Your SlideShare is downloading. ×
0
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Dna forensic
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Dna forensic

4,562

Published on

Published in: Technology, Education
0 Comments
3 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
4,562
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
221
Comments
0
Likes
3
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  1. Forensic DNAAnalysis
  2. Summary  What is DNA?  Where is DNA found in the body?  How does DNA differ among individuals?  Forensic DNA Analysis  DNA and Statistics
  3. What is DNA?
  4. What is DNA?What does DNA stand for?Deoxyribose Nucleic Acid or Deoxyribonucleic Acid What does DNA do? • DNA contains genetic information. • DNA codes for the proteins our bodies make that are necessary for survival.
  5. What is DNA?DNA is a code for making proteins AGC TAG CTT ATA CTC TAT CTC TTT Amino Amino Amino Amino Amino Amino Acid Acid Acid Acid Acid Acid The order of amino acids determines what type of protein is made.
  6. What is DNA?Some common proteins are: Hemoglobin - carries oxygen from lungs to cells Insulin - regulates metabolism Many types of enzymes - catalyze reactions in the body, such as the breakdown of sugar for energy DNA also determines how much of these proteins each cell makes.
  7. What is DNA?What does DNA look like? Double Helix Like a Twisted Ladder
  8. What is DNA?What does DNA look like? Sugar Phosphate Backbone (Sides of Ladder) Nitrogenous Base (Rungs of Ladder)
  9. What is DNA?The DNA ladder is made up of building blocks called nucleotides.What is a nucleotide? Adenine Phosphate Group Cytosine Base Guanine Thymine Deoxyribose sugar
  10. The 4 Bases A C Adenine Cytosine G T Guanine Thymine
  11. The 4 Bases A C G T
  12. The 4 Bases The bases pair up to form the rungs of the ladder. A pairs with T G pairs with C
  13. What is DNA?DNA is written as the sequence of these bases: AAGTCGATCGATCATCGATCATACGT • Only one side of the ladder is written. • In humans, there are three billion (3,000,000,000) base pairs (letters) in the DNA within each cell.
  14. What is DNA?Among humans, most of the 3 billion bases in the DNA sequence are exactly the same. • Our Human DNA is 99.8% similar to each other, but the 0.2% difference is more than enough to distinguish us from one another. • Human DNA is even 98% similar to chimpanzees. • NO TWO PEOPLE HAVE IDENTICAL DNA* *except identical twins
  15. What is DNA?Stupid Facts: • If two different people started reciting their individual genetic code at a rate of one letter per second, it would take almost eight and a half minutes before they reached a difference. • If unwound and tied together, the strands of DNA in one cell would stretch almost six feet but would be only 50 trillionths of an inch wide. • If all the DNA in your body was put end to end, it would reach to the sun and back over 600 times (100 trillion times six feet divided by 92 million miles).
  16. Where is DNA?
  17. Where is DNA?DNA is found in the cells in our body. Nucleus (Brain of the cell) Mitochondria (more later)
  18. Where is DNA?All types of cells in our body contain a copy of the same DNA.Some cells important to forensic science are: White Blood Cell Sperm Cell Cheek Cell
  19. Where is DNA?DNA in the nucleus is packaged into Chromosomes
  20. Where is DNA?Chromosomescome in pairs(one from Mother)(one from Father) There are 46chromosomes in each cell. (23 pairs)
  21. Where is DNA?What are sources of DNA at a crime scene? DNA can be recovered from any substance that contains cells. • Blood • Bone • Semen • Teeth • Saliva • Hair • Tissue • Maggot Crops
  22. Maggot Crop
  23. How does DNA differamong Humans?
  24. How does DNA differ among humans? DNA is a sequence of 4 possible letters A G C T Of the 3 billion letters, 99.8% of the sequence in all humans is identical.There are several ways the sequence can be different.
  25. How does DNA differ among individuals?1. One of the bases (letters) can be different.Person 1 AGCTAGATCGTTATTCCGAG Person 2 AGCTAGATCGTCATTCCGAG
  26. How does DNA differ among individuals?2. Bases (letters) can be added or removed.Person 1 AGCTAGATCGTTATTCCGAGPerson 2 AGCTAGATCGTATTCCGAGPerson 3 AGCTAGATCGTTTATTCCGAGPerson 4 AGCTCCGAG
  27. How does DNA differ among individuals?2. Bases (letters) can be added or removed.Person 1 AGCTAGATCGTTATTCCGAGPerson 2 AGCTAGATCGTATTCCGAGPerson 3 AGCTAGATCGTTTATTCCGAGPerson 4 AGCTCCGAG
  28. How does DNA differ among individuals?3. Regions of DNA can be repeated a different # of timesPerson 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..
