC 3 0 1 7.4 EFFICIENCY OF CEC In open tubular CEC, two processes contribute to band broadening in capillary chromatography: diffusion and mass transfer in the mobile phase. These con- tributions can be expressed via the Van Deemter equation (24)^ H = 2 ^ + C ^ — , (7.3) where H = height equivalent to a theoretical plate; V = mean linear velocity; Djn = solute diffusion coefficient in the mobile phase; r = the capillary radius; and Cjn = the coefficient of resistance to mass transfer for a solute in the mobile phase. The first term in the equation describes the time-related impact of solute dif- fusion. This term is equivalent for HPLC and CEC. Since there is no packing material in open tubular CEC, the "so-called A" term (see below) of the Van Deemter equation is absent. Also absent from this equation are terms describ- ing mass transport in the stationary phase. This is an unimportant source of band broadening both in HPLC and CEC. Differences between CEC and HPLC are manifested in the mass transfer term in the mobile phase. This function is affected by the cross-sectional flow profile. In pressure-driven systems, the height of the theoretical plate (H) is given by H = l±^^:±ll^. (7.4) 96(1 + k'f In voltage-driven systems, H - ^ ^ . (7.3) 16(1 + k'f These equations can be used to assess the impact of laminar flow in the pres- sure-driven system versus plug flow in the electrodriven case. From this simple analysis, the concepts can be translated to the packed capillary Calculated values based on these equations along with their ratio are plotted versus k' in Figure 7.4. At k' values of greater than 1, the ratio Hpressure/^voitage has a value of 2. This indicates the electrodriven system is only twice as efficient as the pressure-driven system. When k' is less than 0.5, the electrodriven system shows a huge advantage. In this case, the system is functioning close to zero retention, and the efficiencies become more like CZE. Here, the mass transfer contributions ^The letter v is used to define velocity instead of fi. This is to avoid confusion between elec- trophoretic mobility and velocity.
    • 302 Chapter 7 Capillary Electrochromatography H 0.06 0.04 0.02 Press Voltage FIGURE 7.4 Comparison of the height of the theoretical plate for pressure- and electropumped systems versus k'. The graph is based on calculations from Eqs. (7.4) and (7.5). toward band broadening become insignificant, and the laminar flow profile of the pressure pumped system becomes the most significant source of band broadening. In the packed capillary, the Van Deemter equation becomes (25) H = 2Adp 4- ^yD^ 30 r k' ] 2 f J2 (7.6) where A = the tortuosity factor; dp = the particle diameter; y = the obstructive factor for diffusion; v = the migration velocity, and D^^^ = the diffusion in the stagnant mobile phase. The first term of this equation (A term) represents the contribution of flow variation in the column packing. This is otherwise known as eddy diffusion. The further apart adjacent particles are from each other, the larger the inter- particle flow velocity profile. This is illustrated in Figure 7.5. When the elec- trodriven system is considered, the flow profiles are now uniform despite differences in the interparticle distances. Analyzing the relevant mathematics and Van Deemter plots, we find that the reduction of eddy diffusion appears responsible for the improved efficiency of CEC over HPLC (25, 26). Rigorous calculations support the reduction of parabolic flow in CEC from that in HPLC as the factor that improves efficiency (25, 26). Experimental data given in Figure 7.6 further support the modest improvements in efficiency for electropumped systems over pressure-pumped systems under uniform condi- tions. An expansion of the fluorene peak is shown in Figure 7.7. The improve- ments in efficiency are significant but not dramatic. Not considered in this analysis is the upper limit for pumping pressure in HPLC. This limits the length of the column when small particles are employed. In CEC, there is no pressure drop and, thus, no limit to the length of the capil- lary. The impact of column length and particle diameter is shown in Table 7.3.
    • 7.5 Operating Characteristics of Packed CEC 3 0 3 Pmssurt driva Electroendosmotlc drive »»i.Mn»,»^ particle —** ^P™ channel ed > (E velocity profll© M 3 FIGURE 7.5 Diagram of eddy diffusion and flow velocity profiles in HPLC and CEC. Courtesy of Hewlett-Packard Corporation. Using 5-|im particles and a 50-cm capillary, the CEC separation is approximately twice as efficient as capillary HPLC, in agreement with the theoretical prediction. When the particle size is reduced to 3 |im, the HPLC column length can be no longer than 25 cm because of the 400-bar pressure limit. This limits the plate count to 45,000 by HPLC, whereas the CEC separation using a 50-cm capillary yields 170,000 theoretical plates. When L5-|im material is used, the 50-cm CEC capillary yields 250,000 plates, compared with 30,000 plates on a 10-cm HPLC capillary 7.5 OPERATING CHARACTERISTICS OF PACKED CEC A. PREPARATION OF CEC CAPILLARIES While most users will purchase prepacked capillaries, the steps in column preparation are worth considering (27). These are illustrated in Figure 7.8 on p. 306 and described in the following: 1. Prepare a temporary outlit frit by sintering silica gel particles with a microflame torch.
