Your SlideShare is downloading. ×
0
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Marker devt. workshop 27022012
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Marker devt. workshop 27022012

458

Published on

Marker development for gene mapping in barley with necessary resources as web links at the end of the presentation.

Marker development for gene mapping in barley with necessary resources as web links at the end of the presentation.

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
458
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
56
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Marker development for mapping Ravi Koppolu RG: Plant Architecture IPK, Gatersleben
  • 2. Outline  Few concepts  Different types of molecular markers and applications  Marker development for gene mapping
  • 3. Exon 1 5‘ 3‘ 5‘-UTR Start codon: ATG Intron 1Promoter 3‘-UTR I 2 Stop codon: TAG TAA TGA Exon 3 Genomic DNA (gDNA)  mRNA  Protein Exon 2 genomic DNA Transcr. Start Start: ATG Stop: TAG TAA TGA ORF (open reading frame) coding sequence Translation Protein Poly(A)A..A mature mRNA Transcription & Post transcriptional modification Slide from Dr. Thorsten Schnurbusch
  • 4. Polymorphism? Is the ability to distinguish two or more individuals The variation shown here is due to four different alleles at a particular gene. Molecular markers can identify sequence polymorphisms among two or more individuals which may result in the change of phenotype. vrs4.k TGGTTGCAGCGGCCACGACACCGGGGGC-GGGGCGCCGTGCGCTGCGTG :Mutant allele MFB104 TGGTTGCAGCGGCCACGACACCGGGGGCCGGGGCGCCGTGCGCTGCGTG :Wild allele 2-rowed spike 6-rowed spike
  • 5. Subsequently, genetic variation at DNA aroused due to mutation will cause variation in protein Protein markers Mutation Mutation arises genetic variation at the DNA level DNA markers A sequence of DNA or protein that can be screened to reveal key attributes of its state or composition and thus used to reveal genetic variation Molecular marker
  • 6. Genomic DNA mutations can be classified into GATCCGAGTATCGCAATTAGCA GATCCGAGTGTCGCAATTAGCA Base substitution GATCCGAGTATCGCATGCATTAGCA GATCCGAGTA ̶ ̶ ̶ ̶ ̶ ̶ ̶ ̶ ̶ ATTAGCA Deletion GATCCGAGTATCGCAATTAGCA GATCCGAGTATCGCAGCATTAGCA Insertion GATCCGAGTATCGCAATTAGCA GATCCGAGTATCTCGCAATTAGCA Duplication GATCCGAGTATCGCAATTAGCA GATGCCAGTATCGCAATTAGCA Inversion
  • 7. Molecular marker types Co-dominant marker systems Restriction Fragment Length Polymorphisms (RFLPs) Simple sequence repeats (SSRs) SNP based marker systems Dominant marker systems Random amplified polymorphic DNAs (RAPD) Amplified fragment length polymorphism (AFLP) Diversity arrays technology (DArT)
  • 8. Co-dominant vs. Dominant marker systems Collard et al. 2005; Euphytica Co-dominant marker Dominant marker Co-dominant markers follow Mendelian inheritance pattern
  • 9. Simple sequence repeats (SSRs) SSRs contain tandem repeated single, double, triple nucleotides several times Allelic variants differ in terms of number of repeats
  • 10. Single nucleotide polymorphisms (SNPs)  A mutation that causes single base change is SNP  Most of them don't have a phenotypic effect  SNPs can be alleles of a particular gene  SNPs are most abundant types of DNA variation found among individuals of same species
  • 11. Applications of molecular markers  Germplasm identification, Classification  Genetic diversity/Relatedness  Selection of parents for making wide crosses  Development of molecular linkage maps  Marker assisted selection  Genomic selection  Map-Based cloning of genes
  • 12. Synteny enables to recruit markers from related species Close et al. 2010; BMC Genomics Mayer et al. 2011, Pl. Cell
  • 13. BLAST against barley EST’s Flank introns/UTRs with primers viroBLAST against barley contigs Resequence SNP Length polymorphism CAPS dCAPS Genotyping on Agarose Syntenic/Colinear regions Marker development procedure at AG PBP
  • 14. Resources for our Marker development workshop
  • 15. Genome Zippers Provide information on putative linear gene order for ̴86% barley genes based on synteny with rice, sorghum and Brachypodium. Mayer et al. Plant Physiol, 2009 Available at http://mips.helmholtz-muenchen.de/plant/triticeae/barleyDisclaimerGZ.jsp A snapshot of Genome Zipper
  • 16. Syntenic cereal sequence databases http://rice.plantbiology.msu.edu/annotation_pseudo_current.shtml http://www.brachypodium.org/
  • 17. Barley viroBLAST Barley viroBLAST contains sequence data like 1.) 28X Illumina shot gun reads based on Morex 2.) Sequenced BACs 3.) Sorted chromosome sequences 4.) Full length cDNA sequences http://webblast.ipk-gatersleben.de/barley/index.php
  • 18. BLAST output with the barley viroBLAST sequence as query against barley EST database The sequence/s from viroBLAST can be BLASTed against barley ESTs to identify Exon-Intron boundaries
  • 19. Primer design  Primers designed to span boundaries of two exonic regions or to the UTRs  Primers can be picked manually or by using software’s like primer3  GC content of a primer pair should better be >=30%  Avoid having multiple A’s or T’s at the 3’end.  Check whether primers are forming any secondary structures or dimers  Better to have overlapping Tm for different primer pairs  If designed manually don't forget to reverse complement the reverse primer Stem loops Dimers
  • 20. Resequencing of primer pairs Resequence the primer pairs in the parents of interest to identify sequence polymorphisms. Sequence analysis will be demonstrated during the workshop Snapshot showing SNPs and deletions identified after resequencing in parents
  • 21. Development of CAPS and dCAPS markers CAPS: Cleaved Amplified Polymorphic sequence In principle CAPS is similar to RFLP except that a shorter PCR amplified product with known SNPs is digested with restriction enzymes instead of whole genomic DNA. Contd….
  • 22. dCAPS: Derived Cleaved Amplified Polymorphic sequence In dCAPS assay mismatches in PCR primers are introduced to create restriction endonuclease polymorphism based on the target mutation. BclI recognition site: CC(N)7GG
  • 23. Web links for Marker development Brachypodium database: http://www.brachypodium.org/ Rice database http://rice.plantbiology.msu.edu/annotation_pseudo_current.shtml Rice ID Converter http://rapdb.dna.affrc.go.jp/tools/converter Barley viroBLAST http://webblast.ipk-gatersleben.de/barley/viroblast.php NCBI BLAST http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome IDT manual Primer design http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/Default.aspx http://www.basic.northwestern.edu/biotools/oligocalc.html Primer3 http://frodo.wi.mit.edu/primer3/ Reverse complement generator http://www.bioinformatics.org/sms/rev_comp.html Clustalw http://www.ebi.ac.uk/Tools/msa/clustalw2/ Nebcutter http://tools.neb.com/NEBcutter2/ dCAPS finder http://helix.wustl.edu/dcaps/dcaps.html

×