  29. How does DNA differ among individuals?3. Regions of DNA can be repeated a different # of timesPerson 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 6Person 2 ..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5Person 3 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT..1 2 3 4 5 6
  30. Forensic DNAAnalysis
  31. Forensic DNA AnalysisCollection of EvidenceTypes of Unknown Samples: • Blood, Semen, Stains, Saliva • Hair, Tissue, Bones, TeethTypes of Known Samples: • Blood or buccal swabs from suspect or victim or other known person
  32. Forensic DNA Analysis Beware of ContaminationContamination occurs when DNA from another source gets mixed in with the sample being collected. • An investigator touches, sneezes, bleeds on a sample. • Wear gloves and use disposable instruments • Package items separately. • Especially, do not mix known samples (from victim or suspect) with unknown samples.
  33. Forensic DNA AnalysisPackaging Evidence • Package each item individually. • Put evidence into paper bags, not plastic. • Moisture degrades DNA; air dry samples. • Keep samples at room temperature and out of sun.
  34. Forensic DNA Analysis Brief History of DNA- (1985) Multilocus RFLP Detects VNTRs:Variable Number of Tandem Repeats
  35. Forensic DNA AnalysisBrief History of DNA(Late 80s, Early 90s) Single locus RFLP D2S44 probe Lanes 6 and 10 match Lanes 8 and 11 match
  36. Forensic DNA Analysis Brief History of DNA(Early 90s)PCR Strips (DQ alpha) 6 Alleles: 1.1, 1.2, 1.3 2, 3 or 4 A person can have one or two of these numbers.
  37. Forensic DNA AnalysisTwo main types of analyses (90s - Present) :Short Tandem Repeats (STRs) • Individual identification possible • Samples: Blood stains, semen Mitochondrial DNA • Used in cases of severely degraded DNA • Individual identification not possible • Samples: Bones, hair shafts
  38. Forensic DNA AnalysisShort Tandem Repeats (STRs) • Currently the most used of all forensic markers • Individual identification possible • Type of data used in the FBI CODIS database • People differ in length at these loci • Are located in the nuclear DNA (chromosomes)
  39. Forensic DNA Analysis Short Tandem Repeats (STRs) Regions of DNA can be repeated a different # of timesPerson 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 6Person 2 ..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5Person 3 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT..1 2 3 4 5 6
  40. Forensic DNA AnalysisShort Tandem Repeats (STRs)Locus or Loci:Refers to the location on the chromosome.Allele:Refers to the type of DNA.For STRs, the allele will be the number of repeats. CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC
  41. Forensic DNA AnalysisExample Locus: D5S818 Alleles: 7,9 Paternal chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATCC Maternal chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC
  42. Forensic DNA Analysis 13 loci used in CODISSTR Marker Chromosome Repeat Sequence Repeat units Other Alleles TPOX 2 AATG 6 - 14 CSF1PO 5 AGAT 6 - 15 10.3 D5S818 5 AGAT 7 -15 D7S820 7 GATA 6 - 14 D8S1179 8 TATC 8 - 19 D13S317 13 TATC 7 - 15 D16S539 16 GATA 5, 8 - 15 D3S1358 3 TCTA* 9, 11- 20 15.2, 16.2 FGA 4 CTTT* 15 - 30 16.2 -30.2 22.3, 34.2, 46.2 TH01 11 AATG* 3, 5 - 12 8.3, 9.3, 10.3, 13.3 VWA 12 TCTA* 11 - 22 15.2 D18S51 18 AGAA* 8 - 27 13.2, 14.2, 15.2 17.2, 19.2 D21S11 21 TCTA* 24 - 38 24.2 - 35.2
  43. Forensic DNA AnalysisBasic Steps in AnalysisExtraction:• Separates DNA from sampleAmplification or PCR:• Amplifies small portions of DNA (STR regions)Separation:• Separates amplified fragments according to size.
  44. PCR Hood
  45. Forensic DNA AnalysisBasic Steps in AnalysisExtraction:• Separates DNA from sampleAmplification or PCR:• Amplifies small portions of DNA (STR regions)Separation:• Separates amplified fragments according to size.
  46. The Thermal Cycler Amplifies DNA
  47. Forensic DNA AnalysisBasic Steps in AnalysisExtraction:• Separates DNA from sampleAmplification or PCR:• Amplifies small portions of DNA (STR regions)Separation:• Separates amplified fragments according to size.
  48. FMBio Separates Amplified DNA
  49. Forensic DNA AnalysisColor image of gel
  50. Forensic DNA AnalysisGel Electrophoresis Black and white image of STR gel.Samples will haveone or two bands at each loci.
