• Like

Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification

  • 869 views
Uploaded on

Presented at the DNA in Forensics Meeting, September 2012 by Sharon Wootton (Life Technologies)

Presented at the DNA in Forensics Meeting, September 2012 by Sharon Wootton (Life Technologies)

More in: Technology
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
No Downloads

Views

Total Views
869
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
55
Comments
0
Likes
1

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Applicaons  of  Personal  Genome  Machine  (PGM™)  in  SNP-­‐based  Human  IdenficaonSharon  Chao  Woo*on,  PhDSenior  Bioinforma3cs  Scien3stHuman  Iden3fica3onLife  Technologies
  • 2. Agenda•Overview  of  PGM™  applica2ons•SNPs  in  human  iden2fica2on•PGM™  Technology•Development  of  a  SNP  panel•Future  plans07/02/12
  • 3. Applicaons  on  the  PGM   STR Y-­‐STR SNP mtDNA Microbial Genotype Genotype Genotype Haplotype Forensics07/03/12
  • 4. Applicaons  on  the  PGM   STR Y-­‐STR SNP mtDNA Microbial Genotype Genotype Genotype Haplotype Forensics Iden%ty   Lineage-­‐ Ancestry-­‐ Phenotypic SNPs informa%ve informa%ve   SNPs SNPs SNPs •  High  heterozygosity •  Haplotype  markers  for   •  High  populaon   •  Hair,  eye,  skin   •  Low  populaon   kinship  analysis heterogeneity color heterogeneity •  Mitochondrial  genome   or  control  region •  Y-­‐chr  SNPs •  Mini  haplogroups07/03/12
  • 5. PGM™  Applicaons  -­‐  SNP  Genotyping STR Y-­‐STR SNP mtDNA Microbial Genotype Genotype Genotype Haplotype Forensics •  Abundant  in  the  human  genome  (~9  million) • 90%    of  human  gene2c  varia2on  comes  from  SNPs • SNPs  occur  about  every  300  bp;  coding  and  non  coding  regions • Most  SNPs  are  bi-­‐allelic • Low  muta2on  rate  (10  -­‐8  -­‐  10-­‐9  per  locus  per  genera2on) • Small  amplicon  size07/02/12
  • 6. PGM™  Applicaons  -­‐  SNP  Genotyping •  Missing  person  iden2fica2on •  Paternity •  DVI •  Ancestral  haplotyping •  Molecular  “phenotype”07/02/12
  • 7. Current  SNP  Technologies•  Allele  discrimina2on  methods SNaPshot® • Sequencing • Primer  extension • Liga2on Oligo ligation assay (OLA) • Hybridiza2on • Enzyma2c  cleavage TaqMan® Assay Homozygote 2 Heterozygote Homozygote 107/03/12
  • 8. Current  SNP  Technologies•  Allele  discrimina2on  methods SNaPshot® • Sequencing • Primer  extension • Liga2on Oligo ligation assay (OLA) • Hybridiza2on • Enzyma2c  cleavage Limitation on number of SNPs TaqMan® Assay Homozygote 2 and samples run Heterozygote simultaneously Homozygote 107/03/12
  • 9. PGM™  for  SNP  Genotyping•  Allows  combina2on  of  large  number  of  SNPs  in  one  mul2plex • Simultaneous  sequencing  of  autosomal,  Y-­‐chr,  X-­‐chr,   mitochondrial  SNPs  possible•  Barcode  up  to  96  individuals  and  sequence  on  one  chip•  Output  is  sequence,  not  an  indicator07/02/12
  • 10. PGM™  Instrument07/02/12
