Your SlideShare is downloading. ×
Estructura y función del ADNEQUIPO 11INTEGRENTES#1 CYNTHIA GUADALUPE ACEVEDO AGUILAR#14 PAOLA LIZETTE HERNANDEZ GUERRERO
Historia del descubrimiento de la moléculaExperimentos clásicos en torno a mitosisAcetabularias deHämmerling yBrachet (193...
1869 Friedrich Miescher descubre loque hoy conocemos como ADN
Fleming Beneden y Strasburger describen en 1890la destribución cromosómica durante la divisióncelular.Walther Flemming
1910 Thomas Hunt Morgandemuestra que los genes residenen los cromosomas
1933 Jean Brachet demuestra que el ADN se encuentra enlos cromosomas y que el ARN está presente en elcitoplasma de todas l...
¿El material genético es ADN ouna proteína?Experimento de Griffith (1920)Trató de obtener una vacuna para proteger a la ge...
1. Inyectó bacterias encapsuladas vivas.Resultado: Los ratones contrajeronneumonía y murieron. La sangrecontenía bacterias...
¿Qué significaban losexperimentos?Una hipótesis era que las bacterias vivashabían adquirido moléculas de informacióngenéti...
¿La molécula de latransformación era el ADN?
Avery, MacLeod y McCarty de la UniversidadRockefeller en 1944 aislaron ADN de bacteriasencapsuladas, las mezclaron con bac...
1944 Oswald Theodore Avery, Colin McLeod y Maclyn McCarty aíslan ADN comomaterial genéticoColin MacLeod, Maclyn McCarty, D...
1944 Oswald Theodore Avery, Colin McLeod y MaclynMcCarty aíslan ADN como material genéticoOswald T. Avery (1940s)
Historia de la genética1950 Erwin Chargaff muestra que los cuatro nucleótidos no están presentes en los ácidos nucleicosen...
El ADN es la molécula que contiene la información genéticaHershey & Chase
Lab rats ... James Watson, above left, and Francis Crick werentgoing to let Rosalind Franklin get in the way of scientific...
Durante 50 años, la historia de la ciencia hasostenido que los descubridores de la doble hélicedel ADN fueron Crick y Wats...
El ADN de loscromosomas se componede dos cadenas enrolladasuna a la otra en una doblehélice.Los azúcares y fosfatosque une...
Solo paresespecíficos debases, llamadospares de basescomplementarias,se pueden unir enla hélice medianteenlaces dehidrógen...
COMPOSICIÓN DEL ADNLa molécula de ADN estácompuesta de subunidades,llamadas nucleótidos,unidos en cadenas largas.Cada nucl...
Bases NitrogenadasEn el ADN sepresentan cuatro basesdiferentes:AdeninaGuaninaTiminaCitosina
MOLÉCULA DE ADN
DIMENSIONESDEL ADN
REPLICACIÓN DEL ADNLa clave de la constanciaPROCESO
La replicación del ADNEs el proceso mediante elcual la molécula de ADNhace copias de sí misma(y, por tanto delcromosoma).E...
Pasos de la replicación del ADNLa doble hélice se desdobla de modo que las dos cadenas de nucleótidos quedanparalelas y se...
Pasos de la replicación del ADNSe forman enlaces entre los fosfatos y los azúcares de losnucleótidos que se han apareado c...
1958 El experimento Meselson-Stahl demuestra que el ADN se replica de modo semiconservador.
Historia de la genética1956 Joe Hin Tjio y Albert Levan establecen en 46 el número de cromosomas en humanosJoe Hin Tjio. A...
Estructura de un cromosoma
¿Qué es un gen?Es una secuencia de nucleótidos en lamolécula de ADN, equivalente a una unidadde transcripción.Contiene la ...
DOGMA CENTRAL DE LA BIOLOGÌA MOLECULARDOGMA CENTRAL DE LA BIOLOGÌA MOLECULARHebra moldeHebra moldeTranscripciónTranscripci...
Naturaleza del material hereditario.Los ácidos nucleicos y sus componentesNaturaleza del material hereditario.Los ácidos n...
También pueden ser pirimidinas, de anillosencillo, como la timina y la citosina, en elADN; y la citosina y el uracilo en e...
Pentosa del ADN: DesoxirribosaPentosa del ADN: DesoxirribosaATENCIÒN: Unhidrógeno en laposición 2’ATENCIÒN: Unhidrógeno en...
DesoxirribunucleótidoDesoxirribunucleótido
La molécula de ADN es una doble héliceantiparalela (Watson y Crick 1953)La molécula de ADN es una doble héliceantiparalela...
