Molecular forensics 2010
Upcoming SlideShare
Loading in...5
×
 

Molecular forensics 2010

on

  • 2,158 views

 

Statistics

Views

Total Views
2,158
Views on SlideShare
2,158
Embed Views
0

Actions

Likes
0
Downloads
147
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Molecular forensics 2010 Molecular forensics 2010 Presentation Transcript

  • Forensic Science: uses of DNA in legal matters In this topic we discuss the uses of DNA in legal matters DNA is a powerful tool in the fight against crime. DNA evidence can identify suspects, convict the guilty, and exonerate the innocent.
  • DNA basics Virtually every human cell contains 23 pairs of chromosomes; half of each pair is maternal, and the other half paternal. Each chromosome is a double helix of two strands. DNA made of 4 bases ACTG (remember complementarity in base pairing. In a sense, one need only to consider one of the two strands, knowing the base sequence in this one strand makes the base sequence in the other entirely predictable This what makes the DNA a genetic material and its use in molecular forensics
  • Identifying criminal suspects -- older methods Over the past 150 years, forensic scientists have developed several methods to identify persons from physical evidence left behind at a crime scene or disaster scene. Older methods include:1. hair -- With a microscope, its possible to get some indication of age, sex, and race from hair. Comparing hairs allows police to identify people, with an error rate of only one in 4500.2. bone -- Age, sex, race, and sometimes medical history can be determined from bones3. fingerprints -- Fingerprint evidence was introduced in the late 1800s despite much skepticism. It took decades before fingerprints were routinely used in police and court matters
  • Identifying criminal suspects -- older methods4. blood -- The four blood groups (A, B, O, AB) were discovered in 1900. Blood typing, based on these four groups, can be a powerful tool for resolving legal matters. But with only four possibilities per person, there are many cases in which blood typing is not helpful. More blood groups have been discovered over the past 100 years, but even these cannot provide the same level of identification as DNA testing5. footprints -- The US Air Force records the footprints of its pilots and other aircrew members before they begin their flying careers. Because it is protected by a boot, the foot is more likely to be intact after an airplane crash than the fingers are.
  • Identifying criminal suspects -- newer methods Current DNA technology allows any individual to be distinguished from all other individuals, living or dead (except an identical twin). DNA can be recovered from blood, semen, saliva, bone, teeth, or microscopic flecks of skin or other tissues. A cigarette butt casually discarded at a crime scene has enough DNA-containing saliva on it for analysis. Similarly the postage stamp or the flap of the envelope you just licked. A single hair with attached root is also adequate.
  • DNA content of biological samples:Type of sample Amount of DNABlood 30,000 ng/mL stain 1 cm2 in area 200 ng stain 1 mm2 in area 2 ngSemen 250,000 ng/mL Postcoital vaginal swab 0 - 3,000 ngHair plucked 1 - 750 ng/hair shed 1 - 12 ng/hairSaliva 5,000 ng/mLUrine 1 - 20 ng/mL
  • Uses of DNA forensic science in criminal matters To identify potential criminal suspects In 1987, DNA screening was used in a landmark case in Leicestershire, England, to clear an innocent 17- year-old boy of the rape and murder of two girls. After analyzing the DNA of 5000 men in 3 villages, the guilty person was found and convicted. Since then, thousands of criminals have been convicted on the basis of DNA evidence, mostly in murder and rape cases
  • DNA technology and rape In Austin, Texas (2002) DNA technology was able to solve the rape of a local college student by requesting a DNA analysis from the phone cord used to strangle a victim He realized that in the course of choking a victim, enough force and friction is applied to the rope or cord that the perpetrator’s skins cells may rub off his hands and be left on the ligature. In spite of the attacker’s attempt to avoid identification through DNA evidence by wearing both a condom and rubber gloves, a reliable DNA profile was developed from the evidence.
