0
Applicaons	  of	  Personal	  Genome	  Machine	  (PGM™)	  in	  SNP-­‐based	  Human	  IdenficaonSharon	  Chao	  Woo*on,	  PhD...
Agenda•Overview	  of	  PGM™	  applica2ons•SNPs	  in	  human	  iden2fica2on•PGM™	  Technology•Development	  of	  a	  SNP	  p...
Applicaons	  on	  the	  PGM	               STR       Y-­‐STR     SNP       mtDNA      Microbial           Genotype   Genot...
Applicaons	  on	  the	  PGM	                   STR              Y-­‐STR                     SNP                   mtDNA   ...
PGM™	  Applicaons	  -­‐	  SNP	  Genotyping             STR              Y-­‐STR           SNP              mtDNA          ...
PGM™	  Applicaons	  -­‐	  SNP	  Genotyping   •	  Missing	  person	  iden2fica2on   •	  Paternity   •	  DVI   •	  Ancestral	...
Current	  SNP	  Technologies•	  Allele	  discrimina2on	  methods                                          SNaPshot®   • Se...
Current	  SNP	  Technologies•	  Allele	  discrimina2on	  methods                                          SNaPshot®   • Se...
PGM™	  for	  SNP	  Genotyping•	  Allows	  combina2on	  of	  large	  number	  of	  SNPs	  in	  one	  mul2plex   • Simultane...
PGM™	  Instrument07/02/12
The	  Ion	  Torrent	  PGM™	  Instrument	  System                 INSTRUMENTS                                   REAGENTS   ...
Ion	  chip	  scalability                             ▲ Ion 318 >1400 Mb                             ▲ Ion 316 >850 Mb     ...
Leveraging	  Semiconductor	  Technology	     WAFER	  SEMICONDUCTOR	     CHIP	  SEMICONDUCTOR	       CHIP	  CROSS	  SECTION...
Sequence	  detecon	  by	  pH                  dNTP                                      H+                                ...
Data	  Output	  is	  an	  Ionogram•	  Must	  be	  read	  “up-­‐and-­‐down”	  along	  with	  “le`-­‐to-­‐right”•	  Height	 ...
PGM™	  Applicaons             STR       Y-­‐STR     SNP       mtDNA      Microbial           Genotype   Genotype   Genotyp...
PGM™	  Applicaons                 STR              Y-­‐STR                           SNP                    mtDNA         ...
HID	  SNP	  Panel	  v0.1•Based	  on	  published	  SNPs	  with	  high	  heterozygosity	  and	  low	  Fst•Genotype	  match	 ...
Populaon	  data           Kidd	  Lab’s	  ALFRED	  (the	  ALlele	  FREquency	  Database)	                                  ...
SNP	  Panel	  Development	  -­‐	  Ampliseq™                             AMPLISEQ™                    MULTIPLEX -          ...
Library	  Preparaon                                                                                                     AM...
Library	  Preparaon                                                                                                     AM...
Data	  analysis                                     AMPLISEQ™                    MULTIPLEX -             MULTIPLEX -      ...
SNP	  genotype	  calling                                               AMPLISEQ™                    MULTIPLEX -           ...
Depth	  of	  coverage	  for	  each	  allele                                                                               ...
Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification
Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification
Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification
Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification
Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification
Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification
Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification
Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification
Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification
Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification
Upcoming SlideShare
Loading in...5
×

Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification

1,217

Published on

Presented at the DNA in Forensics Meeting, September 2012 by Sharon Wootton (Life Technologies)

Published in: Technology
0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
1,217
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
63
Comments
0
Likes
2
Embeds 0
No embeds

No notes for slide

Transcript of "Applications of Personal Genome Machine (PGM™) in SNP-­based Human Identification"