    • 304 chapter 7 Capillary Electrochromatography PRESSURE yjLO 10 ELECTRO 20 30 lyL 10 20 30 TIME (min) 40 FIGURE 7.6 Separation of polycyclic aromatic hydrocarbons on a drawn capillary packed with 3-|Lim Hypersil particles and derivatized in situ with octadecylsilane. Capillary: 90 cm (pressure), 80 cm (electro) x 30 |J.m i.d.; pressure (upper): 25 bar; voltage (lower): 320 V/cm; detection: fluo- rescence. Order of elution: naphthalene, 2-methylanthracene, fluorene, phenanthrene, anthracene, pyrene, and 9-methylanthracene. Reprinted with permission from Chromatographia, 32, 317 (1991) copyright © 1991 Vieweg. 2. Slurry pack the capillary with packing media dispersed in methanol at 350 bar for 3 h. 3. Prepare the permanent outlet frit using a thermal wire stripper. 4. Unpack the capillary by pumping from both ends. 5. Prepare the detector window. 6. Repack the capillary as in step 2. 7. Prepare the inlet frit by gently sintering the particles at the end of the capillary. While there are certainly many variations of this technique, the packing of these capillaries is an art form, and there is a high reject rate. The frit in partic- ular is prone to problems. Frits must retain the chromatographic packing yet be sufficiently porous to allow the passage of solvent. Details of frit production have been described, along with recommendations (28). Frits prepared from
    • 7.5 Operating Characteristics of Packed CEC 305 PRESSURE / / ELECTRICiUXY OraVEN / / DRIVEN 612 600 588 DISTANCE (mm) FIGURE 7.7 Expansion of the fluorene peak from Figure 7.6. Outer curve: pressure-driven chro- matogram; inner curve: electrically driven chromatogram. Reprinted with permission from Chro- matographia, 32, 317 (1991) copyright © 1991 Vieweg. pure spherical silica gel appear best. Since production of frits by sintering destroys the polyimide, the capillary must be carefully handled. Packed capillaries are available from many sources, including Hewlett- Packard, Hypersil, Micro-Tech Scientific, Capital HPLC Ltd., Phase Separations, and Unimicro Technologies, Inc. B. COLUMN EQUILIBRATION The capillary must be flushed with mobile phase prior to use. This can be done with an external HPLC pump, a manual syringe pump,^ or the instrument inter- nal pressure, particularly if a high-pressure mode is available. It may take sev- eral hours to totally condition a capillary. When all air bubbles have left the capillary, it is best to further condition the capillary at low voltage. Alternatively, the capillary may be conditioned by pressurizing the inlet to 10 bar, running a voltage gradient to 25 kV over 30 min, and holding the volt- age at 25 kV for an additional 30 min (29). ^Procedure given in Unimicro Technologies operating instructions. Table 7.3 Achievable Plate Numbers in Capillary HPLC and CEC Particle Size (pm) 5 3 1.5 Capillary Length (cm) 50 25 10 HPLC Plates/Column 55,000 45,000 30,000 Length (cm) 50 50 50 CEC Plates/Column 115,000 170,000 250,000
    • 306 Chapter 7 Capillary Electrochromatography Temporary outlet frit 4 5 3 Outlet frit inlet frit Detector window FIGURE 7.8 Illustration of the processes for frit production and packing of a CEC capillary. C. INJECTION Electrokinetic injection is usually employed in CEC. The mobility discrimina- tion often seen in CZE is less significant in CEC, since the EOF is the driving force for injection. Hydrodynamic injection can also be employed if a high-pres- sure injection mode is available. Since only nanoliters of material must enter the capillary, 8 bar of pressure for 30 s provides a sufficient injection (30). Sample loading is improved by injecting the sample dissolved in a solvent containing more water than the mobile phase (31). In this case, the solutes are retained at the head of the packed capillary and then are eluted by the mobile phase. This increases the loading capacity of the system to the nanogram range. D. CAPILLARY AND MOBILE-PHASE SELECTION Start this process by selecting packings and mobile phases similar to those that have been successful in HPLC. The data given in Table 7.2 should be useful in
    • 7.5 Operating Characteristics of Packed CEC 307 ensuring that a packing material with good EOF characteristics is selected. In addition to C^g material, octyl, phenyl, cyano, and amino reversed-phase mate- rials are available. If specialty phases are required and a packing apparatus is available, a purchased HPLC column will provide a lifetime supply of pack- ing material. Selection of particle sizes of 3 |im or less will yield the most efficient sepa- rations. Using reversed-phase material, select a pH no less that 2.5 (to maintain EOF) nor greater than 9 (to prevent silica dissolution). At pH 2.5, the EOF is 5 to 10 times lower than at pH 7. Use buffers such as Tris, phosphate, borate, and acetate at concentrations from 5 to 25 mM to adjust pH and maintain conductivity. The buffer concen- tration should be optimized, as chromatographic efficiency often improves at higher (25 mM) concentrations. If the buffer concentration is too high. Joule heating may adversely affect the efficiency of the separation. To avoid the pH dependency of the EOF, cation- or anion-exchange packings can be used. A propylsulfonic acid, either by itself or mixed with CIQ material (mixed-mode packing), can provide sufficient EOF, even at acidic pH (30). Acetonitrile is best as a mobile-phase modifier, because unlike methanol, it does not lower the EOF That is always an important consideration when selecting the appropriate modifier. Typical acetonitrile concentrations are 20-80%, depending on the application. Acetonitrile also is more optically transparent than methanol, which can improve detectability Before selecting a solvent other than methanol or acetonitrile, ensure that the material is compatible with the instrument, vials, and vial closures. Methanol can also be used as a mobile-phase modifier when acetonitrile is not appropriate. When using low concentrations of methanol or acetonitrile, the wetting characteristics of the BGE are poor. This can lead to bubble forma- tion, which interrupts the electric circuit. Pressurizing the system with 8-10 bar over both the inlet and outlet vials will minimize bubble formation. The use of low-conductivity buffers such as Tris and MES has also been reported to help suppress bubble formation (32). Another way of suppressing bubble formation is to add small amounts of sur- factants to the system. When using submicellar concentrations of SDS (1-5 mM), bubble formation is suppressed and the EOF may be stabilized (33). In this case, 20% methanol was the modifier. Such a low concentration of modifier permits the SDS to bind to the packing material and modify the stationary phase. At higher modifier concentrations, such binding does not occur, since the organic solvent effectively keeps the SDS off the packing material. Yet another way to suppress bubble formation is to use supplementary |I-HPLC pressurized flow. The application of a voltage to a |I-HPLC separation clearly improves the chromatographic efficiency Another stated advantage is that the sep- aration does not entirely rely on the packing to produce the EOF (34, 35). This approach has been named pressure-driven CEC or electro-HPLC. Since the