  • DNA technology and rape During the struggle, the attacker was forced to use one hand to hold the victim down, leaving only one hand to pull the phone cord tight. The attacker had to grab the remaining end of the cord with his mouth, thereby depositing his saliva on the cord. Although the developed profile came from saliva rather than skin, DNA not only solved the case in Austin, but also linked the perpetrator to a similar other sexual assaults
  • Uses of DNA forensic science in criminal matters To exonerate persons wrongly accused of crimes DNA fingerprinting can show that an accused suspect, or even a convicted suspect, was not the person who left DNA evidence at the scene of the crime. In the US, the FBI has found that DNA analysis exonerates one out of every three suspects. DNA analysis has also helped to show whether or not convicted people might have been wrongly accused. People have been taken off death row in US as a result of new DNA evidence. In addition, DNA evidence has not only helped to freed innocent persons wrongly accused, but has also helped to identified the real perpetrator
  • Use of DNA forensic science in military matters One of the important uses of forensic DNA technology is to identify the victims of crimes, wars, plane crashes, and other catastrophes. Bodies that are fragmented or decomposed may be identified if known tissue samples from the suspected victim are available, or if DNA samples from close relatives are available. DNA can be recovered from the remains of living things even after thousands of years, if conditions are right. US has used DNA technology to identify the remains of nearly 500 servicemen who died during the Vietnam War, Korean War and from World War II.
  • Use of DNA forensic science in family matters By comparing DNA samples from offspring to DNA samples from suspected parents, paternity and maternity can be established. This method is used not only to establish the correct father in paternity cases, but also in cases of suspected hospital mix-ups of newborn babies. DNA analysis can also help answer questions about biological descendants of a particular family. DNA analysis can definitively disprove descent, as in the case of a woman claiming to be Anastasia, the daughter of Russias last czar, and the cases of several pretenders to the throne of France, last occupied by Louis XVI
  • DNA and human migration patterns Theories say that modern humans evolved in Africa between 100,000 and 200,000 years ago, and originally consisted of a small group of 10,000 individuals Proponents of the African origin of modern humans believe that humans dispersed out of Africa about 100,000 years ago, reaching Asia about 60,000 years ago and migrating into New Guinea and Australia during the ice ages 40,000 years ago. DNA studies of mitochondrial DNA from hair of aboriginal inhabitants of the Andaman Islands in the Bay of Bengal (near India) suggest a close relationship between the aborigines there and the pygmies of Africa. A rival theory suggests that modern Homo sapiens arose independently throughout the world from isolated populations of the early human, Homo erectus. A comparison of DNA from people of different ethnic backgrounds will help solve this controversy. The current best evidence is that we are all "Out of Africa."
  • Other uses of DNA for Forensic Identification Identify endangered and protected species as an aid to wildlife officials (could be used for prosecuting poachers) Detect bacteria and other organisms that may pollute air, water, soil, and food Match organ donors with recipients in transplant programs Determine pedigree for seed or livestock breeds Authenticate consumables such as caviar and wine
  • The science of DNA forensics  The DNA of any two humans is more than 99% identical.  It is far too expensive to look at all of the DNA in order to find the 1% difference. Scientists have developed more efficient methods that are based on properties of DNA that frequently differ from person to person. None of these methods can distinguish identical twins. Identical twins have identical DNA
  • The science of DNA forensics Recall that virtually every human cell contains 23 pairs of chromosomes; half of each pair is maternal, and the other half paternal The working portions of the chromosomes are the genes. In a gene, the base sequence essentially codes for protein construction from free amino acids. For reasons unknown, between the genes are short sequences of bases that repeat many times in a row These are generally refereed as Short Tandem Repeats (STRs) Probably more than 30% of the human genome consists of these tandem repeats.
  • Satellite DNA The tandem repeats seem to act as fillers or spacers between the coding portions of the chromosome. One commonly used STR is located on chromosome 11, and is called TH01. TH01 consists of the repeating sequence –AATG- on one strand and –TTAC- on the other. From here we will look only at the AATG strand, knowing that everything that is to be said will occur similarly for the corresponding TTAC portion of the second strand of the double helix. These repeated areas or STRs are called "satellite DNA”. In the example below, the AATG sequence repeats 6 times: 5’..AGTATCTAGCGAATGAATGAATGAATGAATGAATGATCGAGC GATCTCGT--3’
  • Satellite DNA In the example of satellite DNA, a sequence of four DNA letters (AATG) was repeated. The repeating sequence is not always AATG, nor is it always a sequence of four letters. When the repeating sequence has 2-5 DNA letters, it is called a micro-satellite. When the repeating sequence has 9-80 DNA letters, it is called a mini-satellite.  Micro-satellites survive even in degraded DNA.
