Clase 3
Upcoming SlideShare
Loading in...5
×
 

Clase 3

on

  • 1,985 views

 

Statistics

Views

Total Views
1,985
Slideshare-icon Views on SlideShare
1,985
Embed Views
0

Actions

Likes
3
Downloads
156
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Clase 3 Clase 3 Presentation Transcript

    • Decisiones Detección Diagnóstico Investigación Terapia TECNICAS DE ESTUDIO MOLECULAR PCR
    • ¿Que es genotipificacion? • Genoma: “es la totalidad de la información genética que posee un organismo en particular y que codifica para él.. En humanos, el genoma consiste de 23 pares de cromosomas” • Alelo: “Diferentes formas o variantes de una gen” • Genotipo: “Conjunto particular de alelos para todos los genes portados por un individuo” Genotipificación Determinación del genotipo de una persona
    • PCR REACCION EN CADENA DE LA POLIMERASA • Amplificación enzimática de un fragmento de DNA • (simulando una replicación natural del DNA “in vitro”)
    • Eventos en la Replicación del DNA: • Apertura de las cadenas (origen de replicación) • Colocación de los iniciadores (primers de RNA) ( La cadena líder utilizará un solo iniciador mientras que las cadenas rezagadas utilizarán varios iniciadores de RNA.) • Síntesis de cadenas de DNA (partiendo de los iniciadores) • Eliminación de los iniciadores de RNA. • Unión de los fragmentos de DNA (por la enzima DNA ligasa)
    • Reacción en cadena de la polimerasa (PCR) • Componentes – Desoxinucleotidos (dNTPs)  dATP, dTTP, dGTP, dCTP – Enzima  Taq (Thermus aquaticus) – Iniciadores (Primers)  Complementarios a la cadena de ADN – ADN molde  Concentracion de 20ng
    • PCR: Ciclador térmico
    • Desoxinucleotidos (dNTPs) Bases Nitrogenadas del ADN Union por puentes de hidrogeno Adenina-Timina Guanina-Citocina
    • ADN polimerasa Estable a altas temperaturas Thermus aquaticus Thermococcus litoralis Enzima de 95kd. Actividad Exonucleasa: 5’—3’ Actuar altas temperaturas
    • PRIMERS (Iniciadores, Cebadores) Dos oligonucleótidos que son complementarios a cada una de las dos hebras del ADN. Únicos: Asegura alta especificidad: 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 3’ CARACTERÍSTICAS IMPORTANTES Únicos Tamaño Dimeros de primers 5’ La secuencia del extremo 3’ es critica para el funcionamiento
    • Tamaño • Efectos en: – Carácter de único • Mas tamaño (15pb) • Temperaturas de anillaje (ºTm) – La temperatura a la cual la mitad de las hebras de ADN son doble cadena (dc) y la mitad cadena sencilla (cs)
    • Par de“primers” específicos ADN templado Buffer p/ ADN Pol. MgCl2 dCTP dATP dTTP dGTP dH2O estéril PCR Mezcla de Reacción Desoxinucleótidos
    • Etapas de la PCR 1. Desnaturalización: Apertura de la doble cadena 2. Alineamiento: Anillaje de primers 3. Extensión: Generación de la nueva cadena Temperatura 30 ciclos 100 Desnaturación Desnaturación 94 oC Extension 72 oC 50 50-60oC Anillaje 0 Tiempo 94 oC
    • Temperatura 100 Melting 94 oC PCR 50 0 Tiempo DNA de cadena doble 3’ 5’ 5’ 3’
    • Temperatura 100 PCR 94 oC 50 0 Tiempo 3’ DNA de cadena simple 5’ Calor 5’ 3’
    • Temperatura 100 PCR 94 oC 50 Melting o Extension 94 C Annealing 72 oC Primers 50 oC 0 Tiempo 3’ 5’ 5’ Hibridación de primers 5’ 5’ 3’
    • Temperatura PCR 100 94 oC 50 Melting o Extension 94 C Annealing 72 oC Primers 50 oC 0 Tiempo 3’ 5’ Calor 5’ 5’ Calor 5’ 5’ 3’ 30 ciclos
    • Temperatura PCR 100 94 oC 50 Melting o Extension 94 C Annealing 72 oC Primers 50 oC 0 Tiempo 3’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 3’ 30ciclos
    • Temperatura PCR 100 50 94 oC 30ciclos Annealing Extension 72 oC Primers 50 oC 0 3’ 5’ 5’ Tiempo 5’ 5’ 5’ 3’ Calor 5’ 5’ Calor 5’ 94 oC
    • Temperatura 100 50 PCR 94 oC 30ciclos Annealing Extension 72 oC Primers 50 oC 0 3’ 5’ 5’ 5’ 5’ 5’ Tiempo 5’ 3’ 5’ 5’ 5’ 5’ 5’ 5’ 94 oC
    • Temperatura PCR 100 94 oC 50 30ciclos Annealing Extension 72 oC Primers 50 oC 0 3’ 5’ 5’ 5’ 5’ 5’ Tiempo 5’ 3’ Fragmentos de tamaño definido 5’ 5’ 5’ 5’ 5’ 5’ 94 oC
    • El numero de copias del DNA delimitado por los primers se duplica en cada ciclo de PCR. Numero de copias 1 2 4 0 1 # ciclos 2 8 16 32 64 3 4 5 6
    • PCR animation
    • PCR