Fosfatos vanunidos al azúcaren el C-5’ y el C-3’Fosfatos vanunidos al azúcaren el C-5’ y el C-3’HebrasantiparalelasHebrasa...
La función codificante del ADN estádeterminada por la secuencia de susnucleótidos (bases)La función codificante del ADN es...
Hebra moldeHebra moldeHebra líderHebra líderHebra retardadaHebra retardadaEL ADN es la molécula que permite perpetuar la v...
ReplicaciónLas ADN polimerasas requieren comosustrato la punta 3’ hidroxilo libre deuna base apareada para catalizar launi...
ADN polimerasas, ligasas….ADN polimerasas de alta fidelidad dirigidaspor ADN: dos de ellas replican loscromosomas, (α) esp...
ADN-polimerasas…..ADN polimerasas propensas a errores dirigidaspor ADN: un grupo grande que replica con muy bajafidelidad....
Proteinas principales replicaciónTopoisomerasas: rompen una hebra y la tensión delenrrollamiento de la hélice se relajaHel...
Estructura tridimensional de una helicasa: un hexámero conseis sitios de enlace al ATP. La hidrólisis secuencial deestos A...
La ADN polimerasa
Síntesis del primer de ARN por una primasa
En eucariontes losfragmentosde Okasaki tienen 200nucleótidos,los primers unos 10.Los iniciadores de ARN seeliminan mediant...
La ligasa acopla la hidrólisis de un ATP para hacermás favorable la reacción de unión entre el fosfato y elhidroxilo libre...
Efecto de las proteínas de enlace con la hebra sencilla del ADN
Estructura de las proteinas de enlace a la hebra sencillaModelo de la proteína humana
Horquilla de replicación en los mamíferos: Dos polimerasasdiferentes en la hebra retardada, primero empieza la pol αsintet...
Reparación del ADN
Tipos de daño al ADNMecanismos endógenos:1. Pérdida de bases tipo purinas por rupturaespontánea del enlace con el azúcar50...
Agentes extracelulares1. Radiaciones ionizantes: rayos gamma yrayos X causan rupturas en la doble hélice2. Luz UV causa la...
11_21.jpg
11_21_2.jpg
Mecanismos de detección y reparaciónde daños al ADN• Sistemas enzimáticos para reconocer,eliminar y reparar daños inducido...
Capitulo 14: del ADN a las proteínas
Transmisión de la informaciónLa transmisión se lleva a caboprincipalmente gracias a la existencia de losácidos ribonucleic...
RibonucleótidoRibonucleótidoATENCION:Grupo hidroxiloen la posición 2’ATENCION:Grupo hidroxiloen la posición 2’
URACILO sustituye a la TIMINAURACILO sustituye a la TIMINALa secuencia correspondiente a una unidad detranscripción en el ...
TRANSCRIPCIÒNTRANSCRIPCIÒNLa ARN polimerasase activa cuandoforma un complejocon los factores detranscripción oelementostra...
Región reguladora EXON 1 EXON 2 EXON 3 EXON 4 EXON n Región reguladoraPROMOTOR5` 3`Intrón 1 Intrón 2 Intrón 3Unidad de tra...
Procesamiento postranscripcional del ARNCorte en 5’ y unión de un “cap”(5-metilguanosina),para proteger del ataque de las ...
ARN de transferencia activado:cargado con el aminoácidocorrespondienteARN de transferencia activado:cargado con el aminoác...
CODIGOGENETICOARNmCODIGOGENETICOARNm
DOGMA CENTRAL DE LA BIOLOGÌA MOLECULARDOGMA CENTRAL DE LA BIOLOGÌA MOLECULARHebra moldeHebra moldeTranscripciónTranscripci...
TRADUCCIÓNARN --- ProteínaTRADUCCIÓNARN --- Proteína
Cuatro monómeros de aminoácidosReacción decondensaciónPolipéptidoEnlace peptídico catalizado por el complejo enzimático lo...
01_03.jpgEstructura general de un aminoácidoPOLARES CargadosSus moléculas están parcialmente cargadas
01_03_2.jpgPolares neutrosEn sus residuos tienen grupos aminos, hidroxilos o sulfidrilos
01_03_3.jpgNo polares o hidrofóbicos
Estructura primaria(Secuencia lineal)Residuos de los distintos aminoácidosEstructura secundaria(forma adoptada espontáneam...
Estructura cuaternaria: combinación de monómeros
Anemia falciforme:HemoglobinaHbA se transformaen HbSLa mutación es uncambio del segundonucleótido en elcodón 6 en lasubuni...
Variaciones en la secuencia de bases del ADN que no causanalteraciones funcionales patológicas, son alelos opolimorfismos ...