  • Satellite DNA The –AATG- sequence usually is repeated anywhere from 5 to 11 times, and the length of the repeat is inherited and hence differs from person to person . Thus, at the TH01 locus on the maternal chromosome 11, AATG may be repeated 6 times, whereas the paternal chromosome 11 may show the pattern repeated 8 times. This 6:8 combination is found in just 3.5% of the population. Generally many people may have six repeats of –AATG- for this area of satellite DNA, but there are many other areas of satellite DNA scattered over the chromosomes. The chance that two people will have the same number of AATG repeats at all areas of satellite DNA is exceedingly small
  • Is DNA effective in identifying persons? DNA identification can be quite effective if used intelligently. Portions of the DNA sequence that vary the most among humans must be used; also portions must be large enough to overcome the fact that human mating is not absolutely random. Consider the following scenario of a crime scene investigation . Assume that type O blood is found at the crime scene. Type O occurs in about 45% of individuals. If investigators type only for ABO, then finding that the "suspect" in a crime is type O really doesnt reveal very much. If, in addition to being type O, the suspect is a blond, and blond hair is found at the crime scene, then you now have two bits of evidence to suggest who really did it. However, there are a lot of Type O blonds out there.
  • Is DNA effective in identifying persons? If you find that the crime scene has footprints from a pair of Nike shoes (with a distinctive tread design) Then in addition to being type O and blond, is also wearing shoes with the same tread design, then you are much closer to linking the suspect with the crime scene. In this way, by accumulating bits of linking evidence in a chain, where each bit by itself isnt very strong but the set of all of them together is very strong, you can argue that your suspect really is the right person.
  • Is DNA effective in identifying persons? With DNA, the same kind of thinking is used You look for matches (based on sequence or on numbers of small repeating units of DNA sequence) at a number of different locations on the persons genome One or two (even three) arent enough to be confident that the suspect is the right one, Four (sometimes 5-12) are used and a match at all these is rare enough that you (or a prosecutor or a jury) can be very confident ("beyond a reasonable doubt") that the right person is accused.
  • The science of DNA forensics: Use of microsatellite DNA To identify individuals, forensic scientists scan 10-13 DNA regions that vary from person to person and use the data to create a DNA profile of that individual (called a DNA fingerprint). There is an extremely small chance that another person will have the same DNA profile for a particular set of regions.
  • How is DNA typing done? Only one-tenth of a single percent of DNA (about 3 million bases) differs from one person to the next. Scientists can use these variable regions to generate a DNA profile of an individual, using samples from blood, bone, hair, and other body tissues and products. In criminal cases, this generally involves obtaining samples from crime-scene evidence and a suspect, extracting the DNA, and analyzing it for the presence of a set of specific DNA regions (markers).
  • How is DNA typing done To date scientists find the markers in a DNA sample by designing small pieces of DNA (probes, microsatellites markers) that will each seek out and bind to a complementary DNA sequence in the sample. A series of probes bound to a DNA sample creates a distinctive pattern for an individual. Forensic scientists compare these DNA profiles to determine whether the suspects sample matches the evidence sample. The “product principle” is usually used in DNA typing
  • How is DNA typing done A marker by itself usually is not unique to an individual; if, however, two DNA samples are alike at 4 or 5 regions, odds are great that the samples are from the same person. If the sample profiles dont match, the person did not contribute the DNA at the crime scene. If the patterns match, the suspect may have contributed the evidence sample. While there is a chance that someone else has the same DNA profile for a particular probe set, the odds are exceedingly slim. .
  • How is DNA typing done The question is, How small do the odds have to be when conviction of the guilty or acquittal of the innocent lies in the balance? Many judges consider this a matter for a jury to take into consideration along with other evidence in the case. Experts point out that using DNA forensic technology is far superior to eyewitness accounts, where the odds for correct identification are about 50:50
  • How is DNA typing done The more probes (markers) used in DNA analysis, the greater the odds for a unique pattern and against a coincidental match. However, each additional probe adds greatly to the time and expense of testing. Four to 12 probes are recommended. Future DNA forensics is likely to use DNA chip technology (in which thousands of short DNA sequences are embedded in a tiny chip). This will enable much more rapid, inexpensive analysis using many more probes, and raising the odds against coincidental matches.
  • How is DNA typing done These "labs on a chip" will require only one millionth the quantity of DNA that is needed with current technology. The entire analysis will likely happen in a portable unit about the size of a briefcase, which contains everything needed to cut, amplify, tag, and analyze the DNA. This technology is expected to be available in few years to come This will allow crime scene investigators to process a DNA sample at the crime scene and get results within 10 minutes.