  • 11. The  Ion  Torrent  PGM™  Instrument  System INSTRUMENTS REAGENTS DATA  ANALYSIS  Sequencing  Instrument  Semiconductor  Chip  Torrent  Server  Sequencing  Chemistry  One  Touch™  Instruments •  Natural  nucleo3des  Emulsion  PCR  and  Enrichment •  Natural  enzymes  Sample  Prep •  Libraries •  Clonal  beads07/02/12
  • 12. Ion  chip  scalability ▲ Ion 318 >1400 Mb ▲ Ion 316 >850 Mb ▲ Ion 314 >150 Mb07/02/12
  • 13. Leveraging  Semiconductor  Technology   WAFER  SEMICONDUCTOR   CHIP  SEMICONDUCTOR   CHIP  CROSS  SECTION   MANUFACTURING PACKAGING SEMICONDUCTOR  DESIGN07/03/12
  • 14. Sequence  detecon  by  pH dNTP H+ ∆ pH ∆Q Sensing Layer Sensor Plate ∆V Bulk Drain Source To column Silicon Substrate receiver Rothberg)J.M.))et#al#Nature#doi:10.1038/nature10242#07/03/12
  • 15. Data  Output  is  an  Ionogram•  Must  be  read  “up-­‐and-­‐down”  along  with  “le`-­‐to-­‐right”•  Height  of  bar  indicates  how  many  nucleo2des  incorporated  during   flow Sequence: …AATCTTCTGAATTTCTGCAA….• “Negative” or “zero” flows indicate no nucleotide incorporation (TTT) (AA) Key Sequence (AA)•“Nega2ve”  or  “zero”  flows  indicate  no  nucleo2de  incorpora2on • These  observa2ons  are  omibed  when  conver2ng  to  nucleo2de   space 07/02/12
  • 16. PGM™  Applicaons STR Y-­‐STR SNP mtDNA Microbial Genotype Genotype Genotype Haplotype Forensics07/02/12
  • 17. PGM™  Applicaons STR Y-­‐STR SNP mtDNA Microbial Genotype Genotype Genotype Haplotype Forensics Iden%ty   Lineage-­‐ Ancestry-­‐ Phenotypic SNPs informa%ve informa%ve   SNPs SNPs SNPs •  High  heterozygosity •  Haplotype  markers  for   •  High  popula%on   •  Hair,  eye,  skin  color •  Low  populaon   kinship  analysis heterogeneity heterogeneity •  Mitochondrial  genome   or  control  region •  Y-­‐chr  SNPs •  Mini  haplogroups07/02/12
  • 18. HID  SNP  Panel  v0.1•Based  on  published  SNPs  with  high  heterozygosity  and  low  Fst•Genotype  match  probabili2es  of  10-­‐31  -­‐  10-­‐35   136 SNPs 70 - Ken Kidd SNPs 33 Y - SNP 36 - SNPforID SNPlex07/02/12
  • 19. Populaon  data Kidd  Lab’s  ALFRED  (the  ALlele  FREquency  Database)   ALFRED  allele  frequencies  by  popula7on  for  rs770477007/02/12
  • 20. SNP  Panel  Development  -­‐  Ampliseq™ AMPLISEQ™ MULTIPLEX - MULTIPLEX - SNP GENOTYPE CUSTOM PANEL CLONAL BEAD SEQUENCING ON PLUGIN AMPLIFICATION SINGLE CHIP • Up to 6,144 primer pairs Generic Generic Analysis custom to SNP panel • 10 ng DNA input • Up to 200 bp targets Customize Panel Construct Library Prepare Template Run Sequence Analyze Data07/02/12
  • 21. Library  Preparaon AMPLISEQ™ MULTIPLEX - MULTIPLEX - SNP GENOTYPE CUSTOM PANEL CLONAL BEAD SEQUENCING ON PLUGIN AMPLIFICATION SINGLE CHIP Generic Analysis custom to • Up to 6,144 primer pairs Generic SNP panel • 10 ng DNA input • Up to 200 bp targets Customize Panel Construct Library Prepare Template Run Sequence Analyze Data Short Amplicon Method Long Amplicon Method Target amplicons 75 - 200 bp Target amplicons > 200 bp FWD FWD Genomic DNA Genomic DNA REV REV PCR, pool amplicons, PCR, pool amplicons, fragment end-repair with Ion Shear™ Kit Short amplicon pool Fragmented long 75 - 200 bp amplicon pool 50 - 500 bp P1 Adaptor ligation IA OR P1 Barcode adaptors ligation IA-BCx Nick-translation and PCR Final barcoded library IA BCx Target amplicon P107/03/12