MutacionesGerminales o constitucionales:El individuo las adquiere por herencia de sus padres, puedeocurrir de novo en una ...
•Clases de mutaciones:Sustitución de bases:1- Sustituciones sinónimas (otro codón : mismo aa)2- Mutaciones sin sentido (ca...
•Otros tipos de mutaciones:a- Mutaciones de cambio en el marco de lectura- deleciones- duplicaciones o insersionesb- Mutac...
16_01.jpgPérdida de función del gen PAX3: Síndrome de Waardenburg tipo I,sordera y anormalidades pigmentariasDiferentes ti...
Cambio fenotípico por dos mecanismos:1- pérdida o reducción de la función normal.2- el producto podría adquirir una nueva ...
Mutaciones hereditarias:¿Dominante o recesiva?Mutaciones recesivas llevan a un producto génico confunción reducida o con p...
•Clases de mutaciones:Sustitución de bases:1- Sustituciones sinónimas (otro codón : mismo aa)2- Mutaciones sin sentido (ca...
•Otros tipos de mutaciones:a- Mutaciones de cambio en el marco de lectura- deleciones- duplicaciones o insersionesb- Mutac...
16_01.jpgPérdida de función del gen PAX3: Síndrome de Waardenburg tipo I,sordera y anormalidades pigmentariasDiferentes ti...
Cambio fenotípico por dos mecanismos:1- pérdida o reducción de la función normal.2- el producto podría adquirir una nueva ...
Mutaciones hereditarias:¿Dominante o recesiva?Mutaciones recesivas llevan a un producto génicocon función reducida o con p...
Variabilidad de los genesGen Tamaño N° exonesARNt 100 pb 2β-globina 1.600 pb 3colágenoVII 31.000 pb 118Distrofina 2.400.00...
ProteomaEs el set de genes que codifican para proteínasDistribución por su función en el GH:Procesos ADN (replic, trans, t...
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Adn 100527180742-phpapp01
Upcoming SlideShare
Loading in...5
×

Adn 100527180742-phpapp01

407

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
407
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • 01_03_1.jpg
  • 01_03_2.jpg
  • 01_03_3.jpg
  • Transcript of "Adn 100527180742-phpapp01"

    1. 1. Estructura y función del ADNEQUIPO 11INTEGRENTES#1 CYNTHIA GUADALUPE ACEVEDO AGUILAR#14 PAOLA LIZETTE HERNANDEZ GUERRERO
    2. 2. Historia del descubrimiento de la moléculaExperimentos clásicos en torno a mitosisAcetabularias deHämmerling yBrachet (1930 -1940)
    3. 3. 1869 Friedrich Miescher descubre loque hoy conocemos como ADN
    4. 4. Fleming Beneden y Strasburger describen en 1890la destribución cromosómica durante la divisióncelular.Walther Flemming
    5. 5. 1910 Thomas Hunt Morgandemuestra que los genes residenen los cromosomas
    6. 6. 1933 Jean Brachet demuestra que el ADN se encuentra enlos cromosomas y que el ARN está presente en elcitoplasma de todas las células1941 Edward Lawrie Tatum yGeorge Wells Beadlemuestran que los genescodifican las proteínas
    7. 7. ¿El material genético es ADN ouna proteína?Experimento de Griffith (1920)Trató de obtener una vacuna para proteger a la gentecontra la bacteria Streptococcus pneumoniae, queproduce la neumonía. No tuvo éxito, perodescubrió el fenómeno de la transformación.Griffith descubrió dos variedades de Streptococcus, unacon cápsula y otra desnuda. Propuso la hipótesisque la cápsula afecta la capacidad de las bacteriaspara causar la enfermedad y experimentó conratones de la siguiente manera:
    8. 8. 1. Inyectó bacterias encapsuladas vivas.Resultado: Los ratones contrajeronneumonía y murieron. La sangrecontenía bacterias encapsuladas.2. Inyectó bacterias desnudas vivas.Resultado: Permanecieron saludables.No se encontraron Streptococcus en lasangre.3. Inyectó bacterias encapsuladasmuertas.Resultado: Los ratones no tuvieronneumonía y carecían de bacteriasvivas.4. Inyectó una mezcla de bacteriasencapsuladas muertas y bacterias desnudasvivas.Resultado: Tuvieron neumonía y estabaninfestados de bacterias encapsuladas vivasque crecieron
    9. 9. ¿Qué significaban losexperimentos?Una hipótesis era que las bacterias vivashabían adquirido moléculas de informacióngenética provenientes de las bacteriasmuertas.Las moléculas codificaban las instruccionespara formar cápsulas; por lo tanto,transformaban a las bacterias desnudas enbacterias encapsuladas.