  • How does it work: SRT analysis  Need Crime Scene Samples & Reference  Samples DNA Extract and Purify  PCR reactions are performed in Eppendorf tubes. Typical volumes are measured in microliters (one millionth of a liter).  Groups of amplified STR products are labeled with different colored dyes (blue, green, yellow)
  • Profiler Plus: Raw data
  • Statistical estimates: the “product rule” 0.222 x 0.222 x 2 = 0.1
  • Statistical estimates: the product rule 1 in 10 x 1 in 111 x 1 in 20 = 0.1 1 in 22,200 1 in 100 x 1 in 14 x 1 in 81 1 in 113,400 1 in 116 x 1 in 17 x 1 in 16 1 in 31,552 1 in 79,531,528,960,000,000 1 in 80 quadrillion
  • Ivory DNA fingerprintingWe trace stolenivory to aparticularpopulation ofelephants byapplying DNAfingerprinting, atechnique thatanalyzessequences ofDNA known asmicrosatellites
  • Elephant Reference DNA We use 16 microsatellites
  • Illegal Ivory from TZ???
  • Illegal Ivory from TZ??? Monday, July 3, 2006, Kaohsiung Harbor, Taiwan—Routine automated scan of shipping manifests alerted the Taiwanese customs officials to two suspicious containers. Both had departed Tanzania and are at the port en route to the Philippines, having passed through Kaohsiung once before during the same voyage. The containers seemed to be shuttling back and forth between ports in the Far East with no apparent final destination. Officials check the hard-copy shipping documents, which reported that the containers held sisal fiber. “Exporting sisal fiber from Africa to the Philippines is like sending snowballs from Sweden to Siberia as the Philippines grows tons of the fibrous plant.
  • Illegal Ivory from TZ??? The inspectors decided to crack open one of the containers. Hidden behind 60 bales of sisal, they uncovered 744 elephant tusks. The second container held another 350 tusks. This was equivalent to 5.2 metric tons of illegal African ivory, with an estimated wholesale value of $4.6 million and a retail “street value” upward of $21 million.
  • Illegal Ivory from TZ??? Saturday, July 8, 2006, Sai Ying Pun, Hong Kong Island— Five days after the Taiwanese seizure, a local resident reports a terrible burning stench coming from a neighbor’s apartment. Police and fire units respond quickly. No one replies to their knocks on the door, so the units force their way in. They discover seven people cutting and packing what turns out to be 2.6 metric tons of elephant ivory. Hong Kong authorities seize 390 tusks plus another 121 cut pieces. Some clues indicate an East African origin.
  • In late June 2002, Zambia Wildlife Authorityofficers, Lusaka Agreement Task Force and theAnti-corruption Bureau of Malawi uncoveredvital information on shipment of a 20-foot • This container had 7container packed with illegal elephant ivory in crates packed withMalawi and destined for the Far East. contraband African elephant ivory weighing about 6.5 tones • Had 532 whole tusks and about 41,000 rough-carved 12-18 mm cylinders similar to those used for hanko Teaching opportunity signatures in the Far East
  • Inventory
  • Inventoring Packing and transportSampling
  • • Circles show the estimated location of origin of each sample, while crosses indicate locations of reference samples from savanna habitats used to make the assignments.Data point to arelatively narrowband of Southern • The actual locationsAfrica, centered on of the samples ofZambia, as the likely known origin aresource of tusks in highlighted inthis seizure green.
  • DNA profile for 7 genetic loci were developed fromthe dress stain containing high molecular weightDNA extracted from specimen 03341. Based onthe results of these seven genetic loci, andspecimen KLS. (CLINTON) is the source of theDNA obtained from specimen 03341-1, to areasonable degree of scientific certainty.
  • Saddam????