    • 308 Chapter 7 Capillary Electrochromatography capillary is coupled to an LC system, the formation of gradients is simpler as well. However, it should be noted that one of the previously cited papers showed supe- rior separations of oligonucleotides using MECC (34). While instruments employing gradient elution arejust being introduced, a step gradient can be designed with almost any commercial instrument (36). The sepa- ration begins with the weaker mobile phase, and after a period of time, the voltage is removed and the inlet and outlet vials replaced with the stronger eluent. After completion of the run, fresh weak solvent is used to reequilibrate the capillary E. VOLTAGE Most instruments function at a maximum voltage of 30 kV Higher voltages will result in rapid analysis, provided Joule heating is insignificant. Use of a 20-cm capillary with 55-kV applied voltage provides an isocratic separation of 16 poly- cyclic aromatic hydrocarbons in 2 min (37). F. DETECTION Postfrit detection is always employed when using UV absorbance detection, since the capillary packing is opaque. Extended path length capillaries can also be used to increase the sensitivity of detection (29). When using LIF detection, on-capillary detection is possible (37). This approach yields the highest chromatographic efficiency (700,000 plates/meter) and indicates that postfrit detection results in band broadening. The absence of micelles in CEC is advantageous with regard to mass spec- trometry (31, 38, 39). Typical mobile phases contain acetonitrile, ammonium acetate (31), or trifluoroacetic (40). A sheath flow of a few microliters per minute is frequently used to provide a stable electrospray, since the flow rate through the column is quite small. Through the use of nanoelectrospray, the sheath fluid becomes unnecessary. Moving closer to cutting edge technology, open tubular CEC has been inter- faced to a time-of-flight instrument via the nanoelectrospray. The advantage of the time-of-flight instrument is that it is nonscanning. In conjunction with an ion trap, which enriches the ions, limits of detection for peptides reach 10"^ M (41). CEC has also been interfaced to a nuclear magnetic resonance spectrometer (42). G. TEMPERATURE As in all other forms of HPCE, temperature control is particularly important. When increasing the capillary temperature from 20°C to 60°C, the retention time %RSD was lowered from 7.3% to 4.3%, and the analysis time was short-
    • 7.6 Applications 309 ened by 45% (43). To keep the current low and aid in the suppression of bub- ble formation, low-temperature operation at 15°C has been recommended (30). 7.6 APPLICATIONS A representative selection of applications and chromatographic conditions is given in Table 7.4. Some other applications of note are described in this section. The open tubular separation of sulfonic acids (Figure 7.9, p. 312) on a 10-|Xm- i.d. capillary coated with 0.9% PS-264 or 10% OV-17 employs an ion-pairing reagent, tetrabutylammonium hydroxide, as a mobile-phase modifier (49). The use of a narrow-bore capillary improved the mass transfer problem in accordance with the second term of Eq. (7.3). Improvements over CZE and pressure-driven LC sep- arations were demonstrated with this ion-pair CEC system. Thus, the chemistry employed in conventional HPLC separations can be used in CEC as well. Separations of the drug Isradipin and its by-products (Figure 7.10, on p. 313) (45) present a good example of a separation with small V values (0.17-0.90). The large number of plates per unit of time is consistent with the theory, which predicts optimal efficiency at small fe' values. In this early work, the retention time precision ranged from 1.6% to 2.2% (run/run) and 9% (capillary/capillary). Production of the narrow-bore packed capillaries proved problematic in this early work and still does. High-speed separations by CEC are best accomplished by maximizing the electric field strength. Since most instruments are incapable of producing greater that 30 ky it is necessary to use short capillaries to provide the high electric field. This is effective when the separations are not too complex. Figure 7.11, on page 314 shows the separation of some aromatic hydrocarbons using 1.5- |lm nonporous ODS particles packed in a 6.5 cm (10 cm total length) X 100 |Xm capillary (37). With the voltage set at 28 kV, the field strength is 2800 V/cm. Above 28 ky arcing between the capillary and the capillary holder was observed. This becomes another limiting factor when using high voltage, since the grounding and shielding within the instrument become most critical. On com- mercial instrumentation, it is usually necessary to use the "short end" of the capillary to produce such a short capillary length (52). Another factor that permitted operation at such a high field strength was the low conductivity of the BGE. With 2 mM Tris in 70% acetonitrile, the current was 6.7 |LiA at 30 kV. An Ohm's law plot showed a 20% deviation from linearity at 20 ky so that this homemade system could use better heat dissipation. Combined with on-capillary LIE detection to minimize dispersion from the frits, the separation time for this simple mixture is less than 5 s. With a peak width of 0.2 s, it is necessary to set the detector time constant to 0.02-0.03 s to minimize band broadening, and the injection size must be kept quite small. Like other forms of HPCE, whenever the peak widths become narrow, all instrumental parameters must be carefully controlled to maintain the inherent efficiency of the separation.