    10. 10. ¿La molécula de latransformación era el ADN?
    11. 11. Avery, MacLeod y McCarty de la UniversidadRockefeller en 1944 aislaron ADN de bacteriasencapsuladas, las mezclaron con bacteriasdesnudas vivas y produjeron bacteriasencapsuladas vivas.Para demostrar que la transformación laocasionaba el ADN, y no pequeñas cantidades deproteínas que contaminan al ADN, tratarondiferentes muestras con enzimas que destruyenproteínas.Dichas enzimas no afectaron la capacidad detransformación de las muestras de ADN; por otrolado, al tratar muestras con enzimas que destruyenel ADN, se impidió la transformación.
    12. 12. 1944 Oswald Theodore Avery, Colin McLeod y Maclyn McCarty aíslan ADN comomaterial genéticoColin MacLeod, Maclyn McCarty, Detlev Wulf Bronk,Theodosius Dobzhansky, and Wendell M. Stanley at theAvery Memorial Gateway dedication ceremony
    13. 13. 1944 Oswald Theodore Avery, Colin McLeod y MaclynMcCarty aíslan ADN como material genéticoOswald T. Avery (1940s)
    14. 14. Historia de la genética1950 Erwin Chargaff muestra que los cuatro nucleótidos no están presentes en los ácidos nucleicosen proporciones estables, pero que parecen existir algunas leyes generales. La cantidad deadenina, A, por ejemplo, tiende a ser igual a la de timina,ATGCTTATTCTACGAATAAGA = TC = G1905 - 2002)
    15. 15. El ADN es la molécula que contiene la información genéticaHershey & Chase
    16. 16. Lab rats ... James Watson, above left, and Francis Crick werentgoing to let Rosalind Franklin get in the way of scientific glory.Photo-illustration: Harry Afentoglou
    17. 17. Durante 50 años, la historia de la ciencia hasostenido que los descubridores de la doble hélicedel ADN fueron Crick y Watson. En los últimos años,las investigaciones han sacado a la luz la labor deRosalind Franklin, sin cuyas radiografías suscolegas no hubieran llegado tan rápido a la meta.Hoy se puede decir que si éstos son los «padres»del hallazgo de la estructura helicoidal de lamolécula, Franklin merece ser considerada la«madre».Rosalind Franklin
    18. 18. El ADN de loscromosomas se componede dos cadenas enrolladasuna a la otra en una doblehélice.Los azúcares y fosfatosque unen un nucleótido alsiguiente forman elesqueleto en cada lado dela doble hélice.En tanto que las bases decada cadena se aparean enel centro de la hélice.
    19. 19. Solo paresespecíficos debases, llamadospares de basescomplementarias,se pueden unir enla hélice medianteenlaces dehidrógeno: adeninacon timina yguanina concitosina.
    20. 20. COMPOSICIÓN DEL ADNLa molécula de ADN estácompuesta de subunidades,llamadas nucleótidos,unidos en cadenas largas.Cada nucleótido consta deun grupo fosfato, un azúcarde cinco carbonos, ladesoxirribosa y, una basenitrogenada.
    21. 21. Bases NitrogenadasEn el ADN sepresentan cuatro basesdiferentes:AdeninaGuaninaTiminaCitosina
    22. 22. MOLÉCULA DE ADN
    23. 23. DIMENSIONESDEL ADN
    24. 24. REPLICACIÓN DEL ADNLa clave de la constanciaPROCESO
    25. 25. La replicación del ADNEs el proceso mediante elcual la molécula de ADNhace copias de sí misma(y, por tanto delcromosoma).En el núcleo hay muchosnucleótidos libres que sonlos bloques deconstrucción del nuevoADN .
    26. 26. Pasos de la replicación del ADNLa doble hélice se desdobla de modo que las dos cadenas de nucleótidos quedanparalelas y se rompen los enlaces entre las bases. Las dos cadenas de nucleótidosse separan, empezando en un extremo y abriéndose hasta el otro.Cada mitad de la molécula sirve como un molde para la formación de una nuevamitad del ADN. Las bases de los nucleótidos libres se unen con las basescorrespondientes en las dos cadenas de nucleótidos expuestas. La unión específicade A con T y de C con G, asegura que las copias nuevas de ADN sean copiasexactas del original.
    27. 27. Pasos de la replicación del ADNSe forman enlaces entre los fosfatos y los azúcares de losnucleótidos que se han apareado con las cadenas de ADN. Elresultado es que se forman dos copias idénticas de la moléculaoriginal de ADN.Las dos nuevas moléculas de ADN se enroscan y de nuevotoman la forma de una doble hélice.