  1. 1. Applicaons  of  Personal  Genome  Machine  (PGM™)  in  SNP-­‐based  Human  IdenficaonSharon  Chao  Woo*on,  PhDSenior  Bioinforma3cs  Scien3stHuman  Iden3fica3onLife  Technologies
  2. 2. Agenda•Overview  of  PGM™  applica2ons•SNPs  in  human  iden2fica2on•PGM™  Technology•Development  of  a  SNP  panel•Future  plans07/02/12
  3. 3. Applicaons  on  the  PGM   STR Y-­‐STR SNP mtDNA Microbial Genotype Genotype Genotype Haplotype Forensics07/03/12
  4. 4. Applicaons  on  the  PGM   STR Y-­‐STR SNP mtDNA Microbial Genotype Genotype Genotype Haplotype Forensics Iden%ty   Lineage-­‐ Ancestry-­‐ Phenotypic SNPs informa%ve informa%ve   SNPs SNPs SNPs •  High  heterozygosity •  Haplotype  markers  for   •  High  populaon   •  Hair,  eye,  skin   •  Low  populaon   kinship  analysis heterogeneity color heterogeneity •  Mitochondrial  genome   or  control  region •  Y-­‐chr  SNPs •  Mini  haplogroups07/03/12
  5. 5. PGM™  Applicaons  -­‐  SNP  Genotyping STR Y-­‐STR SNP mtDNA Microbial Genotype Genotype Genotype Haplotype Forensics •  Abundant  in  the  human  genome  (~9  million) • 90%    of  human  gene2c  varia2on  comes  from  SNPs • SNPs  occur  about  every  300  bp;  coding  and  non  coding  regions • Most  SNPs  are  bi-­‐allelic • Low  muta2on  rate  (10  -­‐8  -­‐  10-­‐9  per  locus  per  genera2on) • Small  amplicon  size07/02/12
  6. 6. PGM™  Applicaons  -­‐  SNP  Genotyping •  Missing  person  iden2fica2on •  Paternity •  DVI •  Ancestral  haplotyping •  Molecular  “phenotype”07/02/12
  7. 7. Current  SNP  Technologies•  Allele  discrimina2on  methods SNaPshot® • Sequencing • Primer  extension • Liga2on Oligo ligation assay (OLA) • Hybridiza2on • Enzyma2c  cleavage TaqMan® Assay Homozygote 2 Heterozygote Homozygote 107/03/12
  8. 8. Current  SNP  Technologies•  Allele  discrimina2on  methods SNaPshot® • Sequencing • Primer  extension • Liga2on Oligo ligation assay (OLA) • Hybridiza2on • Enzyma2c  cleavage Limitation on number of SNPs TaqMan® Assay Homozygote 2 and samples run Heterozygote simultaneously Homozygote 107/03/12
  9. 9. PGM™  for  SNP  Genotyping•  Allows  combina2on  of  large  number  of  SNPs  in  one  mul2plex • Simultaneous  sequencing  of  autosomal,  Y-­‐chr,  X-­‐chr,   mitochondrial  SNPs  possible•  Barcode  up  to  96  individuals  and  sequence  on  one  chip•  Output  is  sequence,  not  an  indicator07/02/12
  10. 10. PGM™  Instrument07/02/12
  11. 11. The  Ion  Torrent  PGM™  Instrument  System INSTRUMENTS REAGENTS DATA  ANALYSIS  Sequencing  Instrument  Semiconductor  Chip  Torrent  Server  Sequencing  Chemistry  One  Touch™  Instruments •  Natural  nucleo3des  Emulsion  PCR  and  Enrichment •  Natural  enzymes  Sample  Prep •  Libraries •  Clonal  beads07/02/12
  12. 12. Ion  chip  scalability ▲ Ion 318 >1400 Mb ▲ Ion 316 >850 Mb ▲ Ion 314 >150 Mb07/02/12
  13. 13. Leveraging  Semiconductor  Technology   WAFER  SEMICONDUCTOR   CHIP  SEMICONDUCTOR   CHIP  CROSS  SECTION   MANUFACTURING PACKAGING SEMICONDUCTOR  DESIGN07/03/12
  14. 14. Sequence  detecon  by  pH dNTP H+ ∆ pH ∆Q Sensing Layer Sensor Plate ∆V Bulk Drain Source To column Silicon Substrate receiver Rothberg)J.M.))et#al#Nature#doi:10.1038/nature10242#07/03/12