  • Other DNA technologies used in forensic investigations The DNA revolution began when scientists at Johns Hopkins discovered enzymes that cut DNA (restriction enzymes). This family of enzymes is important because each member of the enzyme family cuts DNA at a specific site. For example, the EcoR1 enzyme cuts DNA whenever it sees the letters GAATTC: DNA before EcoR1 cuts: AATCTAGGGAATTCACAGCGATGCGAATTCGCAATTA DNA after EcoR1 cuts: AATCTAGGG AATTCACAGCGATGCG AATTCGCAATTA
  • Some of the DNA technologies used in forensic investigations Restriction Fragment Length Polymorphism (RFLP) RFLP is a technique for analyzing the variable lengths of DNA fragments that result from digesting a DNA sample with a special kind of enzyme.  This enzyme, a restriction endonuclease, cuts DNA at a specific sequence pattern know as a restriction endonuclease recognition site.  The presence or absence of certain recognition sites in a DNA sample generates variable lengths of DNA fragments, which are separated using gel electrophoresis.  Generally, no two people have their DNA cut into pieces of exactly the same length because there are so many slight variations in each persons genes
  • DNA Restriction Enzymes•Evolved by bacteria to protect against viral DNA infection•Endonucleases = cleave within DNA strands•Over 3,000 known enzymes
  • Enzyme Site Recognition Restriction site Palindrone•Each enzyme digests (cuts) DNA at a specific sequence = restriction site•Enzymes recognize 4- or 6- base pair, palindromic sequences (eg GAATTC) Fragment 1 Fragment 2
  • 5 vs 3 Prime Overhang Enzyme cuts•Generates 5 prime overhang
  • Common Restriction EnzymesEcoRI– Eschericha coli– 5 prime overhangPstl– Providenciastuartii– 3 prime overhang
  • Restriction Fragment Length Polymorphism (RFLP)  RFLP is one of the original applications of DNA analysis to forensic investigation.  With the development of newer, more efficient DNA-analysis techniques, RFLP is not used as much as it once was because it requires relatively large amounts of DNA.  In addition, samples degraded by environmental factors, such as dirt or mold, do not work well with RFLP.
  • Early 1980s: Restriction Fragment Length Polymorphism (RFLP)  Genetic variation in the distance between restriction enzyme sites  Template DNA digested by enzymes, electrophoresed,Sir Alec Jeffreys detected via Southern blotting  Power of discrimination in the range of 106-108 for a six probe analysis
  • Mechanisms for RFLPs
  • RFLPs Scientists also uses a simple method, called Southern blotting, that shows the sizes of a persons DNA pieces. The example shows the Southern blots for three different people. Person #1 has had their DNA cut into two large pieces that show up on the blot.The larger piece is toward the top of the diagram. The DNA of persons #2 and #3 have been cut differently, because their DNA is not the same as that of person #1. After cutting, persons #2 and #3 have only a single piece of their DNA show up on the blot. Person #2 has the same large piece as person #1, but lacks the smaller piece. Person #3 has the smaller piece only.
  • Mid-1980s: The Colin PitchforkCase  Two young women raped and murdered in Narborough, England  5,000 local men are asked to provide blood/saliva samples  1st exoneration and conviction on forensic DNA evidence
  • The Catch: RFLP testing requires a relatively large amount of HMW DNA (~50ng = thousands of cells) Not ideal for forensic evidence, in which small, degraded samples are common
  • Some of the DNA technologies used in forensic investigations  Polymerase Chain Reaction = molecular Xeroxing  Three temperature phases,Dr. Kary Mullis carried out in a Thermal Cycler,Eccentric Genius replicate or “amplify” the desired DNA fragment(s)
  • Some of the DNA technologies used in forensic investigationsPCR Analysis  DNA amplification with PCR allows DNA analysis on biological samples as small as a few skin cells.  The ability of PCR to amplify such tiny quantities of DNA enables even highly degraded samples to be analyzed.  Great care, however, must be taken to prevent contamination PCR is used to make millions with other biological materials of exact copies of DNA from during the identifying, a biological sample collecting, and preserving of a sample.  Combined PCR-RFLP is widely used in forensic investigations.
  • PCR (cont’d) First forensic application is the DQα locus, later multi-plexed with Polymarker™ loci using dot-blot detection method Works with lower quantity (1-2ng), lower quality samples Power of discrimination goes from 102- 106...not good enough for databasing
  • Some of the DNA technologies used in forensic investigations  The Federal Bureau of Investigation (FBI) in US uses a standard set of 13 specific STR regions for Combined DNA Index System (CoDIS)  CoDIS is a software program that operates local, state, and national databases of DNA profiles from convicted offenders, unsolved crime scene evidence, and missing persons.  The odds that two individuals will have the same 13-loci DNA profile is about one in one billion.