  • 22. Library  Preparaon AMPLISEQ™ MULTIPLEX - MULTIPLEX - SNP GENOTYPE CUSTOM PANEL CLONAL BEAD SEQUENCING ON PLUGIN AMPLIFICATION SINGLE CHIP Generic Analysis custom to • Up to 6,144 primer pairs Generic SNP panel • 10 ng DNA input • Up to 200 bp targets Customize Panel Construct Library Prepare Template Run Sequence Analyze Data Short Amplicon Method Long Amplicon Method Target amplicons 75 - 200 bp Target amplicons > 200 bp FWD FWD Genomic DNA Genomic DNA REV REV PCR, pool amplicons, PCR, pool amplicons, fragment end-repair with Ion Shear™ Kit Short amplicon pool Fragmented long 75 - 200 bp amplicon pool 50 - 500 bp P1 Adaptor ligation IA OR P1 Barcode adaptors ligation IA-BCx Nick-translation and PCR Final barcoded library IA BCx Target amplicon P107/03/12
  • 23. Data  analysis AMPLISEQ™ MULTIPLEX - MULTIPLEX - SNP GENOTYPE CUSTOM PANEL CLONAL BEAD SEQUENCING ON PLUGIN AMPLIFICATION SINGLE CHIP Generic Analysis custom to • Up to 6,144 primer pairs Generic SNP panel • 10 ng DNA input • Up to 200 bp targets Customize Panel Construct Library Prepare Template Run Sequence Analyze Data07/02/12
  • 24. SNP  genotype  calling AMPLISEQ™ MULTIPLEX - MULTIPLEX - SNP GENOTYPE CUSTOM PANEL CLONAL BEAD SEQUENCING ON PLUGIN AMPLIFICATION SINGLE CHIP Generic Analysis custom to • Up to 6,144 primer pairs Generic SNP panel • 10 ng DNA input • Up to 200 bp targets Customize Panel Construct Library Prepare Template Run Sequence Analyze Datacoverage Het  G/A A T Calignments Greference   rs891700 07/02/12
  • 25. Depth  of  coverage  for  each  allele BC10 BC9 BC8 BC7 BC6 100x 100x 100x 100x 100x 0" 100" 200" 300" 400" 500" 600" 700" 0" 50" 100" 150" 200" 250" 300" 350" 400" 0" 200" 400" 600" 800" 1000" 1200" 0" 100" 200" 300" 400" 500" 600" 0" 100" 200" 300" 400" 500" 600" 700" 800" 900" rs 14 90 41 rs 3" 10 49 54 07 rs " 89 17 00 rs " 14 13 21 2" rs 87 67 24 rs " 90 71 00 rs " 13 57 61 rs 7" 13 55 36 rs 6" 20 46 36 rs 1" 19 79 25 5" rs 71 73 02 rs " 25 19 34 rs " 10 29 04 7" rs 72 78 11 rs " 91 71 18 rs " 73 76 81 rs " 76 38 69 rs " 20 56 27 rs 7" 10 15 25 rs 0" 14 63 72 rs 9" 13 60 28 8" rs 73 51 55 rs " 96 46 81 rs " 90 13 98 rs " 20 76 84 rs 8" 21 07 61 rs 2" 21 11 98 rs 0" 13 35 87 rs 3" SNPs  by  rs  IDReads per allele 18 86 51 0" rs 35 44 39 rs " 14 54 36 1" rs 87 31 96 rs " 80 37 42 rs 9" 15 28 46 0" rs 72 91 72 rs " 13 82 38 7" rs 74 09 10 rs " 93 82 83 rs " 14 93 23 rs 2" 10 24 11 6" rs 71 Coverage  needed  to  overcome  undercalling 93 66 rs " 10 31 82 rs 5" 10 05 53 3" rs 72 20 98 rs " 28 31 70 0" rs 91 41 65 rs " 73 31 64 rs " 20 40 41 rs 1" 10 28 52 8" T" T" T" T" T" C" C" C" C" C" A" A" A" A" A" G" G" G" G" G" BC10 BC9 BC8 BC7 BC6 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# rs 14 90 41 rs 3# 10 49 54 07 rs # 89 17 00 rs # 14 13 21 2# rs 87 67 24 rs # 90 71 00 rs # 13 57 61 rs 7# 13 55 36 rs 6# 20 46 36 rs 1# 19 79 25 5# rs 71 73 02 rs # 25 19 34 rs # 10 29 04 7# rs 72 78 11 rs # 91 71 18 rs # 73 76 81 rs # 76 38 69 rs # 20 56 27 rs 7# 10 15 25 rs 0# 14 63 72 rs 9# 13 