    28. 28. 1958 El experimento Meselson-Stahl demuestra que el ADN se replica de modo semiconservador.
    29. 29. Historia de la genética1956 Joe Hin Tjio y Albert Levan establecen en 46 el número de cromosomas en humanosJoe Hin Tjio. Albert Levan
    30. 30. Estructura de un cromosoma
    31. 31. ¿Qué es un gen?Es una secuencia de nucleótidos en lamolécula de ADN, equivalente a una unidadde transcripción.Contiene la información, a partir de la cual sesintetiza un polipéptido, una enzima, un ácidoribonucleico: mensajero, de transferencia oribosomal.En el genoma humano la mayoría de losgenes son únicos y se expresan en formaindependiente. Los genes segregan cuandoocurre la meiosis.
    32. 32. DOGMA CENTRAL DE LA BIOLOGÌA MOLECULARDOGMA CENTRAL DE LA BIOLOGÌA MOLECULARHebra moldeHebra moldeTranscripciónTranscripciónTraducciónTraducción
    33. 33. Naturaleza del material hereditario.Los ácidos nucleicos y sus componentesNaturaleza del material hereditario.Los ácidos nucleicos y sus componentesLos ácidos nucleicos son macromoléculas conestructura de polímero lineal, donde los monómeros sonnucleótidos. Cada nucleótido está formado por un azúcarpentosa, un fosfato y una base nitrogenada. Las basespueden ser purinas (de doble anillo), como la Adenina yla Guanina...Los ácidos nucleicos son macromoléculas conestructura de polímero lineal, donde los monómeros sonnucleótidos. Cada nucleótido está formado por un azúcarpentosa, un fosfato y una base nitrogenada. Las basespueden ser purinas (de doble anillo), como la Adenina yla Guanina...ADENINA (A)ADENINA (A)GUANINA (G)GUANINA (G)
    34. 34. También pueden ser pirimidinas, de anillosencillo, como la timina y la citosina, en elADN; y la citosina y el uracilo en el ARNTambién pueden ser pirimidinas, de anillosencillo, como la timina y la citosina, en elADN; y la citosina y el uracilo en el ARNTIMINA (T)TIMINA (T) URACILO (U)URACILO (U) CITOSINA (C)CITOSINA (C)123 456
    35. 35. Pentosa del ADN: DesoxirribosaPentosa del ADN: DesoxirribosaATENCIÒN: Unhidrógeno en laposición 2’ATENCIÒN: Unhidrógeno en laposición 2’3’5’
    36. 36. DesoxirribunucleótidoDesoxirribunucleótido
    37. 37. La molécula de ADN es una doble héliceantiparalela (Watson y Crick 1953)La molécula de ADN es una doble héliceantiparalela (Watson y Crick 1953)
    38. 38. Fosfatos vanunidos al azúcaren el C-5’ y el C-3’Fosfatos vanunidos al azúcaren el C-5’ y el C-3’HebrasantiparalelasHebrasantiparalelasPunta 3’ librePunta 3’ librePunta 5’ librePunta 5’ libreACIDOS NUCLEICOSACIDOS NUCLEICOS
    39. 39. La función codificante del ADN estádeterminada por la secuencia de susnucleótidos (bases)La función codificante del ADN estádeterminada por la secuencia de susnucleótidos (bases)
    40. 40. Hebra moldeHebra moldeHebra líderHebra líderHebra retardadaHebra retardadaEL ADN es la molécula que permite perpetuar la vida:REPLICACIÓN DEL ADNEL ADN es la molécula que permite perpetuar la vida:REPLICACIÓN DEL ADN
    41. 41. ReplicaciónLas ADN polimerasas requieren comosustrato la punta 3’ hidroxilo libre deuna base apareada para catalizar launión de otro nucleótido.El OH libre se une al 5’α-fosfórico deldeoxinucleósido 5’ trifosfato,liberándose un pirofosfato inorgánico
    42. 42. ADN polimerasas, ligasas….ADN polimerasas de alta fidelidad dirigidaspor ADN: dos de ellas replican loscromosomas, (α) específica para la hebraretardada porque tiene una subunidad primasa,(δ) líder y elongación de la hebra retardada,otras dos reparan el ADN (β y ε), y una de ellasreplica y repara el ADN mitocondrial (γ).δ,ε,γ : tienen actividad 3’ - 5’ exonucleasaδ y ε : tienen actividad de reparación del ADNde tipo excisión de nucleótidos y de bases.