  • The Combined DNA Index System (CoDIS) A database of DNA profiles from violent felons and crime scene samples Laws concerning who is eligible for the database vary from state to state Database currently contains about 2,038,470 felons and 93,956 crime scene profiles (19,00 hits so far)
  • The Mystical Power of CoDIS  Extremely powerful investigative tool, linking crimes, and pulling suspects out of thin air!  Can prevent, as well as solve crimes!
  • The Dark Side of CoDIS1. DNA mixtures and degraded DNA profiles have lead to spurious matches For example, an unknown mixture taken from a vaginal swab taken from the victim of a sexual assault profile with three alleles at the D21S11 locus, ex. (28, 30, 31) would “hit” on (28, 28), (28, 30), (28, 31), (30, 30), (30, 31), and (31, 31). A total of 6 genotypes If we designate an obligate or required allele (+), (28, 30+, 31)* would now hit only on the following genotypes: (28, 30), (30, 30), and (30, 31). We have reduced the number of hits at the D21S11 locus by half. Assigning obligate alleles at as many loci as possible can reduce the number of spurious hits to the offender database. * In this example, the victim was determined to be a (28, 31) at D21S11. Therefore, the 30 allele is foreign to the victim and presumed to be from the suspect2. Stringent laws explicitly permit databasing innocent people3. Adding arrestees to database violates presumption of innocence
  • “Specialized” PCR-based systems  mtDNA  Y-STRs  SNPs
  • Mitochondrial DNA (mtDNA)
  • Mitochondrial DNA Analysis Mitochondrial DNA analysis (mtDNA) can be used to examine the DNA from samples that cannot be analyzed by RFLP or STR. Nuclear DNA must be extracted from samples for use in RFLP, PCR, and STR; however, mtDNA analysis uses DNA extracted from another cellular organelle called a mitochondrion. The older biological samples that lack nucleated cellular material, such as hair, bones, and teeth, cannot be analyzed with STR and RFLP, can be analyzed with mtDNA. In the investigation of cases that have gone unsolved for many years, mtDNA is extremely valuable.
  • Mitochondrial DNA (mtDNA) Pros Single-cell sensitivity because each cell contains ~1000 mitochondria Especially useful for shed hairs, burnt remains Can be used to establish kinship directly because entire complement of mtDNA is maternally inherited
  • Mitochondrial DNA (mtDNA) Cons Single-cell sensitivity because each cell contains ~1000 mitochondria = very high contamination risk! Heteroplasmy - more than one mtDNA type manifesting in different tissues in the same individual Lower power of discrimination - maternal relatives all share the same mtDNA
  • Uses of mtDNA
  • MtDNA uses Since mtDNA has strictly maternal inheritance, this means mtDNA haplotypes should be shared by all individuals within a maternal family line. Mitochondrial DNA is thus useful for studying the evolution of closely related species Many studies are focused on the mitochondrial D-loop region which is the most variable part of mtDNA It has a higher substitution rate than in the rest of the mtDNA genome
  • Uses of mtDNA analysis Since all mothers have the same mitochondrial DNA as their daughters. Comparing the mtDNA profile of unidentified remains with the profile of a potential maternal relative can be an important technique in missing person investigations
  • Y-Chromosome Analysis The Y chromosome is passed directly from father to son The analysis of genetic markers on the Y chromosome is especially useful for tracing relationships among males or for analyzing biological evidence involving multiple male contributors
  • Y-STRs Problem: ~99% of violent crimes are committed by men DNA mixtures of male suspect and female victim can pose an analytical challenge, especially when the female DNA contribution is much greater than the male = preferential amplification Solution: Test for markers found only on the Y-chromosome. Only male DNA is amplified!
  • Y-STRs prons and cons1. Lower power of discrimination - paternal relatives all share the same Y-STR haplotype2. 10% of Central Asian males share the same Y-STR haplotype
  • Single Nucleotide Polymorphisms (SNPs) Point mutations (base substitutions) found in 1% or more of the population 1.8 million identified in human genome Detected on micro-array plates with fluorescent tags (all or nothing response)
  • SNPs (cont’d) ~50 SNPs provides same power of discrimination as 13 STR loci Certain SNPs are used as predictors of ancestry/ethnicity Characterizing the admixed African ancestry of African Americans, by Fouad Zakharia, Analabha Basu, Devin Absher, Themistocles L Assimes, Alan S Go, Mark A Hlatky, Carlos Iribarrenl, Joshua W Knowles, Jun Li, Balasubramanian Narasimhan, Steven Sidney, Audrey Southwick, Richard M Myersl, Thomas Quertermous, Neil Risch and Hua Tang Genome Biology 2009, 10:R141 doi:10.1186/gb-2009-10-12- r141
  • Fingerprints Vs DNA analysis  DNA is often compared with fingerprints in the way matches are determined.  When using either DNA or fingerprints to identify a suspect, the evidence collected from the crime scene is compared with a "known” standard.  If identifying features are the same, the DNA or fingerprint can be determined to be a match.  However, if identifying features of the DNA profile or fingerprint are different from the known standard, it can be determined that it did not come from that known individual.
