• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content

Loading…

Flash Player 9 (or above) is needed to view presentations.
We have detected that you do not have it on your computer. To install it, go here.

Like this presentation? Why not share!

Rethinking microbial diversity analysis in the high throughput sequencing era

on

  • 962 views

 

Statistics

Views

Total Views
962
Views on SlideShare
942
Embed Views
20

Actions

Likes
0
Downloads
7
Comments
0

1 Embed 20

http://lemosbioinfo.wordpress.com 20

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Rethinking microbial diversity analysis in the high throughput sequencing era Rethinking microbial diversity analysis in the high throughput sequencing era Presentation Transcript

    • Universidade Federal do Pampa Curso de Bacharelado em Ciências Biológicas Trabalho de Conclusão VRETHINKING MICROBIAL DIVERSITY ANALYSIS IN THE HIGH THROUGHPUT SEQUENCING ERA Acadêmico: Leandro Nascimento Lemos Prof. Dr. Luiz Fernando Wurdig Roesch - Orientador São Gabriel-RS 2011 L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51 1
    • L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 1. Introdução Geral1.1. - Estimativa da diversidade microbianaa) Anomalia de Placas ~ 5% 1) dificuldade em simular inúmeras condições ambientais em meios de cultura. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 1. Introdução Geral1.1. - Estimativa da diversidade microbianab) Técnicas independentes de cultivo de micro-organismos L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 1. Introdução Geral1.3. Sequenciadores de nova geração Primeira Segunda Terceira Geração Geração Geração …ACGTGACTGAGGCTAG CTAGACTACTTTATATATATACGTCGT CACTGATGACTAGATTAACTGATTTAGATACCTTGATTTTAAAAAAATA L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • A 16S primer Bacterial DNA 16S primer B Barcode primer B Barcodes 16S rRNA primer Sample A Sample B Sample C Sample D Modified from Hoffmann et al. (2007) Nucl. Acid. Res. Barcode 1 Barcode 2 Barcode 3 Barcode 4 Sample A Sample B Sample C Sample DL.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 1. Introdução Geral1.3. Crescimento do número de sequências no RPD II e SILVA-> Maior crescimento a partir de 2007 (Roesch et al., 2007). L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • Grande diversidade a) O solo apresenta a maior diversidade microbiana do ambiente terrestre. O número de sequências é de fundamental importância para obtenção de resultados confiáveis.http://biology.uoregon.edu/people/BOHANNAN/pics/Microbes.jpg L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • Hipótese:- Se o número de sequências não é representativo em umambiente, os resultados obtidos podem não ser válidos econfiáveis;- O número de sequências necessários em cada tipo deabordagem pode variar de acordo com o teste aplicado e adiversidade de cada ambiente. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • Objetivos:- Demonstrar que o nível de esforço amostral obtido em análisesde comparação de comunidades microbianas pode produzirresultados distintos;- Determinar quais os tipos de análises e inferências maiseficientes quando temos disponível um número pequeno ougrande de sequências obtidos por plataformas desequenciadores de nova geração. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 2. Material e Métodos 5 L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 2. Material & Metódos2.1. Processamento de sequências, simulação de comunidadesmicrobianas e análises de Bioinformática Eliminação de sequências de baixa qualidade trim.pl Simulação de comunidades microbianas hipotéticas r_s_q.pl 100 500 1000 5000 500 500 500 500 10000 20000 L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 2. Material & Metódos2.2. Análises de Bioinformática L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 2. Material & Metódos2.3. Abordagens baseadas em táxons (taxon-based approaches) campo1 campo2 campo3 Alinhamento de sequências (Algoritmo de Needleman-Wunsch) UTO1 4 8 19 UTO2 2 2 1 Greengenes Mothur UTO3 0 1 34 Agrupamento de sequências para formação de Unidades Taxonômicas Operacionais 3 e 20% de dissimilaridade Mothur L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 2. Material & Metódos2.2. Abordagens baseadas em testes de hipóteses ( hypothesistesting approaches) Agrupamento de sequências CD-HIT Construção de uma árvore filogenética MUSCLE Comparação de comunidades microbianas UNIFRAC L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • Comparação entre comunidades microbianas Análise de Coordenadas Principais (ACP) ACP - Qualitativo ACP - Quantitativo
