Your SlideShare is downloading. ×
L14 human genome
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

L14 human genome

555
views

Published on

Published in: Technology

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
555
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
41
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Human Genome Project Determine the entire sequence of the human genome. 3 billion base pairs Problem: It’s really big!
  • 2. Genome Sequencing As of 6/ 25/ 04 1128 genome projects: 199 complete (includes 28 eukaryotes) 508 prokaryotic genomes in progress 421 eukaryotic genomes in progress smallest: archaebacterium Nanoarchaeum equitans 500 kb Bacillus anthracis (anthrax) 5228 kb S. cerivisiae (yeast) 12,069 kb Arabidopsis thaliana 115,428 kb Drosophila melanogaster (fruit fly) 137,000 kb Anopheles gambiae (malaria mosquito) 278,000 kb Oryza sativa (rice) 420,000 kb Mus musculus (mouse) 2,493,000 kb Homo sapiens (human) 2,900,000 kb http:// www. genomesonline. org/ 1980 - $10/bp 2001 - $0.1 / bp S. cerevisiae 200x H. sapiens 200x A. dubia
  • 3.  
  • 4. Human Genome Project timeline E. coli Drosophila C. elegans Yeast NRC Recommends HGP U.S. HGP Begins 1990 1995 2000 Human Gene Map (16,000 genes) Human Gene Map (30,181 genes) Goal for Human Genetic Map Exceeded Physical Map Covers 98% of Genome Pilot Human Sequencing Begins Full-Scale Human Sequencing Begins Human draft Phil Hieter
  • 5. Completion of the genome 4-5 coverage 9x coverage 99.99 % acc GenBank entries double every 18 months “ Working Draft” “ Complete”
  • 6. Completion of the genome The current genome sequence (Build 35) contains 2.85 billion nucleotides interrupted by only 341 gaps. It covers approximately 99% of the euchromatic genome and is accurate to an error rate of approximately 1 event per 100,000 bases. Human genome seems to encode only 20,000-25,000 protein-coding genes International Human Genome Sequencing Consortium . Finishing the euchromatic sequence of the human genome. Nature 2004 Oct 21;431(7011):931-45.
  • 7. Institutes that produced 85 % of the sequence 1. Whitehead Institute for Biomedical Research , Center for Genome Research, Cambridge, MA 2. The Sanger Centre , Cambridge, UK 3. Washington University Genome Sequencing Center , St. Louis, MI 4. US Department of Energy , JGI, Walnut Creek, CA 5. Baylor College of Medicine Human Genome Sequencing Center , Houston, TX Countries: USA, UK, Japan, Germany, China, France
  • 8. Genome Sequencing Genome: 3 Gb Cut genome into large pieces Clone into BACs: 100 kb Order based on sequence features ( markers ) = mapping Cut again Sequence AGAACAGGACGTATGTGGT TGTGGTTTTCTACTCC CTACTCCTGTGTT TTGTAAGTGAGAACA Assemble each BAC … TTGTAAGTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTT… Assemble entire sequence
  • 9.  
  • 10.  
  • 11.  