    43. 43. ADN-polimerasas…..ADN polimerasas propensas a errores dirigidaspor ADN: un grupo grande que replica con muy bajafidelidad. La tasa de error de la polimerasa ι (iota) es20.000 veces mayor que la de ε. Se expresan encantidades altas en el sistema inmune, implicadas enla hipermutabilidad en linfocitos B y T.ADN polimerasas dirigidas por ARN: usan comomolde una hebra de ARN: transcriptasas reversas.Ej: Actividad polimerasa en la enzima telomerasa(Tert) que replica la parte final de los extremoslineales de los cromosomas.Transcriptasa reversa endógena, que ocasionalmentepuede convertir ARN en ADNc e integrarlo al genoma.
    44. 44. Proteinas principales replicaciónTopoisomerasas: rompen una hebra y la tensión delenrrollamiento de la hélice se relajaHelicasas: completan el desenrrollamientoADN polimerasas: complejos agregados dediferentes proteínas.Primasas: sintetizan los iniciadores de ARN que senecesitan para iniciar la replicaciónLigasas: sellan las lagunas dejadas por lasribonucleasas cuando remueven los primers, catalizanla unión fosfodiester entre nucleótidos adyacentes.Proteinas de unión a la hebra sencilla del ADN:estabilizan la horquilla de replicación.
    45. 45. Estructura tridimensional de una helicasa: un hexámero conseis sitios de enlace al ATP. La hidrólisis secuencial deestos ATPs permite el desenrrollamiento de la doble hélice.
    46. 46. La ADN polimerasa
    47. 47. Síntesis del primer de ARN por una primasa
    48. 48. En eucariontes losfragmentosde Okasaki tienen 200nucleótidos,los primers unos 10.Los iniciadores de ARN seeliminan mediante unaARNasaespecífica que reconocedobleshélices híbridas ARN-ADNLa laguna es llenada por unapolimerasa y la uniónfinalmentees realizada por una ligasa
    49. 49. La ligasa acopla la hidrólisis de un ATP para hacermás favorable la reacción de unión entre el fosfato y elhidroxilo libre, liberando al final un AMP.
    50. 50. Efecto de las proteínas de enlace con la hebra sencilla del ADN
    51. 51. Estructura de las proteinas de enlace a la hebra sencillaModelo de la proteína humana
    52. 52. Horquilla de replicación en los mamíferos: Dos polimerasasdiferentes en la hebra retardada, primero empieza la pol αsintetizando el primer de ARN algo del ADN porque tiene unasubunidad primasa, luego sigue trabajando la pol δ en laelongación del fragmento
    53. 53. Reparación del ADN
    54. 54. Tipos de daño al ADNMecanismos endógenos:1. Pérdida de bases tipo purinas por rupturaespontánea del enlace con el azúcar5000/día/célula humana2. Deaminación espontánea de citosinas yadeninas produce uracilo e hipoxantina3. Moléculas con oxígenos reactivos atacan losanillos de las bases nitrogenadas4. La ADN polimerasa puede incorporar basesequivocadas en la replicación5. Errores en la replicación o recombinaciónprovocan fracturas en el ADN
    55. 55. Agentes extracelulares1. Radiaciones ionizantes: rayos gamma yrayos X causan rupturas en la doble hélice2. Luz UV causa la formación de los dímerosde timina3. Químicos ambientales como agentesalquilantes y otras sust químicas formanaductos con las bases del ADN:hidrocarburos, productos naturales como lasaflatoxinas.
    56. 56. 11_21.jpg
    57. 57. 11_21_2.jpg
    58. 58. Mecanismos de detección y reparaciónde daños al ADN• Sistemas enzimáticos para reconocer,eliminar y reparar daños inducidos alADN se han descrito y estudiado bienen bacterias• El estudio de los síndromeshereditarios de predisposición al cáncerha permitido ampliar el conocimientoen el ser humano
    59. 59. Capitulo 14: del ADN a las proteínas
    60. 60. Transmisión de la informaciónLa transmisión se lleva a caboprincipalmente gracias a la existencia de losácidos ribonucleicos o ARNsARN mensajero (lineal de hebra simple)ARN de transferenciaARN ribosomalY a las ARNs polimerasas
    61. 61. RibonucleótidoRibonucleótidoATENCION:Grupo hidroxiloen la posición 2’ATENCION:Grupo hidroxiloen la posición 2’
    62. 62. URACILO sustituye a la TIMINAURACILO sustituye a la TIMINALa secuencia correspondiente a una unidad detranscripción en el ADN se transcribe en una hebracomplementaria de ARN, llamada transcritoprimario, a partir del cual, por modificaciones post-transcripcionales , se origina el ARN mensajeroLa secuencia correspondiente a una unidad detranscripción en el ADN se transcribe en una hebracomplementaria de ARN, llamada transcritoprimario, a partir del cual, por modificaciones post-transcripcionales , se origina el ARN mensajero
    63. 63. TRANSCRIPCIÒNTRANSCRIPCIÒNLa ARN polimerasase activa cuandoforma un complejocon los factores detranscripción oelementostrans. La interacciónde estos entre sí, y conlas secuenciasreguladoras del ADN(los factores cis) es laque determina donde,cuando y con quérapidez ocurre latranscripción
    64. 64. Región reguladora EXON 1 EXON 2 EXON 3 EXON 4 EXON n Región reguladoraPROMOTOR5` 3`Intrón 1 Intrón 2 Intrón 3Unidad de transcripciónSecuencia que no se traduce Secuencia que no se traduceModelo simplificado de un gen humanoDra. Patricia Cuenca BergerINISADespués del procesamiento postranscripcional del ARNtranscrito primario, la secuencia de ARNm corresponde a lassecuencias de los exones y las no codificantes (UTRs).Después del procesamiento postranscripcional del ARNtranscrito primario, la secuencia de ARNm corresponde a lassecuencias de los exones y las no codificantes (UTRs).
    65. 65. Procesamiento postranscripcional del ARNCorte en 5’ y unión de un “cap”(5-metilguanosina),para proteger del ataque de las exonucleasas,facilitar el transporte núcleo-citoplasma, y elanclaje del ARNm al ribosomaCorte en 3’ y unión de una cola de poli-A (200AMP), confiere estabilidad y ayuda en latraducciónEliminación de los intrones, por formación de uncomplejo snARNs-proteinas: “spliceosoma”, elcual es específico. La especificidad de la reacciónestá dada por la complementaridad de las basesentre los pequeños ARNs nucleares y el ARNtranscrito primario
    66. 66. ARN de transferencia activado:cargado con el aminoácidocorrespondienteARN de transferencia activado:cargado con el aminoácidocorrespondiente
    67. 67. CODIGOGENETICOARNmCODIGOGENETICOARNm
    68. 68. DOGMA CENTRAL DE LA BIOLOGÌA MOLECULARDOGMA CENTRAL DE LA BIOLOGÌA MOLECULARHebra moldeHebra moldeTranscripciónTranscripciónTraducciónTraducción
    69. 69. TRADUCCIÓNARN --- ProteínaTRADUCCIÓNARN --- Proteína
    70. 70. Cuatro monómeros de aminoácidosReacción decondensaciónPolipéptidoEnlace peptídico catalizado por el complejo enzimático localizado en el ribosoma
    71. 71. 01_03.jpgEstructura general de un aminoácidoPOLARES CargadosSus moléculas están parcialmente cargadas
    72. 72. 01_03_2.jpgPolares neutrosEn sus residuos tienen grupos aminos, hidroxilos o sulfidrilos
    73. 73. 01_03_3.jpgNo polares o hidrofóbicos
    74. 74. Estructura primaria(Secuencia lineal)Residuos de los distintos aminoácidosEstructura secundaria(forma adoptada espontáneamente)Estructura terciaria(Forma tridimensional: globular,tubular, como una rueda, etc.)Las proteínas sufren transformaciones post-traduccionales
    75. 75. Estructura cuaternaria: combinación de monómeros
    76. 76. Anemia falciforme:HemoglobinaHbA se transformaen HbSLa mutación es uncambio del segundonucleótido en elcodón 6 en lasubunidad betaAdenina por timinaÁcido glutámicopor valinaHbSSelección NaturalVentaja heterocigotoMalaria
    77. 77. Variaciones en la secuencia de bases del ADN que no causanalteraciones funcionales patológicas, son alelos opolimorfismos del gen existentes en la población (>1%)Variaciones en la secuencia de bases del ADN que no causanalteraciones funcionales patológicas, son alelos opolimorfismos del gen existentes en la población (>1%)Alteraciones en la secuencia de bases del ADN quealteran la función normal (produciendo patología)del producto génico son mutacionesAlteraciones en la secuencia de bases del ADN quealteran la función normal (produciendo patología)del producto génico son mutaciones
    78. 78. MutacionesGerminales o constitucionales:El individuo las adquiere por herencia de sus padres, puedeocurrir de novo en una célula germinal de alguno de lospadres.Todas las células del cuerpo llevan la misma mutaciónEjemplo: enfermedades hereditariasSomáticas:Se adquiere en el transcurso de la vidaEs portada únicamente por la célula afectada y sus célulashijas. El individuo es un mosaico.Ejemplo: cáncer
    79. 79. •Clases de mutaciones:Sustitución de bases:1- Sustituciones sinónimas (otro codón : mismo aa)2- Mutaciones sin sentido (cambio a codón STOP)3- Mutaciones de sentido equivocado:sustitución del aa en la proteina4- Mutaciones en el sitio de corte y empalme delARN.