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) Análise de Cobertura = representatividade L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) a) indivíduos únicos ou compartilhados; Florida - 5%; Antártica - 15%; Mauna Ulu - 9.3%; Puu Puai bare - 12.4%; – Era esperado um número maior de sequências compartilhadas; – Mesmo conjunto de dados. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) Florida - 48%; Mauna Ulu - 59%; Puu Puai bare - 47%; L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) – ---> Amostras com uma baixa cobertura não apresentam resultados confiáveis ao ser aplicado Diagramas de Venn; – ---> É necessário uma alta cobertura (> 90%); L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) a) Índices de diversidade = comparação e caracterização decomunidades microbianas ---> Aumento da diversidade com o aumento do número de sequências em uma amostra; L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) ---> Sem mudanças significativas. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) ---> Sem mudanças significativas. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) ---> Sem mudanças significativas. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) b) Estimador de riqueza = Chao1 L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.1. Abordagens baseada em táxons (Quantas sequências sãonecessárias?) – ---> Chao1 não apresenta resultados confiáveis quando aplicado numa base de dados com um pequeno número de sequências. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.2. Abordagens filogenéticas (Quando devem ser usadas?) – a) amostras aleatórias com a mesma intensidade amostral (4 – amostras de 500 sequências para cada ambiente); – b) amostras aleatórias com o aumento da intensidade amostras (100, 500, 1.000, 5.000, 10.000 e 20.000) – c) amostras aleatórias com o aumento da intensidade amostral (100, 500 e 20.000) para comparação de três ambientes. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.2. Abordagens filogenéticas (Quando devem ser usadas?) L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.2. Abordagens filogenéticas (Quando devem ser usadas?) – ---> (A) - 10.000 sequências são necessárias para formação de agrupamento; – ---> (B) - Formação de agrupamentos a partir de 500 sequências. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.2. Abordagens filogenéticas (Quando devem ser usadas?) – ---> (A) e (B): sem formação de agrupamentos. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.2. Abordagens filogenéticas (Quando devem ser usadas?) – ---> Limitação: as amostras poderiam ser muito similares, devido a uma mesma origem de base de dados; – – ---> Qual o nível de cobertura para comparar comunidades microbianas de ambientes distintos? L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 3. Resultados3.2. Abordagens filogenéticas (Quando devem ser usadas?) – (A) e (B) baixa cobertura = ambientes distintos (escala continental) L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 4. Discussão Realmente precisamos de milhares de sequências para avaliar adiversidade microbiana?a) Cobertura;b) Ambiente a ser analisado. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 4. Discussão Realmente precisamos de milhares de sequências para avaliar adiversidade microbiana?a) Cobertura; Com base nos resultados de cobertura (51 - 81%) era esperado que o númerode Unidades Taxonômicas Operacionais entre as amostras fosse relativamentealto. É necessário ter uma cobertura (> 90%) para a aplicação dos Diagramas deVenn L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 4. Discussão Realmente precisamos de milhares de sequências para avaliar adiversidade microbiana?a) Cobertura; – Um grande porcentagem de espécies estão presentes em um número pequeno. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 4. Discussão Realmente precisamos de milhares de sequências para avaliar adiversidade microbiana?a) Normalização do número de sequências; L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 4. Discussão Realmente precisamos de milhares de sequências para avaliar adiversidade microbiana?a) Normalização do número de sequências; L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 4. Discussão Realmente precisamos de milhares de sequências para avaliar adiversidade microbiana?a) Chao1 = apenas com intensidade amostral alta L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 4. Discussão Realmente precisamos de milhares de sequências para avaliar adiversidade microbiana? a) Chao1 = apenas com intensidade amostral alta L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 4. Discussão Realmente precisamos de milhares de sequências para avaliar adiversidade microbiana?a) Baixa cobertura e abordagens filogenéticas L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 4. Discussão Realmente precisamos de milhares de sequências para avaliar adiversidade microbiana?b) Ambientes similaresI) ACP - quantitativo = 500 sequênciasII) ACP = qualitativo = 10.000 sequências L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 5. Conclusão- Abordagens baseadas na informação filogenética são deextrema importância para a comparação de comunidadesmicrobianas do solo com alta ou baixa cobertura;- Abordagens baseadas em Unidades Taxonômicas Operacionaissão úteis para detectar mudanças em UTOs específicas, mas énecessário uma alta cobertura. L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • 5. ConclusãoL.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51
    • Agradecimentos:- Ao CNPq, pela bolsa de IniciaçãoCientífica; 46
    • Universidade Federal do Pampa Curso de Bacharelado em Ciências Biológicas Trabalho de Conclusão VRETHINKING MICROBIAL DIVERSITY ANALYSIS IN THE HIGH THROUGHPUT SEQUENCING ERA Acadêmico: Leandro Nascimento Lemos Prof. Dr. Luiz Fernando Wurdig Roesch - Orientador São Gabriel-RS 2011 L.N. Lemos et al. / Journal of Microbiological Methods 86 (2011) 42–51 47