    • 310Chapter7CapillaryElectrochromatography ^ S S ^ ^ ^Q 3V ^^ -o:sQ o PQPQ PQ o X << oo < ___o ONXC»X ^IO^ ^00 in^ K D. in (N < ^in r^ in 1 in 1—t 00 < ^ o(N ^ 2c a, o ^o X u 13. in cyi P O o 'C 3. m ^O O '!73 (U X ro cy^ Q O w X in of Q O (J (/5 o J 3. m do o :3 2 B :2. m 00 u 1/5 ;_;(U X u w u 3- m 2 U Cfl M dJ & X u w u 13. in T3 CO pTi O o >>U U H u^ < 1^ in -TS c o o <J >>u u H LO < u u B 3- o in X B(J in <N la o^ (NO min XX BBCJU ONm ^(N B o in X B in 00 fS B 3-O or—1 X S u 00 ^ B ^in 1^ X BCJ 00 rN B 3- o o1—1 X BCJ in (N B 3- o o X B CJ O in 1 in (N B a o in X BCJ ,—1 (N B 3- o in X BCJ 00 in < ^< IN <u X CJ <uN C3 PQ ^X aC3 c T3 C c« _> -^3 cuN Pi PQ T3^ c3 ^^ <uo ^^g.^ s CD u 3 XJ -T3 <;z Q o 3 o Z-tiC u .2C U
    • 7.6Applications311 B GO 2 o u u U5 tl^ o^ en OJ a o H fl o u <u "S'T3 UH > ^IT) IT) dO CJ <u "STd HH OH < inin .—I00r^I—I o o X2 PHH Sin S s (N << oo O 2 CQH OOs__ in00r^ H s1 ?3 ^1. Q O o o 2 S ^ O O PH a o o bX) PI ^ B3- ro do u 'c75 ^ >-(c« 12 c(U ^o Q O 2 u ^Z£ II II CD O 2 O 3- o o t—I X a a o X a o o r-{ X a X a o o 5 al ino XX aa a o OS o^ 22 o-^S C u (?S ON <u T3 3CO 1 z as PH 3'o o II PQ II <
    • 312 Chapter 7 Capillary Electrochromatography 1H4N 5A2N 4A1N — • % l| iW < i • • • . . i ^ . . l I — . . ^ , . ^ ^ ^ ^ , ^^^ , ^ ^^^ >..4N»f*t»*»»»it«<iJV>J 2A1N 8A2N Time (min) FIGURE 7.9 Electrochromatography of naphthalene sulfonic acids. Capillary: 50 cm x 10 |xm i.d. PS-264 coated; buffer: 10 mM phosphate, pH 7, 1.25 mM tetrabutylammonium hydroxide; volt- age: -21 kV; detection: laser fluorescence. Key: 4A1N, 4-amino-l-naphthalene sulfonic acid; 2A1N, 2-amino-l-naphthalene sulfonic acid; 8A2N, 8-amino-2-naphthalene sulfonic acid; 5A2N, 5-amino- 2-naphthalene sulfonic acid; 1H4N, l-naphthol-4-sulfonic acid. Reprinted with permission from J. Chromatogr., 557, 125 (1991) copyright © 1991 Elsevier Science Publishers. CEC is beginning to have an impact in the field of chiral recognition (35, 53, 54). As an example, a separation of thalidomide enantiomers on an immobi- lized vancomycin chiral stationary phase is shown in Figure 7.12 (55). Van- comycin is a powerful chiral selector. The problem with its use in CZE is its high-UV absorbance. This often requires that special techniques such as partial capillary filling be used (Section 4.9F). In CEC, no such problems occur, since the antibiotic is bound to the capillary wall. While Figure 7.12 shows a non- aqueous separation in the "polar-organic mode," reversed-phase separations work as well but are 30% less efficient. The production of a bound vancomycin column began with packing a diol silica into a 100-|im capillary. The diol was oxidized with sodium periodate. Vancomycin was attached by reductive amination (in 50 mM phosphate, pH 7) with sodium cyanoborohydride followed by reduction of free aldehyde, again with sodium cyanoborohydride (in 50 mM phosphate, pH 3) on the packing material. It is these types of creative approaches that will expand the scope and future applications of CEC. During studies employing cation-exchange packings, some unusual results were noted. For basic compounds, this packing yielded "staggering efficien-
    • 7.7 CEC Microfluidic Devices 313 ? c £i o m < 01 3 .2 .—J 1 5 T1 ^ 0.002 au. liJ-H n WH — 1 — 1 — 1 — 0.5 1.0 1.5 Retention Time (min) 2.0 FIGURE 7.10 Capillary electroosmotic chromatography of Isradipin and its by-products. Capil- lary: 14.3 cm X 50 lim i.d. packed with Hypersil ODS (3 x.m) mobile phase: 2 mM sodium tetra- borate (pH 8.7)-80% acetonitrile; voltage: 30 kV; injection: 4 s at 1.5 kV; detection: UV, wavelength not specified. Reprinted with permission from J. Chromatogr., 593, 313 (1992) copyright © 1992 Elsevier Science Publishers. cies," but explanations were not forthcoming. This effect was first observed by Smith and Evans (56). The possibihty of some form of isotachophoresis (Sec- tion 8.61) was considered but never proved. In any event, milUons of theoreti- cal plates were observed. Similar results were observed by Moffatt et ah (57) for partially ionized anionic or neutral compounds using a Cis- Their explanation of the effect is nonequilibrium conditions caused by pulses of strong or weak solvent that arise from the sample. The increased efficiency occurs when the migration time of the solute is matched to the elution time of the sample- induced discontinuity. As shown in Figure 7.13, focusing does not occur when the solute is dissolved in the mobile phase. The peak width of the neutral marker, thiourea, is the same in both instances. Good migration time and peak area reproducibility were found, indicating that the focusing effect can be con- sidered for analytical applications where high sensitivity and resolution are required (57). 7.7 CEC MICROFLUIDIC DEVICES With the advent of micromachining to produce chemical analysis systems, it becomes possible to perform CEC on these chip-based systems (58, 59). The design of one such column is shown in Figure 7.14 (59). The capillary inlet is