  51. ABI 310 Genetic Analyzer Separates Amplified DNA
  52. Forensic DNA AnalysisCapillary ElectrophoresisSample will have one or two peaks at each loci.
  53. Forensic DNA AnalysisCompare to a ladder that has all peaks at each loci.
  54. Forensic DNA Analysis
  55. Forensic DNA Analysis TPOX CSF1PO D5S818 D8S1179 Blood stain 7,9 10,13 7,15 8,8 Suspect 1 8,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 3 7,9 10,13 7,15 8,8
  56. Forensic DNA (mitochondria)Mitochondria - The powerhouse of the cell. Mitochondria have Mitochondria their own DNA
  57. Forensic DNA (mitochondria)Mitochondrial DNA Double Helix Chromosomes Ring of DNA YES NO YES
  58. Forensic DNA (mitochondria)Mitochondrial DNA Mitochondrial DNA is only 16,569 letters long. (compared to 3 billion in nuclear DNA) There is a 900 base pair region with a 1.7% difference (D loop).
  59. Forensic DNA (mitochondria)Nuclear DNA vs. Mitochondrial DNADouble Helix Double Helix46 Chromosomes One Ring Multiple copies inOne copy per cell each mitochondria Multiple mitochondria in each cell MtDNA used for old or degraded samples
  60. Forensic DNA (Mitochondria)For nuclear DNA: Length is measuredFor mtDNA: Sequence is examined Different colored peaks correspond to a different base
  61. Forensic DNA AnalysisBasic Steps in AnalysisExtraction:• Separates DNA from sampleAmplification or PCR:• Amplifies small portion of mtDNA (D loop)Sequencing:• Sequence is determined by another reaction and separation of sequenced fragments
  62. Forensic DNA (Mitochondria)DNA Sequences are compared to each other.Hair found on Suspect AGCTAGATCGTTATTCCGAG Victim AGCTAGATCGTTATTCCGAG Conclusion: Hair may have come from the victim.
  63. Forensic DNA (Mitochondria)DNA Sequences are compared to each other.Hair found on Suspect AGCTAGATTGTTATTCCGAG Victim AGCTAGATCGTTATTCCGAG Conclusion: Hair did not come from the victim
  64. Forensic DNA (Mitochondria)Cigarette buttat crime scene AGCTAGATTGTTATTCCGAG Suspect #1 AGCTAGATCGTTATTCCGAG Suspect #2 AGCTAGATTGTTATTCCGAG Suspect #3 AGCTTGATTGTTATTCCGAG Suspect #4 AGCTAGATTGTTATTCCGAG Conclusion: Cigarette could be from Suspects #2, #4 or other person with the same sequence.
  65. DNA and StatisticsThe final result is presented as a statistic.Do not say:“The DNA in the bloodstain is John Doe’s DNA.”Do Say:“The chance that another person has this DNA in the bloodstain is 1 in 300 billion.”
  66. DNA and StatisticsWhere do the statistics come from?First, the frequency of each allele is estimated using data from a population data base. Allele frequency Locus: D5S818 from database 7 26% Alleles: 7,9 9 11%
  67. DNA and StatisticsWhere do the statistics come from?Next, the frequency of the genotype at each locus is calculated. Locus: D5S818 Genotype frequency 7,9 6% Alleles: 7,9
  68. DNA and StatisticsFor total frequency, multiply all of the frequencies together. D5 = 6% D8 = 12% D18 = 0.5% Total = 0.004%
  69. CSF1PO TPOX 7 0.00 6 0.00 8 0.00 7 0.00 9 0.03 8 0.5310 0.25 9 0.0911 0.31 10 0.0612 0.33 11 0.2813 0.06 12 0.0414 0.01 13 0.0015 0.00 TH01 vWA 5 0.01 13 0.00 6 0.24 14 0.13 7 0.15 15 0.08 8 0.12 16 0.21 9 0.16 17 0.279.3 0.33 18 0.2010 0.01 19 0.0911 0.00 20 0.02 21 0.00
  70. D16S539 D7820 7 0.00 6 0.00 8 0.03 7 0.01 9 0.11 8 0.1610 0.08 9 0.1511 0.32 10 0.3012 0.27 11 0.2013 0.17 12 0.1214 0.03 13 0.0615 0.00 14 0.01 D13S317 D5S818 7 0.00 7 0.00 8 0.14 8 0.00 9 0.05 9 0.0110 0.05 10 0.0611 0.31 11 0.3712 0.31 12 0.3513 0.08 13 0.1914 0.06 14 0.0115 0.00 15 0.00
  71. Demonstration Calculating Frequencies

×