60 28 8# rs 73 51 55 rs # 96 46 81 rs # 90 13 98 rs # 20 76 84 rs 8# 21 07 61 rs 2# 21 11 98 rs 0# 13 35 87 rs 3# 18 86 51 0# rs 35 44 39 rs # 14 54 36 1# rs 87 31 Reads per alleley  rs  ID 96 rs # 80 37 42 rs 9# 15 28 46 0# rs 72 91 SNPs  b normalized 72 rs # 13 82 38 7# rs 74 09 10 rs # 93 82 83 rs # 14 93 23 rs 2# 10 24 11 6# rs 71 93 66 rs # 10 31 82 rs 5# 10 05 53 3# rs 72 20 98 rs # 28 31 70 0# rs 91 41 65 rs # 73 31 64 rs # 20 40 41 rs 1# 10 28 52 8# T# C# A# G# T# T# T# T# C# C# C# C# A# A# A# A# G# G# G# G# Allele  alloca7on
  • 26. Depth  of  coverage  for  each  allele 100x 100x 100x 100x 100x 0" 100" 200" 300" 400" 500" 600" 700" 800" 0" 50" 100" 150" 200" 250" 300" 350" 0" 200" 400" 600" 800" 1000" 1200" 1400" 1600" 0" 100" 200" 300" 400" 500" 600" 700" 800" 900" 0" 100" 200" 300" 400" 500" 600" 700" 800" 900" rs1490413( rs7520386( rs560681( rs10495407( rs891700( rs1413212( rs876724( rs12997453( rs1357617( rs9866013( rs1872575( LT06 LT05 LT04 LT03 LT01 rs1355366( rs6444724( rs13134862( rs1554472( rs6811238( rs1979255( rs717302( rs159606( rs13182883( rs7704770( rs251934( rs338882( rs1029047( rs13218440( rs2811231( rs1478829( rs1358856( rs2503107( rs2272998( rs214955( rs727811( rs6955448( rs917118( rs1019029( rs321198( rs737681( rs10092491( rs4288409( rs2056277( rs4606077( rs2270529( rs7041158( rs1463729( rs10776839( rs735155( rs3780962( rs1410059( rs740598( rs964681( rs10768550( rs10500617( rs1498553( rs901398( rs6591147( rs590162( rs2107612( rs2255301( rs2269355( rs2111980( rs10773760( rs1886510( rs9546538( rs1058083( rs354439( rs1454361( rs873196( rs4530059( rs1821380( rs729172( rs2342747( rs430046( rs1382387( rs2175957( rs8070085( rs1004357( rs1027895( rs8078417( rs2291395( rs4789798( rs689512( SNPs  by  rs  ID rs3744163( rs2292972( rs1493232( rs9951171( rs7229946( rs985492( rs521861( rs1736442( rs1024116( rs719366( rs576261( rs12480506( rs2567608( rs1005533( rs1523537( rs722098( rs464663( rs2833736( rs914165( rs9606186( rs5746846( rs2073383( rs733164( rs987640( rs2040411( Higher  depth  of  coverage  precludes  undercalling rs1028528( rs1800865( rs2075640( rs2299942( rs2267801( rs2267802( rs2071394( rs1865680( rs2075182.3( rs2075181( rs1515817( rs2032595( rs2032598( rs2032599( rs2032601( rs2032600( rs2032607( rs2032604( rs2032624( rs2020857( rs2032668( rs2032666( rs2032658( rs2072422( rs2032653( rs1864258( rs3897( rs3900( rs891407( rs2032611( rs2032631( rs2032673( rs2032626( rs1558843( rs1276035( T" T" T" T" T" C" C" C" C" C" A" A" A" A" A" rs1276034( G" G" G" G" G" Allele  alloca7on 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# rs1490413( rs7520386( rs560681( rs10495407( rs891700( rs1413212( rs876724( rs12997453( rs1357617( rs9866013( rs1872575( rs1355366( rs6444724( rs13134862( rs1554472( rs6811238( rs1979255( rs717302( rs159606( rs13182883( rs7704770( rs251934( rs338882( rs1029047( rs13218440( rs2811231( rs1478829( rs1358856( rs2503107( rs2272998( rs214955( rs727811( rs6955448( rs917118( rs1019029( rs321198( rs737681( rs10092491( rs4288409( rs2056277( rs4606077( rs2270529( rs7041158( rs1463729( rs10776839( rs735155( rs