    • 314 Chapter 7 Capillary Electrochromatography 2 3 4 5 6 RETENTION TIME (SECONDS) FIGURE 7.11 High-speed separation of polycyclic aromatic hydrocarbons on a short capillary at high field strength. Capillary: 6.5 cm (10 cm total length) x 100 |xm; packing: 1.5-|xm non- porous CDS material; mobile phase: 70% acetonitrile, 2 mM Tris; voltage: 28 kV; injection: 5 kV for 2 s; detection: LIF, doubled argon-ion laser at 257 nm, emission collected between 280 and 600 nm. Reprinted with permission from Anal. Chem., 70, 4787 (1998) copyright © 1998 Am. Chem. Soc. mAU 100 80- 60- 40" 20- U C J l il T ) 5 1 10 15 20 FIGURE 7.12 Separation of thahdomide enantiomers on an in situ immobilized vancomycin chi- ral stationary phase. Capillary: 26 cm x 100 mm; packing: diol silica with immobilized vancomycin; mobile phase: 80% methanol, 20% acetonitrile, 0.2 parts acetic acid, 0.2 parts triethylamine; volt- age: 20 kV; temperature: 15°C; detection: UV, 260 nm; pressurization: 10 bar over inlet and outlet. Courtesy of Paul Owens, Astra Hassle AB, Sweden.
    • 7.7 CEC Microfluidic Devices 315 B i 8 I 1 T ' l t I 'f 'i,M,i,ni,iMi|M„, y, 11,. I .1111 ,,,,,.^,11, I i| I I ,..:|M.|, j "^ Time 1 min FIGURE 7.13 High-efficiency CEC separation caused by an unusual focusing effect. Capillary: 33 cm (24.5 cm to detector) x 50 mm; packing: 3-mm Hypersil Cig; mobile phase: 70:30 [5 mM Tris (pH 8.6):acetonitrile]; injection: 5 kV for 5 s; voltage: 30 kV; temperature: 30°C; detection: Uy 214 nm; inlet and outlet pressurized with nitrogen at 10-12 bar; solute: 6-(hydroxymethyl)- 2-(methylamino)-5-methylpyrimidin-4-ol, 2.1 mg/mL. Solute dissolved in (A) water; (B) mobile phase. Reprinted with permission from Anal. Chem., 71, 1119 (1999) copyright © 1999 Am. Chem. Soc. split several times to allow the sample to be dispersed over the functionalized surface of the etched column. A similar structure occurs at the outlet to allow recombination of the channels for detection. It appears likely that there will be a role for CEC in the forthcoming revolution in miniaturized analytical systems.
    • 316 Chapter 7 Capillary Electrochromatography COMOSS f l Collocated Monolith Collector -8d- 16d -8d- 16d Coupling Channels -32d- 1 No. of Channels FIGURE 7.14 Configuration of an inlet splitter to disperse sample and mobile phase over a micro- fabricated chromatographic column. Reprinted with permission from Ana/. Chem., 70, 3790 (1998) copyright © 1998 Am. Chem. Soc. REFERENCES 1. Choudhary, G., Horvath, C. Dynamics of Capillary Electrochromatography. Experimental Study on the Electroosmotic Flow and Conductance in Open and Packed Capillaries.J. Chromatogr., A, 1997; 781:161. l.Pretorius, V, Hopkins, B. J., Schieke, J. D. A New Concept of High-Speed Liquid Chromatogra- phy J. Chromatogr., 1974; 99:23. 3.Jorgenson, J. W, Lukacs, K. High-Resolution Separations Based on Electrophoresis and Elec- troosmosis. J. Chromatogr, 1981; 218:209. 4.Tsuda, T., Nomura, K., Nakagawa, G. Open-Tubular Microcapillary Liquid Chromatography with Electro-osmotic Flow Using a UV Detector. J. Chromatogr, 1982; 248:241. 5. Pesek, J. J., Matyska, M. T. A New Open Tubular Approach to Capillary Electrochromatography. J. Capillary Electrophor, 1997; 4:213. 6.Guo, Y., Colon, L. A. A Stationary Phase for Open Tubular Liquid Chromatography and Elec- trochromatography Using Sol-Gel Technology. Anal. Chem., 1995; 67:2511. 7. Mayer, S., Schurig, V. Enantiomer Separation by Electrochromatography in Open Tubular Columns Coated with CHIRASIL-DEX. J. Liq. Chromatogr, 1993; 16:915. 8. Mayer, S., Schurig, V. Enantiomer Separation by Electrochromatography on Capillaries Coated with Chirasil-Dex. HRC & CC, 1992; 15:129. 9. Rathore, A. S., Horvath, C. Effect of a Predetection Open Segment in the Column on Speed and Selectivity by Capillary Electrochromatography. Anal. Chem., 1998; 70:3271. 10. Majors, R. Column Watch. Perspectives on the Present and Future of Capillary Electrochro- matography LC/GC, 1998; 16:96.