    • El numero de copias del DNA delimitado por los primers se duplica en cada ciclo de PCR. Numero de copias 1 2 4 8 16 32 64 0 1 2 3 4 5 6 Numero de ciclos
    • Electroforesis Revelado Separación de moléculas en un campo eléctrico Electrodo (+) Cámara de electroforesis Camas para preparación del gel de agarosa Fuente de poder Electrodo (-)
    • Agarosa y su preparación Gel actúa como filtro molecular, controlando la migración en función del peso molecular
    • Agarosa Mezclar agarosa con una solución tampón como el TAE (tris-ac. Acetico-EDTA) Calentar
    • Tinción con Bromuro de etidio Agente intercalante Bromuro de Etidio Molécula fluorescente que se intercala entre la s bases de la molécula de DNA Absorción a 330 nm (UV)emisión en luz visible
    • Factores que afectan la velocidad de migración 1. TAMAÑO DEL FRAGMENTO la velocidad de migración del fragmento es inversamente proporcional al log del nº de pares de bases 2. CONFORMACION DE LA MOLECULA ADN circular ADN Lineal
    • 3. VOLTAJE APLICADO La velocidad de migración es proporcional al voltaje aplicado 4. CONCENTRACIÓN AGAROSA Inversamente proporcional a velocidad de corrido 2% 1.5% 1% 0.5%
    • Interpretación de electroforesis Marcador de peso molecular 1.Permite identificar tamaño de fragmentos 25pb 50pb 100pb
    • Ejemplos de corridos de electroforesis Con marcador de 100pb Con marcador de 50pb M 1 2 3 4 5 6 M 1 2 3 4 7 300pb 400pb 250pb 150pb 100pb 400pb 350pb 300pb 250pb M
    • Bandas Inespecíficas Corrido de electroforesis con bandas inespecíficas Bandas definidas con diferentes pesos moleculares
    • Interpretación de electroforesis Calidad del ADN BUENA CALIDAD DE ADN 1 2 3 4 5 CP: Control Positivo CN: Control Negativo 1-6: Pacientes 6 CP CN DIFERENTES CALIDADES DE ADN 1 2 3 4 CP CN CP: Control Positivo CN: Control Negativo Pozo 2  No ADN Pozos 3 y 4  Bajas concentraciones
    • Técnicas derivadas/ basadas en PCR PCR Nested :Amplificación de una secuencia dentro de otro previamente amplificada PCR Multiplex :Varios targets diferentes en forma simultánea PCR-RFLP :Polimorfismo genético RT-PCR : Detección de mRNA Real Time PCR :Cuantificación de copias iniciales – en tiempo real
    • PCR Nested (anidada) Dos rondas de amplificación con diferentes pares de primers 1 Reacción Primers externos para amplificación de una secuencia extensa 2 Reacción Primers internos para amplificación de una región especifica SEGUNDA PCR Genera mayor ESPECIFICIDAD
    • PCR Multiplex • Amplificación de varias secuencias de forma simultanea • Diferentes set de primers • Ojo Tamaño del amplicon APLICACIONES Ensayos de deleciones Amplifica exones Ensayos forenses Biomarcadores polimórficos Ensayos microbiológicos Cepas y especies
    • RFLPs Restriction fragment length polymorphism • Estudios de polimorfismos: variación en la secuencia de ADN METODOLOGIA 1. Extracción de ADN 2. PCR – se obtiene la secuencia target 3. Digestión con enzimas de restricción  mecanismo de defensa de bacterias 4. Electroforesis en gel
    • Cambios en el sitio de restricción Person A 5' GGCC GGCC GGCC GGCC 3' GGCC GGTC GGCC 3' Person B 5' GGCC
    • Cambios en el sitio de restricción Hae III corta: 5' GGCC CC 5’ GGCC 3’ GGCC GGCC GG CC CC 3' GG CC 5' GGCC GGCC GGCC GGTC GG GGCC GG CC GG 3'
    • ADN NORMAL ADN NORMAL A B ADN SILVESTRE C B+C A B C C ADN MUTADO B A A B+C A
    • PCR en tiempo real (RT-PCR)  La técnica RT-PCR combina la amplificación del DNA con la detección de los productos en un solo tubo.  “Tiempo Real”: Detección de productos de PCR en la medida que se van generando  Monitoreando la amplificación de una secuencia especifica en tiempo real utilizando tecnologías fluorescentes UTILIDADES - Genotipificación - Cuantificación de carga viral - Cuantificación del numero de copias de un gen - Expresión génica (RNA)  Retrotranscripción
    • Componentes RT-PCR Target DNA Polimerasa Primer Nucleótidos Solución Buffer Sonda Termociclador Segmento de ADN que se ha seleccionado para amplificar. Es el molde (Muestra). Enzima capaz de copiar el ADN usado como molde una hebra simple de ADN (produce una hebra complementaria). Segmentos cortos de ADN de cadena simple específico para un segmento de DNA. Los primers son usados como punto inicial de la actividad de la DNA polimerasa. Pequeñas unidades de ADN; “letras“ del alfabeto biológico (A, T, C, G). Solución que reúne las condiciones necesarias para que la reacción de amplificación se de. Segmento corto de ADN complementario al target (marcadores fluorescentes) Equipo que produce ciclos térmicos (Capacidad de detectar sondas)