3780962( rs1410059( rs740598( rs964681( rs10768550( rs10500617( rs1498553( rs901398( rs6591147( rs590162( rs2107612( rs2255301( rs2269355( rs2111980( rs10773760( rs1886510( rs9546538( rs1058083( rs354439( rs1454361( rs873196( rs4530059( rs1821380( rs729172( rs2342747( rs430046( rs1382387( rs2175957( rs8070085( rs1004357( rs1027895( rs8078417( rs2291395( rs4789798( rs689512( rs3744163( rs2292972( rs1493232( rs9951171( rs7229946( rs985492( rs521861( rs1736442(SNPs  by  rs  ID rs1024116( rs719366( rs576261( rs12480506( rs2567608( rs1005533( rs1523537( rs722098( rs464663( rs2833736( rs914165( rs9606186( rs5746846( rs2073383( rs733164( rs987640( rs2040411( rs1028528( rs1800865( rs2075640( rs2299942( rs2267801( rs2267802( rs2071394( rs1865680( rs2075182.3( rs2075181( rs1515817( rs2032595( rs2032598( rs2032599( rs2032601( rs2032600( rs2032607( rs2032604( rs2032624( rs2020857( rs2032668( rs2032666( rs2032658( rs2072422( rs2032653( rs1864258( rs3897( rs3900( rs891407( rs2032611( rs2032631( rs2032673( rs2032626( rs1558843( rs1276035( T# T# T# T# T# C# C# C# C# C# A# A# A# A# A# rs1276034( G# G# G# G# G#
  • 27. Amplicon  coverage AMPLISEQ™ MULTIPLEX - MULTIPLEX - SNP GENOTYPE CUSTOM PANEL CLONAL BEAD SEQUENCING ON PLUGIN AMPLIFICATION SINGLE CHIP Generic Analysis custom to • Up to 6,144 primer pairs Generic SNP panel • 10 ng DNA input • Up to 200 bp targets Customize Panel Construct Library Prepare Template Run Sequence Analyze Data Y  -­‐  SNPS depth  of  coveragedepth  of  coverage SNPs  sorted  by  depth  of  coverage SNPs  sorted  by  depth  of  coverage Female  individual Male  individual 07/03/12
  • 28. 07/02/12
  • 29. HID-­‐SNP  Genotyper  pluginallele  coveragealleles  represented SNPs  by  rs  ID07/02/12
  • 30. 314  chip:  ~32  individuals 316  chip:  >96  individuals 12,762 124x07/02/12
  • 31. HID  Ion  Community  Homepage07/02/12
  • 32. Summary •SNPs  are  valuable  iden2fiers  when  small-­‐amplicon  PCR  based   detec2on  is  necessary •Not  intended  to  supplant  STRs  for  forensic  typing. •Next-­‐genera2on  sequencing  technologies  allow  for  high   mul2plexed  capabili2es  -­‐  of  SNPs  and  individuals   •Iden2ty  SNP  panel  on  PGM™  using  well-­‐characterized   polymorphisms07/03/12
  • 33. Future  Plans•Poten2al  external  collabora2ons  for  research  applica2ons  on  the   PGM•Ancestral  and  phenotypic  SNP  panel•Mini  haplogroups,  Y  and  Mito  haplotyping  panel  •Microbial  forensics07/03/12
  • 34. Acknowledgments   •Robert  Lagacé •Lori  Hennessy   •Reina  Langit   •  Joe  Chang •  Chien-­‐wei  Chang •Narasimhan  Rajagopalan   Sharon.Wootton@lifetech.com07/03/12
  • 35. Thank  You ©  2012  Life  Technologies  Corpora2on.  All  rights  reserved.  The  trademarks   men2oned  herein  are  the  property  of  Life  Technologies  Corpora2on  or  their   respec2ve  owners.   Refer  to  product  page  on  the  Life  Technologies  website  for  Limited  Use   License. The  content  provided  herein  may  relate  to  products  that  have  not  been  07/03/12 officially  released  and  is  subject  to  change  without  no2ce.