  • 12. What does the sequence mean? TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGTCATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACATACAAAATAATACCTCAGTGTAACCTCTGTTTGTATTTCCCTTGATTAACTGATGCTGAGCACATCTTCATGTGCTTATTGACCATTAATTAGTCTTATTTGTTAAATGTCTCAAATATTTTATACAGTTTTACATTGTGTTATTCATTTTTTAAAAAATTCATTTTAGGTTATATGTATGTGTGTGTCAAAGTGTGTGTACATCTATTTGATATATGTATGTCTATATATTCTGGATACCATCTCTGTTTCATGCATTGCATATATATTTGCCTATTTAGTGGTTTATCTTTTCATTTTCTTTTGGTATCTTTTCATTAGAAATGTTATTTATTTTGAGTAAGTAACATTTAATATATTCTGTAACATTTAATGAATCATTTTATGTTATGTTTAGTATTAAATTTCTGAAAACATTCTATGTATTCTACTAGAATTGTCATAATTTTATCTTTTATATACATTGATATTTTTATGTCAAATATGTAGGTATGTGATATTATGCACATGGTTTTAATTCAGTTAATTGTTCTTCCAGATGTTTGTACCATTCCAACATCATTTAAATCATTAAATGAAAAGCCTTTCCTTACTAGCTAGCCAGCTTTGAAAATCCATTCATAGGGTTTGTGTTAATATATTTTTGTTCTTTTTTTTCCTTTCTACTGATCTCTTTATATTAATACCTACTGTGGCTTTATATGAAGTCATGGAATAATACGTAGTAAGCCCTCTAACACTGTTCTGTTACTGTTGTTATTGTTTTCTCAGGGTACTTTGAAATATTCGAGATTTTATTATTTTTTAGTAGCCTAGATTTCAAGATTGTTTTGACGATCAATTTTTGAATCAATTGTCAATATTTTTAGTAATAAAATGATGATTTTTGATTGGAAATACATTAAATCTATAAGCCAAATTGGAGATTATTGATATATTAACAAAAATGAGTTTTCCAGTCCATGAATGTATGCACATTATAAAATTCATTCTTAAGTATGTCATTTTTTAAGTTTTAGTTTCAGCAGTATATGTTTGTTACATAGGTAAACTCCTGTCATGGGGGTTAGTTGTACAGGTTATTTTATCATCCAGGCATAAAGCCCAGTACCCAGTAGTTATCTTTTCTGCTCCTCTCCCTCCTGTCACCCTCCACTCTCAAGTAGACCCCAGTTTCTGTTGTTCTCTTCTTTGCATTAATGACTTCTCATCATTTAGATTGCACTTGTAAGTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTTAGTTTGCTAAGGATAACCACCTCCATCTCCATCCATGTTCCCACAAAAGACATGATCTCCTTTTTTATGGCTGCATATTATTCCATGGTATATATGTACCACATTTTCTTTATCCAATCTGTCATTGATGGACATTTAGGTTGTTTCCACATCATTGCCGTTGTAAATACTGCTGCAGTGAATATTCGTGTGTATGTCTTTATGGTAGAATGATTTATATTCCTCTGGGTATATTTCCAAGTAATGGGATGGTTGGGTCAAATGGTAATTCTGCTTTTAGCTTTTTGAGGAATTGCCATATTGCCTTTCACAACGGTTGAACTAATTTATACTCCCAAGAGTGTATAAGTTGTTCCTTTTTCTCTGCAACCTCGACATCACCTGTTATTTATGACTTTTATATAATAGCCATTCTGCTGGTCTGAGATGGTATCTCATTATGATTTTGATTTGCATTTCTCTAATGCTCAGTGATATTGAGCTTGGCTGCATATATGTCTTCTTTTAAAAATATCTGTTCATGTCCTTTGCCTAATTTATAACGGGGTTGTTTGTTTTTCTCTTGTAAATTTGTTTAAGTTCCTTATAGATTCTAGGTATTAAACCTTTTTTCAGAGGCGTGGCTTGCAAATATTTTCTCCCATTCTATAGGTTGTCTGTTTATTCTGTTGATAGTTTCCCTTGCTGTGCAGAAGCTCTTAACTTTAATTAGATCCGACTTGTCAATTTTTGCTTTGGTCGCAATTGCTTTTGATGTTATTGTCGTGAAATCTTTGCTAGTTCTTAGGTCCAGGATGATATTGCCCAAGTTGTCTTCCAGGGCTTTTATAATTTTGGATTTTACATTTAAGTCTTAATATATTTATTAAATTTGTTAGGGTTTCAGGATACAAGGACAATATAGCAGCAAACAATGTAAAAGTAAAATCTGAAAAATAATAGAAAACAGTTTAATTGAACACTTTACCATTATGTAATGCCCTTCTTTGTCTTTCCTGATCTTTGTTGGTTTGAAGTTCAAAAAAGACAAACTTAATGGTACAATAGGTATTGTAGATTTCAGGACTTTCTGTATAAAATATTTTGTATATATGAATAGATCATTTTTTATTTCCAGTCTTTAAACATTTTCTTAACATTTTCTTCTATTGCTTCACTTCACTCGCTAGGACCATCAGGACAGTGTTGAACAGAAATTGTCAGACTGATCATCACAACTTTTTCTAGATTTTAGAAGGAAATTTTTCTTTATTTCAACATAAAGCAGCATGTTAATGCCAAGTTTTAATATGTGTTATCAGATTGAAATTTTTTTGTATATTTCTACATTACCAAGAATTTTTAGCAAGAGTTTTTGTTGAGTTTTAATTTAAAAATCATTTGTTAATTTCATCTGATTTTTTTATTTCTCTTTTTACCTTAAGAGATTAAACTGACTACAGATTGAATATAAACAAACAAACAAACAAACAAAAACTCTAAAATGCTGTGGATCAACACCACTTAGTAATTTGTATACTTGGATTCAATTTGCTGAAATTTTGTTAGACATTTTTGCGTCGATATTTATGAGGGATGTTGATCTGTAAAAGTATTAAAATGCCTTTGACAGATTTTGATAGCAGTGTTATTCTGGCCTAATAAATCAAACTGAGGTATGATCCTTCCTTTTCTATTTCTTAATAGCATTTTTAAAATTGGTGGTTTTTTCCTTCCTTAGTGAAATTTACCAGCAAAGTAACAGGCCTTATATTTCTCTTGTGGAAATATTTTAATTTCAAATTAATGGTATTTTGTTCTTGTAGGGTGGTAATTTTCTCTGTGTTTGGTCTTAATGGACTCTTAGCTGATCACCCAGTTACTCAGCGAGGTCTCTTCACTCTGGAAGAGCTGGAACTCCAGTGTGTTTTAGTGCAGCATGACCACGGGTATTACCGTTCAACATTTAGGCTTTATCAGTGATAACTATTTGTCCTCATGGAGTTTTTGCCGCTGGGCCTACACAGTTTAGGCTTCAGCTTAGAACACATAATGAATTCTTATGCAGATTTCTGCCCACCTTTGACCTTTCATGATTTCCTCTTCTTGGGTAAGCTGCCTTATTAATCTGATACACTTCAGCAGTCCAGAACTACACTCTTTCCCTTCTCTGCTCTTGGAGATGACTCTTTTGTCTGAGATTCACTTTGCTGTGCTGAAAAAGAAAAGTGCTTCAAGGAAGATACCAAGGAAAATCACAGGGCTCATTTATGTATTTCTCTTCTTTCAAGGACTACAGCTTTGTGTTGCCTATGTTCAATTTCTGAAAATAATTAGAGCATATATACTCTGTGTGAGAAGGCAAATCCAGACAGTTAGTTTGTATGACTAGAAGCAGAAGTCTACATGGAGAATTTTACTTAACTGTGTTATAGTTTCTTTAATTATTTCAAGAGTATGTTTAATGTTCCACAGATCTCATTCTATAAATCTTTATCATCTTAGAGCTCTGATACTATTTAGAATTACTATTCCTTCAAATAAGAGATTAGAAACAGGGTTATATTTGGGGTAGGTTGACTTACTTTTCTGGGAACCAAAGCATATTAAATTGACCAGTTTTAACACACTTCTATGTATGCACAAAGATATATATTTACATTCTGCAAAATCATTCTTTCCTTTTTGAATTTGAAAAGGATCTTTGGTATACAGATATTCAATAGCCAGCCTGAAGATTCATTTGAATTCATTTAATGTTTAGATTCACTACATGAAATGATCCAGAAGAGAGTACTCAAATATAAGTATCTATAACGATGGAAATATACATCTCCACTGCCCAAGATGGTAGTCATGAGTCAATATTGATCATGTGAGACGTGGCAAGTGTTACTCAGGGTCTCAATATTTAAATGTATTAAGCTTTAATTAATGTAAATTTGAATTTAGCAAAACATGTATAGCTTGTGGTTACTGTTTTATTCAGTGCCAATATAGAACATTTCCATGATTACAGAAAGTTATCTTAGAATACTCAGTTCTGGACTATTTTATCTGGCTAAATTAAATGTTAAAATATTACAAATTCATCTTCAGGCTGGCTGTTGAATATTTTTATAGCAAAAGTCATTTATAAATTTAAAACTCAAATAATTATCTTTTTCAATATGTAAAATATGTCTTTACATATTCTACTCCCTTCTTACATACATATTCTGATGTAACATAGGTATTCTCTTATTCATGCACACTGAAATGACAACATAAATAATTTTACTAAGTGTCACCATATAAAAAACTTTGAACAAAATCAGATTATATCACTGTGGATATTTCTATTTTGAACTAACTTAGATGATAATTTTAATCTATATCCTAGATGAACTTTAAATCAATAAAATCTCTCAATGGTGTTATAAATCTCAAGCCATTAGCCACTGATTATCCCATTTTTATTCTTTTCATATTAATTTTATTGCCATGTATGAATGCTGTAGCATCCATGTTTAAATACTAGTTAACAAAATGCACTGGCATCAGATACAATAAGGATGAAATGAGATATAATTAGGACTCTGGTAACACACATAAAATTGGAAAGATACCCTGAAATTCAAGCCAAGAAGATATTTATCCAGCTTATTTTATTTTGAGACAGAGTCTTGCTCTCTCACTCAGGCTGGAGTGCAGTGGACCATTCTAGGCTCGCTCCAACCTCTGTCTCCCAAATTGAAGTAATTCTCGTGCCTCAATCTCCCGAGTAGCTGGGATTACAGGCATGTGTCACCAAGCCTGGCTGATTTTTGTAGTTTTAGTAGAGACGGGGTTTCACCATGATGGCCAGGCTGGTCTTGAACTCCTGGCCTCAAGTGACTGGAACACCTCGGCCTCCTAAAGTGCTGGGATTACAGACGAGAGCCACTGAACAGCTTTGATCCAACTTATTTGGATGAATGAGTTACATATTTTACATTAAATCTGTTATTGTGATAATTCTTCATGTTATTTTCCATGTATAGATTTATATATAATGTAATTTTAATTTTTTTTCACCGGAGAGTATAAACAACAATTATTTTATAAACAGGATAATAAAAATAAGACAAAAATTGTTGAAATGTCTTCATTTGACTACTAACTTTTTACATGTTTGTTACTTTGAAGCTGTTATCAATACTTGTGATGTATTACAATTAAGTAAAGATTTAAAGATGCCATTTTTAACTTATTATGACACAAAGTCTATAAATTCTTATATTTTGAGATTTGTATTTAAATAACTTGTGAAATTTAATTTTAAAATAAAATTTCTTCTATGGATTGGTCTTCAATCGAGGCATAAAAAGGAATATAACAGTGTGGCACTATAACTTCTATATTGAATTTCTATATTATTTAACACAATTATAATTTTGCTAATGAATTGTAATGTTTTTAAAAAGCTAGGTGAATTTTATTAAATTCATTACATGGCGATAACACAGAGAAAACATTTTGGGGATTCTTTTAAAATGGTATGTACAAAAGCTTAAAAGTTGTTATGTAGTGGCAGAGATAAAAAAGTAAAACAAAAAAAAGCTTAAAAGTTTGCTTTACTATTTATAGGCTCATAAGTGTAAGTGTGCCAGAAAATGAAAAAGAAAGGAGAGAAATTATAAATAACTGTGTGGAAAACACAGATAAAGCATAAAGATAGAATATAAAGATAGAAGCATTTTAATATGAGGCAGTGATGGCTTTTTGAAGAATCCCAACTAAGGACCTACTTTTAGTTAATAAATAATATGTTTCTAATCCCTATATTGTCCACAGCAACCTTTTTAGGACATGGAGCAGTGACTATGAGTGCCAGAAGGCAAGAGTAGAAGCAATTGTAAAATCATGAACACTAGTTTGTAAAATCCTCACTGAGATATAATATCTGTTTGCCTCTACCTTAGAATTATTAATGTCTTGAGGGCTGGGA A very small piece of chromosome 21
  • 13.  
  • 14. What’s in a genome? Genes (i. e., protein coding) But. . . only <2% of the human genome encodes proteins Other than protein coding genes, what is there? • genes for noncoding RNAs (rRNA, tRNA, miRNAs, etc.) • structural sequences (scaffold attachment regions) R egulatory sequences • “ junk” (including transposons, retroviral insertions, etc.)
  • 15.  
  • 16.  
  • 17.  
  • 18. Genome overview
    • Marked variation in distribution of number of features (GC, CpG, repetitions)
    • 2 0.000- 25 .000 protein coding genes
    • Proteome is more complex than those of invertebrates
    • Hundreds of genes resulted from horizontal transfer
    • More than 1.4 million SNPs , 10 million SNPs
  • 19. Application to Medicine and Biology
    • Disease genes – positional cloning ( 30 genes already)
    • Paralogues of disease genes (achromatopsia, CNGA3, CNGB3 ); (971 known disease genes => 286 paralogues)
    • Drug targets – recent compendium = 483 drug targets, 18 new identified; Alzheimer’s disease,  -amyloid is generated by processing APP by BACE; BACE2 in obligatory Down’s syndrom region of chromosome 21
    • Basic biology – bitter taste - new family of G-protein coupled receptors
  • 20. The next steps
      • Large scale identification of regulatory regions
      • Sequencing of additional large genomes
      • Completing the catalogue of human variation
      • Sequence-based functional prediction
  • 21. Chimpanzee Sequencing and Analysis Consortium . Initial sequence of the chimpanzee genome and comparison with the human genome. Nature 2005 Sep 1;437(7055):69-87. Thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements. 98,6 % identitity to human genome sequence Differences in gene/exon structures
  • 22. Apparent differences between humans and great apes in the incidence or severity of medically important conditions (excluding differences explained by obvious anatomical differences ). Medical Condition Humans Great Apes Definite HIV progression to AIDS Common Very rare Influenza A symptomatology Moderate to severe Mild Hepatitis B/C late complications Moderate to severe Mild P. falciparum malaria Susceptible Resistant Menopause Universal Rare Likely E. coli K99 gastroenteritis Resistant Sensitive? Alzheimer’s disease pathology Complete Incomplete Coronary atherosclerosis Common Uncommon Epithelial cancers Common Rare