    • PCR Convencional Vs. PCR en Tiempo Real PCR tradicional Preparación de la Muestra Amplificación Detección PCR en Tiempo Real Preparación de la Muestra Amplificación y Detección
    • Sistemas de Detección Uso de moléculas fluorescentes No-Específico SYBR Green I  Molecular fluorescente que se unen a ADN  Emisión a 520nm DESVENTAJAS Inespecífico
    • Curva de Melting PRODUCTOS ESPECIFICOS
    • Curva de melting PRODUCTOS ESPECÍFICOS TIENE UN MAYOR °TM
    • Sistema de Detección Específico TaqMan Uso de “secuencia especifica de oligonucleotidos” - Reportero 5’: Emite fluorescencia - Quencher 3’: Bloquea emisión de fluorescencia Actividad 5’ nucleasa Separación reportero-quencher
    • Sistema de Detección Específico Molecular Beacon Probes Secuencia de la sonda Stem Quencher Fluoroforo
    • Molecular Beacon Probes
    • Sistema de Detección Específico Scorpions probe 1. Hibridación del primer a una secuencia target Loop Stem Bloqueador Quencher Primer Fluoroforo 2. Extensión de la polimerasa formando un producto de PCR
    • 4. Fase de anillaje  Cambio conformacional del loop 5. Hibridación
    • Cinética de la PCR  Exponencial: Duplicación exacta del producto  se acumula en cada ciclo.  Lineal: Componentes consumidos, productos empiezan a degradarse.  Plateau: Reacción se consume y no se generan más productos.
    • Fluorescencia Plateau Fase logarítmica UMBRAL CT (CP) Número de ciclos • Umbral: Fluorescencia basal de las muestras debido al SYBR Green y Sondas de Hibridación (determinado automáticamente por el instrumento). • CT (CP): Número de ciclo en donde la fluorescencia supera el umbral.
    • …El CT depende de la concentración inicial de ADN! A > CT < [ ADN inicial ] A < CT > [ ADN inicial ] 1 1. 2. 3. 4. 5. 10 ng = CT 18 1 ng = CT 21 100 pg = CT 25 10 pg = CT 28 Blanco 2 3 4 5
    • RT-PCR (Retro-transcripción) Detección de la expresión de un gen – por presencia de mRNA mRNA Enzima mRNA—cDNA : Retro-transcriptasa Primers: - Hexameros al azar - Oligo dT cDNA PCR Enzima Taq polimerasa
    • Métodos moleculares PCR Ventajas • • • • • Método “Gold standard” Se independizan del transporte. Alta sensibilidad y especificidad Se pueden utilizar sondas Se puede utilizar en muestras no invasivas
    • Desventajas: • Se necesita cierta información de la secuencia en estudio para poder diseñar los primers. • Limitaciones del tamaño del fragmento a amplificar • Errores de la replicación. • Contaminación (se reduce considerablemente tomando las precauciones necesarias y en manos experimentadas).
    • SECUENCIACIÓN
    • Mezcla de reacción
    • Secuenciación de Sanger • Reacción de PCR • Uso de: – Dideoxinucleotidos – Deoxinucleotidos  dNTPs
    • La Reacción con ddATP 3’AATAGCATGGTACTGATCTTACGCTAT5’ 5’TTATCGTA 5’TTATCGTACCATGACTAGAATGCGA 5’TTATCGTACCATGACTAGA 5’TTATCGTACCATGACTA 5’TTATCGTACCATGA 5’TTATCGTACCA 5’TTATCGTA 5’TTATCGTACCA 5’TTATCGTACCATGA 5’TTATCGTACCATGACTA 5’TTATCGTACCATGACTAGA 5’TTATCGTACCATGACTAGAATGCGA 8pb 11pb 14pb 17pb 19pb 25pb
    • Separación de Fragmentos ddCTP ddGTP ddTTP Lectura 5’ a 3’ desde la basa al tope ddATP INTERPRETACION DEL GEL AGTACTTATGCAGGTC ACGTGCA
    • Secuenciación automatizada “Dye terminator”  Marca fluorescente en cada uno de los diferentes nucleótidos: A, T, G y C.  Emisión de luz a una longitud de onda especifica  Laser de iones de argón
    • Electroforesis Capilar
    • Lecturas automatizadas de las secuencias de ADN Cromatograma o electrofenograma - Se representa la base según color diferente - Intensidad de la señal luminosa (altura del pico)
    • Secuenciación de Sanger
    • Conclusiones • Aunque en biología molecular existen muchas técnicas para detección de cambios tanto a nivel del ADN como a nivel cromosómico, el secreto esta en seleccionar la mas adecuada dependiendo de los requerimientos y la disponibilidad