  • Fingerprinting analysis Fingerprinting analysis has been used for more than a century and is still widely used in law enforcement agencies. Because of its unique characteristic, it is conclusive evidence and a valuable tool among advanced technology even today. However, there is a chance it might lose its ground by DNA fingerprint which is more sophisticated and accurate than traditional fingerprint.
  • Fingerprints: Friction Ridge skin Every person has minute raised ridges of skin on the inside surfaces of their hands, and fingers and on the bottom surfaces of their feet and toes - known as friction ridge skin. They are also known as "epidermal ridges" which are caused by the underlying interface between the dermal papillae of the dermis and the interpapillary (rete) pegs of the epidermis. These epidermal ridges serve to amplify vibrations triggered when fingertips brush across an uneven surface, transmitting the signals to sensory nerves involved in fine texture perception The friction ridges provide a gripping surface - in much the same way that the tread pattern of a car tire does. Friction ridge skin is also the only skin on the body without hairs.
  • Fingerprinting analysis There are three types of fingerprints that exist at crime scenes: Visible prints- made from finger stained with colored materials such as ink, blood, and grease. Plastic prints - formed by pressing onto a soft surface such as clay, soap, and wax and they are visible with naked eye and do not need no enhancement Latent print - invisible print left on an object by the body’s natural greases and oils. Because it cannot be seen by naked eyes, fingerprint powders, chemicals, and even lasers are used to make it visible on the crime scene evidence.
  • Latent Fingerprints Friction ridges have very small pores along their length that continuously exude perspiration. The perspiration forms a layer along the top of the ridges. When a person touches an object, a moist impression of the friction ridge pattern is left on that object. The phrase latent fingerprint is generally used to refer to a fingerprint, or partial fingerprint, which has been left at the scene of a crime. The degree to which a latent fingerprint is visible depends on the nature of the object touched and the conditions at the time the object was touched. Impressions made on smooth non-porous surfaces such as metal, glass or plastics are sometimes visible to the naked eye. Such prints can be developed with color contrasting powder that adheres to the moisture in the fingerprint.
  • Latent Fingerprints The developed fingerprints are recorded by photography, and sometimes also by lifting the impression with adhesive tape. Impressions made on porous objects such as paper, cardboard and unfinished timber are generally invisible. These prints can be detected and developed with special lighting, lasers, x-rays and a range of chemical processes. Once developed, the fingerprint is generally recorded by photography.
  • Fingerprinting analysis The fingerprints can be categorized into three basic formations, which are loops, arches, and whorl. Loops are lines that enter and exit on the same side of the print. Arches are lines that start on one side of the print, rise into hills and then exit on the other side of the print. Whorl is circles that do not exit on either side of the print. Looped prints and the most common account for around 60% of the world’s population
  •  Friction ridges do not run evenly  ridge ending - a ridge that ends and unbroken across our fingers, abruptly hands, toes and feet.  spur - a bifurcation with a short ridge They display a number of branching off a longer ridge characteristics known as  bifurcation - a single ridge that minutiae. divides into two ridges The principle categories of  dot - an independent ridge with minutiae are as follows: approximately equal length and width  lake or enclosure - a single ridge that bifurcates and reunites shortly afterwards to continue as a single ridge  short ridge, island or independent ridge - a ridge that commences, travels a short distance and then ends  crossover or bridge - a short ridge that runs between two parallel ridges.
  • Why use fingerprinting in criminal investigations? According to most professional criminal investigators, fingerprints obey three fundamental principles. These principles are:1. A fingerprint is an individual characteristic. It is yet to be found that prints taken from different individuals possess identical ridge characteristics.2. A fingerprint will remain unchanged during an individual’s lifetime.3. Fingerprints have general characteristic ridge patterns that permit them to be systematically classified
  • The Principles of Fingerprint Identification There are two fundamental principles underlying the use of fingerprints as a means of identifying individuals –1. Immutability: Friction ridge patterns do not change naturally during the life of a person. The pattern of minutiae starts developing in the third month of pregnancy and is fully formed by the fourth month. During a persons lifetime, the pattern remains the same, apart from changing in size or by accident, mutilation or skin disease, until death. In fact, the friction ridge patterns will remain after death until the body decomposes.