    • References 3 1 7 ll.Lurie, I. S., Conver, T. S., Ford, V. L. Simultaneous Separation of Acidic, Basic, and Neutral Organic Compounds, Including Strong and Moderate Acids and Bases, by Capillary Elec- trochromatography. Anal Chan., 1998; 70:4563. 12. Dulay, M. T., Kulkarni, R. P., Zare, R. N. Preparation and Characterization of Monolithic Porous Capillary Columns Loaded with Chromatographic Particles. Anal. Chem., 1998; 70:5103. 13.Peters, E. C, Petro, M., Svec, F., Frechet, J. M. J. Molded Rigid Polymer Monoliths as Separa- tion Media for Capillary Electrochromatography 1. Fine Control of Porous Properties and Sur- face Chemistry. Anal. Chem., 1998; 70:2288. 14.Peters, E. C, Petro, M., Svec, E, Frechet, J. M. J. Molded Rigid Polymer Monoliths as Separa- tion Media for Capillary Electrochromatography. 2. Effect of Chromatographic Conditions on the Separation. Anal. Chem., 1998; 70:2296. 15.Schure, M. R., Murphy, R. E., Klotz, W. L., Lau, W. High-Performance Capillary Gel Elec- trochromatography with Replaceable Media. Anal. Chem., 1998; 70:4985. 16. Fujimoto, C, Kino,J., Sawada, H. Capillary Electrochromatography of Small Molecules in Poly- acrylamide Gels with Electroosmotic Flow J. Chromatogr., A, 1995; 716:107. 17. Fujimoto, C. Charged Polyacrylamide Gels for Capillary Electrochromatographic Separations of Uncharged, Low Molecular Weight Compounds. Anal. Chem., 1995; 67:2050. 18. Colon, L. A., Reynolds, K. J., Ahcea-Maldonado, R., Fermier, A. M. Advances in Capillary Elec- trochromatography. Electrophoresis, 1997; 18:2162. 19.Dittman, M. M., Rozing, G. P Capillary Electrochromatography—a High-Efficiency Micro-sep- aration Technique. J. Chromatogr., A, 1996; 744:63. 20.Zimina, T. M., Smith, R. M., Myers, P. Comparison of ODS-Modified Silica Gels as Stationary Phases for Electrochromatography in Packed Capillaries. J. Chromatogr, A, 1997; 758:191. 21. Knox, J. H., Grant, 1. H. Miniaturisation in Pressure and Electroendosmotically Driven Liquid Chromatography: Some Theoretical Considerations. Chromatographia, 1987; 24:135. 22. Rathore, A. S., Horvath, C. Capillary Electrochromatography: Theories on Electroosmotic Flow in Porous Media (Review). J. Chromatogr, A, 1997; 781:185. 23. Wright, P. B., Lister, A. S., Dorsey J. G. Behavior and Use of Non-aqueous Media without Sup- porting Electrolyte in Capillary Electrophoresis and Capillary Electrochromatography. Anal. Chem., 1997; 69:3251. 24.Bruin, G.J. M., Tock, P. P. H., Kraak, J. C, Poppe, H. Electrically Driven Open-Tubular Liquid Chromatography J. Chromatogr, 1990; 517:557. 25. Knox, J. H. Thermal Effects and Band Spreading in Capillary Electro-separation. Chro- matographia, 1988; 26:329. 26.Dittman, M. M., Wienand, K., Bek, E, Rozing, G. P. Theory and Practice of Capillary Elec- trochromatography LC/GC, 1995; 13:800. 27.Lelievre, E, Yan, C, Zare, R.N., Gariel, P Capillary Electrochromatography: Operating Charac- teristics and Enantiomer Separations. J. Chromatogr, A, 1996; 723:145. 28.Behnke, B., Gram, E., Bayer, E. Evaluation of the Parameters Determining the Performance of Electrochromatography in Packed Capillary Columns. J. Chromatogr, A, 1995; 716:207. 29. Lurie, I. S., Meyers, R. P., Conver, T. S. Capillary Electrochromatography of Cannabinoids. Anal. Chem., 1998; 70:3255. 30. Euerby M. R., Johnson, C. M., Bartle, K. D. Practical Experiences and Applications of Capillary Electrochromatography in the Pharmaceutical Industry. LC/GC, 1998; 16:386. 31.Ding, J., Vouros, P. Capillary Electrochromatography and Capillary Electrochromatogra- phy-Mass Spectrometry for the Analysis of DNA Adduct Mixtures. Anal. Chem., 1997; 69:379. 32.Boughtflower, R. J., Underwood, T., Paterson, C.J. Capillary Electrochromatography—Some Important Considerations in the Preparation of Packed Capillaries and the Choice of Mobile Phase Buffers. Chromatographia, 1995; 40:329. 33.Bailey, C. G., Yan, C. Separation of Explosives Using Capillary Electrochromatography. Anal. Chem., 1998; 70:3275.