    80. 80. •Otros tipos de mutaciones:a- Mutaciones de cambio en el marco de lectura- deleciones- duplicaciones o insersionesb- Mutaciones dinámicas•La patología molecular intenta explicar porque uncambio genético dado podría resultar en un fenotipoclínico particular.
    81. 81. 16_01.jpgPérdida de función del gen PAX3: Síndrome de Waardenburg tipo I,sordera y anormalidades pigmentariasDiferentes tipos de mutaciones afectan al gen, todas causan pérdida de funcióny el mismo resultado clínico
    82. 82. Cambio fenotípico por dos mecanismos:1- pérdida o reducción de la función normal.2- el producto podría adquirir una nueva función.•¿Por qué las mutaciones tienen diferentes tipos deherencia, dominantes, recesivas, etc?Las leyes de Mendel se cumplen en la herencia de algunosrasgos y enfermedades humanas, las que son codificadaspor un solo gen.Leyes de Mendel: redescubiertas 1900Modelo de la doble hélice del ADN: 1953
    83. 83. Mutaciones hereditarias:¿Dominante o recesiva?Mutaciones recesivas llevan a un producto génico confunción reducida o con pérdida de función.- Para la mayoría de los genes, es suficiente el producto de unode los alelos (la mitad) para que se lleve a cabo la funciónnormal. Por eso es que la mayoría de los errores innatos delmetabolismo son recesivos.Mutaciones dominantes llevan a un producto génico conganancia de función.- La ganancia de función causa fenotipos dominantesporque la presencia del producto normal no previeneque el producto mutado se “comporte” anormalmente.La adquisición de una nueva función es un evento raro enenfermedades hereditarias, pero muy común en cáncer
    84. 84. •Clases de mutaciones:Sustitución de bases:1- Sustituciones sinónimas (otro codón : mismo aa)2- Mutaciones sin sentido (cambio a codón STOP)3- Mutaciones de sentido equivocado:sustitución del aa en la proteina4- Mutaciones en el sitio de corte y empalme delARN.
    85. 85. •Otros tipos de mutaciones:a- Mutaciones de cambio en el marco de lectura- deleciones- duplicaciones o insersionesb- Mutaciones dinámicas•La patología molecular intenta explicar porque uncambio genético dado podría resultar en un fenotipoclínico particular.
    86. 86. 16_01.jpgPérdida de función del gen PAX3: Síndrome de Waardenburg tipo I,sordera y anormalidades pigmentariasDiferentes tipos de mutaciones afectan al gen, todas causan pérdida de funcióny el mismo resultado clínico
    87. 87. Cambio fenotípico por dos mecanismos:1- pérdida o reducción de la función normal.2- el producto podría adquirir una nueva función.•¿Por qué las mutaciones tienen diferentes tipos deherencia, dominantes, recesivas, etc?Las leyes de Mendel se cumplen en la herencia de algunosrasgos y enfermedades humanas, las que son codificadaspor un solo gen.Leyes de Mendel: redescubiertas 1900Modelo de la doble hélice del ADN: 1953
    88. 88. Mutaciones hereditarias:¿Dominante o recesiva?Mutaciones recesivas llevan a un producto génicocon función reducida o con pérdida de función.- Para la mayoría de los genes, es suficiente el productode uno de los alelos (la mitad) para que se lleve a cabola función normal. Por eso es que la mayoría de loserrores innatos del metabolismo son recesivos.Mutaciones dominantes llevan a un producto génicocon ganancia de función.- La ganancia de función causa fenotipos dominantesporque la presencia del producto normal no previeneque el producto mutado se “comporte” anormalmente.La adquisición de una nueva función es un evento raro enenfermedades hereditarias, pero muy común en cáncer
    89. 89. Variabilidad de los genesGen Tamaño N° exonesARNt 100 pb 2β-globina 1.600 pb 3colágenoVII 31.000 pb 118Distrofina 2.400.000 pb 79Genes dentro de genes:Ej: el intrón 27 del gen NF1 contiene 3 genesGenes que se sobreponen:Ej: algunos genes mitocondriales
    90. 90. ProteomaEs el set de genes que codifican para proteínasDistribución por su función en el GH:Procesos ADN (replic, trans, trad.) 22%Metabolismo 17%División celular 12%Defensa 12%Regulación y señales 12%Estructura 8%Función desconocida 17%

    ×