  15. 15. Data  Output  is  an  Ionogram•  Must  be  read  “up-­‐and-­‐down”  along  with  “le`-­‐to-­‐right”•  Height  of  bar  indicates  how  many  nucleo2des  incorporated  during   flow Sequence: …AATCTTCTGAATTTCTGCAA….• “Negative” or “zero” flows indicate no nucleotide incorporation (TTT) (AA) Key Sequence (AA)•“Nega2ve”  or  “zero”  flows  indicate  no  nucleo2de  incorpora2on • These  observa2ons  are  omibed  when  conver2ng  to  nucleo2de   space 07/02/12
  16. 16. PGM™  Applicaons STR Y-­‐STR SNP mtDNA Microbial Genotype Genotype Genotype Haplotype Forensics07/02/12
  17. 17. PGM™  Applicaons STR Y-­‐STR SNP mtDNA Microbial Genotype Genotype Genotype Haplotype Forensics Iden%ty   Lineage-­‐ Ancestry-­‐ Phenotypic SNPs informa%ve informa%ve   SNPs SNPs SNPs •  High  heterozygosity •  Haplotype  markers  for   •  High  popula%on   •  Hair,  eye,  skin  color •  Low  populaon   kinship  analysis heterogeneity heterogeneity •  Mitochondrial  genome   or  control  region •  Y-­‐chr  SNPs •  Mini  haplogroups07/02/12
  18. 18. HID  SNP  Panel  v0.1•Based  on  published  SNPs  with  high  heterozygosity  and  low  Fst•Genotype  match  probabili2es  of  10-­‐31  -­‐  10-­‐35   136 SNPs 70 - Ken Kidd SNPs 33 Y - SNP 36 - SNPforID SNPlex07/02/12
  19. 19. Populaon  data Kidd  Lab’s  ALFRED  (the  ALlele  FREquency  Database)   ALFRED  allele  frequencies  by  popula7on  for  rs770477007/02/12
  20. 20. SNP  Panel  Development  -­‐  Ampliseq™ AMPLISEQ™ MULTIPLEX - MULTIPLEX - SNP GENOTYPE CUSTOM PANEL CLONAL BEAD SEQUENCING ON PLUGIN AMPLIFICATION SINGLE CHIP • Up to 6,144 primer pairs Generic Generic Analysis custom to SNP panel • 10 ng DNA input • Up to 200 bp targets Customize Panel Construct Library Prepare Template Run Sequence Analyze Data07/02/12
  21. 21. Library  Preparaon AMPLISEQ™ MULTIPLEX - MULTIPLEX - SNP GENOTYPE CUSTOM PANEL CLONAL BEAD SEQUENCING ON PLUGIN AMPLIFICATION SINGLE CHIP Generic Analysis custom to • Up to 6,144 primer pairs Generic SNP panel • 10 ng DNA input • Up to 200 bp targets Customize Panel Construct Library Prepare Template Run Sequence Analyze Data Short Amplicon Method Long Amplicon Method Target amplicons 75 - 200 bp Target amplicons > 200 bp FWD FWD Genomic DNA Genomic DNA REV REV PCR, pool amplicons, PCR, pool amplicons, fragment end-repair with Ion Shear™ Kit Short amplicon pool Fragmented long 75 - 200 bp amplicon pool 50 - 500 bp P1 Adaptor ligation IA OR P1 Barcode adaptors ligation IA-BCx Nick-translation and PCR Final barcoded library IA BCx Target amplicon P107/03/12
  22. 22. Library  Preparaon AMPLISEQ™ MULTIPLEX - MULTIPLEX - SNP GENOTYPE CUSTOM PANEL CLONAL BEAD SEQUENCING ON PLUGIN AMPLIFICATION SINGLE CHIP Generic Analysis custom to • Up to 6,144 primer pairs Generic SNP panel • 10 ng DNA input • Up to 200 bp targets Customize Panel Construct Library Prepare Template Run Sequence Analyze Data Short Amplicon Method Long Amplicon Method Target amplicons 75 - 200 bp Target amplicons > 200 bp FWD FWD Genomic DNA Genomic DNA REV REV PCR, pool amplicons, PCR, pool amplicons, fragment end-repair with Ion Shear™ Kit Short amplicon pool Fragmented long 75 - 200 bp amplicon pool 50 - 500 bp P1 Adaptor ligation IA OR P1 Barcode adaptors ligation IA-BCx Nick-translation and PCR Final barcoded library IA BCx Target amplicon P107/03/12