    • 318 Chapter 7 Capillary Electrochromatography 34.Behnke, B., Bayer, E. Pressurized Gradient Electro-High-Performance Chromatography. J. Chro- matogr.. A, 1994; 680:93. 35.Deng, Y., Zhang, J., Tsuda, T., Yu, P H., Boulton, A. A., Cassidy R. M. Modeling and Optimiza- tion of Enantioseparation by Capillary Electrochromatography. Anal Chem., 1998; 70:4586. 36.Euerby, M. R., Gilligan, D. Step-Gradient Capillary Electrochromatography. Analyst, 1997; 122:1087. 37. Dadoo, R., Zare, R. N., Yan, C, Anex, D. S. Advances in Capillary Electrochromatography: Rapid and High-Efficiency Separations of PAH's. Anal Chem., 1998; 70:4787. 38. Lane, S., Boughtflower, R., Paterson, C, Morris, M. Evaluation of a New Capillary Electrochro- matography/Mass Spectrometry Interface Using Short Columns and High Field Strengths for Rapid and Efficient Analyses. Rapid Commun. Mass Spectrom., 1996; 10:733. 39. Lord, G. A., Gordon, D. B., Tetler, L. W, Carr, C. M. Electrochromatography-Electrospray Mass Spectrometry of Textile Dyes. J. Chromatogr., A, 1995; 700:27. 40. Wu, J.-T., Hunag, P, Li, M. X., Lubman, D. S. Protein Digest Analysis by Pressurized Capillary Electrochromatography Using an Ion Trap Storage/Reflectron Time-of-Flight Detector. Anal Chem., 1997; 69:2908. 41. Wu, J.-T., Huang, P., Li, M. X., Qian, M. G., Lubman, D. M. Open-Tubular Capillary Elec- trochromatography with an On-Line Ion Trap Storage/Reflection Time-of-Flight Mass Detector for Ultrafast Peptide Mixture Analysis. Anal Chem., 1997; 69:320. 42. Pusecker, K., Schewitz,J., Gfrorer, P, Tseng, L.-H., Albert, K., Bayer, E. Online Coupling of Cap- illary Electrochromatography, Capillary Electrophoresis, and Capillary HPLC with Nuclear Mag- netic Resonance Spectroscopy. Anal Chem., 1998; 70:3280. 43. Djordjevic, N. M., Fowler, P W. J., Houdiere, E, Lerch, G. Retention of Neutral Solutes by Cap- illary Electrochromatography J. Liq. Chromatogr. Related Technol, 1998; 21:2219. 44. Yan, C, Schaufelberger, D., Emi, E Electrochromatography and Micro High-Performance Chro- matography with 320 |Xm I.D. Packed Columns. J. Chromatogr, A, 1994; 670:15. 45.Yamamoto, H., Baumann, J., Erni, F. Electrokinetic Reversed-Phase Chromatography with Packed Capillaries. J. Chromatogr, 1992; 593:313. 46. Rebscher, H., Pyell, U. A Method for the Experimental Determination of Contributions to Band- broadening in Electrochromatography with Packed Capillaries. Chromatographia, 1994; 38:723. 47. Li, S., Lloyd, D. K. Packed-Capillary Electrochromatographic Separation of the Enantiomers of Neutral and Anionic Components Usingj3-Cyclodextrin as a Chiral Selector Effect of Operating Parameters and Comparison with Free-Solution Capillary Electrophoresis. J. Chromatogr, A, 1994; 666:321. 48. Smith, N. W., Evans, M. B. The Analysis of Pharmaceutical Compounds Using Electrochro- matography. Chromatographia, 1994; 38:649. 49.Pfeffer, W. D., Yeung, A. S. Electroosmotically Driven Electrochromatography of Anions Having Similar Electrophoretic Mobihties by Ion Pairing. J. Chromatogr, 1991; 557:125. 50.Dittmann, M. M., Rozing, G. P, Ross, G., Adan, T., Unger, K. K. Advances in Capillary Elec- trochromatography. J. Capillary Electrophor, 1997; 4:201. 51. Yan, C, Dadoo, R., Jui, Z., Zare, R. N., Rakestraw, D.J. Capillary Electrochromatography: Analy- sis of Polycyclic Aromatic Hydrocarbons. Anal. Chem., 1995; 67:2026. 52.Euerby, M. R., Johnson, C. M., Cikalo, M., Bartle, K. D. "Short-End Injection" Rapid Analysis Capillary Electrochromatography. Chromatographia, 1998; 47:135. 53.Schweitz, L., Andersson, L. I., Nilsson, S. Capillary Electrochromatography with Molecular Imprint-Based Selectivity for Enantiomer Separation of Local Anesthetics. J. Chromatogr, A, 1997; 792:401. 54. Peters, E. C, Lewandowski, K., Petro, M., Svec, F, Frechet,J. M.J. Chiral Electrochromatogra- phy with a "Molded" Rigid Monolithic Capillary Column. Anal. Commun., 1998; 35:83. 55. Wikstrom, H., Svensson, L. A., Owens, P K. Vancomycin Chiral Stationary Phasefor Capillary Electrochromatography, in HPCE'99. 1999.