  • The Principles of Fingerprint Identification2. Uniqueness. Friction ridge detail forms in a purely random manner during fetal development in the womb. There is sufficient variability in the arrangement of minutiae to ensure that no two friction ridge patterns are identical, whether they are on different fingers of the same person or on the fingers of different people. While this principle is difficult to prove empirically, no two fingerprints have ever been found to be identical in over a century of the use of fingerprinting >hundreds of millions fingerprinted worldwide. Additionally, studies have demonstrated that while identical twins share the same DNA profile markers, they can nevertheless be differentiated by their fingerprints
  • Methods of fingerprint detection Crime scene fingerprints may be detected by simple powders or chemicals applied at the crime scene or by using chemical techniques applied in specialist laboratories to appropriate articles removed from the crime scene. These labs are very advanced and sophisticated detecting now 50% or more of the total crime scene fingerprints in the world To date about 20 effective methods are currently in use in the more advanced fingerprint laboratories around the world. Some of the techniques such as the use of Ninhydrin, Diazafluorenone, and Vacuum Metal Deposition show quite surprising sensitivity and are used operationally to great effect.
  • Methods of fingerprint detection Ninhydrin or Diaza-fluorenone react with amino acids. Others such as ethyl cyanoacrylate polymerisation, work by water-based catalysis and polymer growth. These methods are very specific Vacuum metal deposition use gold and zinc and are non-specific but detect fat layers as thin as one molecule. Wide range of fluorescence techniques have also been introduced, primarily for the enhancement of chemically developed fingerprints and also for detection of inherent fluorescence of the latent fingerprints
  • Livescan devices There are different types of fingerprint readers on the market, which all measure in some way the physical difference between ridges and valleys. There are two major families of these devices: solid-state fingerprint readers and optical fingerprint readers. 3D fingerprint scanners have now been developed which employ the detailed 3D information to rovide very high resolution
  • Fingerprints reveal drug use The secretions, skin oils and dead cells in the fingerprint contain residues of various chemicals and their metabolites present in the body which can be detected and used for forensic purposes. E.g. fingerprints of tobacco smokers contain traces of cotinine, a nicotine metabolite; they also contain traces of nicotine itself NB: This is sometimes ambiguous as its presence may be caused by mere contact of the finger with a tobacco product. By treating the fingerprint with gold nanoparticles with attached cotinine antibodies, and then subsequently with fluorescent agent attached to cotinine antibody antibodies, a fingerprint of a smoker becomes fluorescent; non-smokers fingerprints stay dark. The same approach is being investigated to be used for identifying heavy coffee drinkers, cannabis smokers, and users of various other drugs. In 2008 English researchers developed methods of identifying users of marijuana, cocaine and methadone from their fingerprints
  • Word of wisdom Alexander Hamilton Men give me some credit for genius, but all of the genius I have lies in this. “I explore it in all its bearings”. When I have a subject in mind, I study it profoundly, day and night it is before me. My mind becomes pervaded with it. The result is what some people call the fruits of genius, whereas it is in reality the fruits of study and labor(as quoted in Sterling W. Sill, The Upward Reach, p. 125).
  • Validity of fingerprinting for identification The validity of forensic fingerprint evidence is still being challenged by academics, judges and the media. While fingerprint identification was an improvement over earlier anthropometric systems, the subjective nature of matching, despite a very low error rate, has made this forensic practice controversial. Their assessment is still unreliable (successive tests should bring the same results) and their validity (results should accurately reflect the external criteria being measured) is questionable These specific criticisms are now being accepted by some leaders of the forensic fingerprint community, providing an incentive to improve training and procedures.
  • The Importance of Hard Work Thomas Alva Edison (1847-1931): “There is no substitute for hard work.” I am grateful to my parents for teaching me the value of hard work and the importance of self-education
  • Dans les champs de lobservation lehasard ne favorise que les espritspréparés (Inaugural lecture,University of Lille, December 7, 1854In the fields of observation Louis Pasteur“chance favors (1822-1895only the prepared mind”