  23. 23. Data  analysis AMPLISEQ™ MULTIPLEX - MULTIPLEX - SNP GENOTYPE CUSTOM PANEL CLONAL BEAD SEQUENCING ON PLUGIN AMPLIFICATION SINGLE CHIP Generic Analysis custom to • Up to 6,144 primer pairs Generic SNP panel • 10 ng DNA input • Up to 200 bp targets Customize Panel Construct Library Prepare Template Run Sequence Analyze Data07/02/12
  24. 24. SNP  genotype  calling AMPLISEQ™ MULTIPLEX - MULTIPLEX - SNP GENOTYPE CUSTOM PANEL CLONAL BEAD SEQUENCING ON PLUGIN AMPLIFICATION SINGLE CHIP Generic Analysis custom to • Up to 6,144 primer pairs Generic SNP panel • 10 ng DNA input • Up to 200 bp targets Customize Panel Construct Library Prepare Template Run Sequence Analyze Datacoverage Het  G/A A T Calignments Greference   rs891700 07/02/12
  25. 25. Depth  of  coverage  for  each  allele BC10 BC9 BC8 BC7 BC6 100x 100x 100x 100x 100x 0" 100" 200" 300" 400" 500" 600" 700" 0" 50" 100" 150" 200" 250" 300" 350" 400" 0" 200" 400" 600" 800" 1000" 1200" 0" 100" 200" 300" 400" 500" 600" 0" 100" 200" 300" 400" 500" 600" 700" 800" 900" rs 14 90 41 rs 3" 10 49 54 07 rs " 89 17 00 rs " 14 13 21 2" rs 87 67 24 rs " 90 71 00 rs " 13 57 61 rs 7" 13 55 36 rs 6" 20 46 36 rs 1" 19 79 25 5" rs 71 73 02 rs " 25 19 34 rs " 10 29 04 7" rs 72 78 11 rs " 91 71 18 rs " 73 76 81 rs " 76 38 69 rs " 20 56 27 rs 7" 10 15 25 rs 0" 14 63 72 rs 9" 13 60 28 8" rs 73 51 55 rs " 96 46 81 rs " 90 13 98 rs " 20 76 84 rs 8" 21 07 61 rs 2" 21 11 98 rs 0" 13 35 87 rs 3" SNPs  by  rs  IDReads per allele 18 86 51 0" rs 35 44 39 rs " 14 54 36 1" rs 87 31 96 rs " 80 37 42 rs 9" 15 28 46 0" rs 72 91 72 rs " 13 82 38 7" rs 74 09 10 rs " 93 82 83 rs " 14 93 23 rs 2" 10 24 11 6" rs 71 Coverage  needed  to  overcome  undercalling 93 66 rs " 10 31 82 rs 5" 10 05 53 3" rs 72 20 98 rs " 28 31 70 0" rs 91 41 65 rs " 73 31 64 rs " 20 40 41 rs 1" 10 28 52 8" T" T" T" T" T" C" C" C" C" C" A" A" A" A" A" G" G" G" G" G" BC10 BC9 BC8 BC7 BC6 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# 0%# 10%# 20%# 30%# 40%# 50%# 60%# 70%# 80%# 90%# 100%# rs 14 90 41 rs 3# 10 49 54 07 rs # 89 17 00 rs # 14 13 21 2# rs 87 67 24 rs # 90 71 00 rs # 13 57 61 rs 7# 13 55 36 rs 6# 20 46 36 rs 1# 19 79 25 5# rs 71 73 02 rs # 25 19 34 rs # 10 29 04 7# rs 72 78 11 rs # 91 71 18 rs # 73 76 81 rs # 76 38 69 rs # 20 56 27 rs 7# 10 15 25 rs 0# 14 63 72 rs 9# 13 60 28 8# rs 73 51 55 rs # 96 46 81 rs # 90 13 98 rs # 20 76 84 rs 8# 21 07 61 rs 2# 21 11 98 rs 0# 13 35 87 rs 3# 18 86 51 0# rs 35 44 39 rs # 14 54 36 1# rs 87 31 Reads per alleley  rs  ID 96 rs # 80 37 42 rs 9# 15 28 46 0# rs 72 91 SNPs  b normalized 72 rs # 13 82 38 7# rs 74 09 10 rs # 93 82 83 rs # 14 93 23 rs 2# 10 24 11 6# rs 71 93 66 rs # 10 31 82 rs 5# 10 05 53 3# rs 72 20 98 rs # 28 31 70 0# rs 91 41 65 rs # 73 31 64 rs # 20 40 41 rs 1# 10 28 52 8# T# C# A# G# T# T# T# T# C# C# C# C# A# A# A# A# G# G# G# G# Allele  alloca7on
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×