    • References 3 1 9 56. Smith, N. W., Evans, M. B. The Efficient Analysis of Neutral and Highly Polar Pharmaceutical Compounds Using Reversed-Phase and Ion-Exchange Electrochromatography. Chromato- graphia, 1995; 41:197. 57. Moffatt, E, Cooper, P A.,Jessop, K. M. Capillary Electrochromatography. Abnormally High Effi- ciencies for Neutral-Anionic Compounds under Reversed-Phase Conditions. Anal Chem., 1999; 71:1119. 58.Kutter, J. P, Jacobsen, S. C, Matsubara, N., Ramsey,J. M. Solvent-Programmed Microchip Open- Channel Electrochromatography. Anal. Chem., 1998; 70:3291. 59. He, B., Niall, T., Regnier, E Fabrication of Nanocolumns for Liquid Chromatography. Anal. Chem., 1998; 70:3790.
    • CHAPTER 8 Injection 8.1 Volumetric Constraints on Injection Size 8.2 Performing an Injection and a Run 8.3 Injection Techniques 8.4 Short-End Injection 8.5 Injection Artifacts: Problems and Solutions 8.6 Stacking and Trace Enrichment References 8.1 VOLUMETRIC CONSTRAINTS ON INJECTION SIZE All capillary separation techniques including HPCE have certain constraints on the amount of material that can be injected. Injection in HPCE is designed to allow introduction of sufficient material into the capillary and minimize the extracapillary variance from the process itself. The volumetric problem is expressed in Table 8.1. Because the entire internal volume of a 50 cm x 50 |im i.d. capillary is only 981 nL, the injection volume must be kept quite small. In Section 2.14, the concept of additivity of variances was introduced (1-3). This will now be used to calculate the impact of injection on the theoretical plate count. The contribution to variance from a plug injection is (1, 2) 2 12 < = ^ , (8-1) Table 8.1 Internal Volume versus Capillary i.d. (vim) Volume/mm (nL) Total volume (nL) 10 0.0785 39.3 Diameter for a 25 0.491 245 50-cm Capillary 50 1.96 981 100 7.85 3,925 200 3L4 15,700 321
    • 322 Chapter 8 Injection where / is the length of the injection plug. To model the increase in band broad- ening from the injection process, the diffusion-limiting case must be considered via the Einstein equation: aU=2D^t. (8.2) Since the squares of the variances are additive, the contributions to band broadening from injection and diffusion can be inserted into the theoretical plate equation: (8.3) For a 50-cm capillary and a solute migration time of 600 s, the impact of the injection size for a small molecule (D^ = 10"^ cmVs) and a large molecule (D^ - 10"^ cmVs) is shown in Figure 8.1. As can be seen from the figure, injec- tion of 1% of the capillary volume with sample causes a 92% loss of efficiency for a large molecule and an 8% loss of efficiency for the prototypical small mol- ecule. As discussed in Section 2.14, the more efficient the separation, the harder it is to maintain that efficiency. The same can be seen in Table 8.2, where calculations have been made to predict the allowable injection sizes that provide 5% and 10% increase in peak T H E O R E T 1 C A L P L A T E S 1000000 100000 10000 0.1 0.2 0.3 0.4 0.5 0.6 0.7 INJECTION SIZE (cm) 0.8 0.9 FIGURE 8.1 Impact of injection zone length on the number of theoretical plates for a small mol- ecule, 0 (Djn = 10"^ cmVs), and a large molecule, A {D^ = 10~^ cmVs), as solved by Eq. (8.3). Con- ditions: capillary length: 50 cm to detector; migration time: 600 s.
    • 8.2 Performing an Injection and a Run 323 Table 8.2 Calculated Maximum Injection Length and Volume for a 50 cm X 50 pim i.d. Capillary Number of Theoretical Plates (N) Peak Width (mm), 5% increase linj (mm) Vinj (nL) 10% increase /inj (mm) Vinj (nL) tm-= 10min 100,000 4.47 1.24 2.43 1.77 3.48 500,000 2.00 0.56 1.09 0.79 1.55 1,000,000 1.41 0.39 0.77 0.56 1.10 Data from reference (2). Peak widths at half height calculated from N = 5.5^(,t^^/w'^y ). width for separations yielding 100,000, 500,000, and 1,000,000 theoretical plates (2). To maintain 95% efficiency for a 1,000,000-plate separation, an injec- tion plug of 0.07% of the capillary length is required. For a 100,000-plate sep- aration, a 0.24% injection can be tolerated. Both of these models assume that the injection electrolyte is identical to the running electrolyte. Through the use of a low-conductivity injection solution relative to the BGE, it is possible to obtain substantial compression of the injec- tion zone. Introduced in Chapter 2, this process is known stacking. This fam- ily of related processes will be described in detail later in this chapter. In any event, the problem of injection is one of the driving forces behind micromachined systems. Using "pinched injection," it is possible to inject minute amounts of sample (4) without suffering the effects of "ubiquitous injec- tion" (see Section 8.5). This allows shortened capillaries to be employed in complex separations, such as the separation of DNA-sequencing reaction prod- ucts. Through the use of LIF detection, sensitivity is not a problem despite the small injection size. To approach the optimal efficiency of HPCE, injection must be optimized. Through the use of dilute aqueous samples and short electrokinetic injections, separations providing millions of theoretical plates are possible (5). As is often the case, efficie