Discover and advanceCancer research                       Dissociate tumor tissue                       Isolate cancer ste...
MACS® Technology by Miltenyi Biotec                                                                                       ...
Push the envelope of innovation                                                                       From bench to bedsid...
Taking tumor tissue to task                                                                                               ...
The driving force of tumor development                                                                                    ...
Hematological tumors                                                                                                      ...
Spreading the tumor                                                                                                       ...
Molecular analysis     Expression profiling and mitochondrial enrichment     Excel in tumor molecular analyses            ...
Cancer Research Biotec
Cancer Research Biotec
Cancer Research Biotec
Cancer Research Biotec
Cancer Research Biotec
Upcoming SlideShare
Loading in …5

Cancer Research Biotec


Published on

  • Be the first to comment

  • Be the first to like this

No Downloads
Total views
On SlideShare
From Embeds
Number of Embeds
Embeds 0
No embeds

No notes for slide

Cancer Research Biotec

  1. 1. Discover and advanceCancer research Dissociate tumor tissue Isolate cancer stem cells Enrich and detect circulating tumor cells Investigate endothelial and progenitor cells
  2. 2. MACS® Technology by Miltenyi Biotec Sorting out a cell separation strategy Providing a firm foundation for reliable results Choosing the optimal way of cell separation Contents Propel your cancer research Positive selection Untouched isolation Sequential sorting: Depletion followed by positive selection 4 Push the envelope of innovation with MACS® Technology Magnetic labeling Magnetic labeling First magnetic Comprehensive solutions for cancer research MACS® Technology, the recognized standard in cell separation, Cells of interest are Non-target cells are labeling has supported oncology research and immunobiology for magnetically labeled magnetically labeled Non-target cells are with MACS with a biotinylated magnetically labeled 5 From bench to bedside over 20 years. MicroBeads. antibody cocktail with a biotinylated Translating discovery research into clinical therapy and Anti-Biotin antibody cocktail and MicroBeads. Anti-Biotin Benefit from MACS Technology MicroBeads. 6 Taking tumor tissue to task Tumor tissue dissociation • Easily isolate rare cell populations First magnetic • Optimal recovery and excellent purity separation 7 Tumor immunology • Fast, convenient, and reliable Undesired cells are Interaction between immune system and cancer cells • Gentle to cells retained in a MACS Magnetic Column placed in a • Automated cell separation with the separation MACS Separator while 8 The driving force of tumor development autoMACS® Pro Separator the unlabeled cells Cancer stem cells Cells are separated in pass through. • Compatible with flow cytometry a MACS Column placed in a MACS 9 Targeting cancer stem cells • Cell separations can easily be scaled-up Separator. Tools for the enrichment and analysis of CSCs • Bridges basic research and clinical applications The flow-through Second magnetic fraction can be Magnetic labeling collected as the separation 10 Hematological tumors About MACS MicroBeads negative fraction Target cells are Undesired cells are magnetically labeled MACS MicroBeads are superparamagnetic particles of depleted of the Multiple myeloma and B-CLL labeled cells. retained in a MACS with MicroBeads approximately 50 nanometers in diameter. They are composed Column placed in a according to a subset MACS Separator. marker. 11 Tumor vascularization of a biodegradable matrix, and it is therefore not necessary to remove them from cells after the separation process. Elution of the The target cells pass Endothelial cells, pericytes, and endothelial progenitors through the column labeled cell fraction Second magnetic • Colloidal, for easy handling, and short incubation times and are collected as separation The column is the enriched, 12 Spreading the tumor • Small (50 nm), non-toxic, biodegradable removed from the unlabeled cell Target cells are Circulating tumor cells separator. The fraction, depleted of retained in the column • Detachment is not required for downstream experiments retained cells are while unlabeled cells non-target cells. eluted as the pass through. After • Conjugated to highly specific monoclonal antibodies 13 Capture circulating tumor cells enriched, positively the column is Tools for enrichment and analysis of CTCs selected cell fraction. removed from the separator, the target cells are eluted as the 14 Molecular analysis enriched, positively Expression profiling and mitochondrial enrichment selected cell fraction. Positive selection means that the desired target Untouched isolation is performed by Cell subsets can be isolated by first depleting the 16 Optimal conditions cells are magnetically labeled and isolated as the depletion of undesired cells. Non-target non-target cells and then positively selecting the Cell culture magnetically retained cell fraction. cells are magnetically labeled and eliminated cell subsets of interest. Positive selection is the most direct and specific from the cell mixture. The non-magnetically This strategy is useful if undesired cells in the way to isolate the target cells from a heterog- labeled, untouched cell fraction contains the cell suspension express the same antigen that 17 Order information enous cell suspension. Binding of MicroBeads target cells. is used for positive selection of the target cells. Place your order by fax, phone, or online! to the cell surface does not affect viability or For many different cell types, Miltenyi Biotec function of the cells. Both fractions, labeled and offers optimized MACS Cell Isolation Kits contain- unlabeled, can be recovered and used. ing pre-titrated cocktails of antibodies directed 21 References against non-target cells. More than 13,000 studies used Miltenyi Biotec products2 3
  3. 3. Push the envelope of innovation From bench to bedside Comprehensive solutions for cancer research Translating discovery research into clinical therapy Streamline your experiments Researchers working for researchers A bridge from laboratory to clinic Miltenyi Biotec reagents, instruments, and services are As a premier biotechnology company, Miltenyi Biotec is We are aware of the many challenges faced by translational designed to support scientists in achieving outstanding results. committed to the advancement of scientific understanding researchers. Bridging proof-of-principle research with From sample preparation, through cell sorting and culture to and medicine by providing products and services for GMP-grade therapies isnt easy and we can help you performing cell and molecular analyses. biomedical research and cellular therapy. overcome these challenges. In today’s research environment the translation of discovery MACS Sample Preparation MACS Cell Culture research into efficacious clinical treatments is of utmost Discover The quality of an experiment The product portfolio for importance. Our product portfolio and vast interdisciplinary A portfolio of over 1,000 products is at your disposal, helping strictly depends on the quality cell culture includes media expertise pays tribute to that fact. you to convert pioneering concepts into reality. of the sample preparation. Use as well as recombinant the innovative gentleMACS™ cytokines and growth Dissociator for consistent, fast, factors up to GMP grade. Advance and gentle dissociation and In addition, products for homogenization of various effective cell activation and Countless researchers worldwide rely on our products to tissues or cells in a closed expansion are available. advance their research; in fact, more than 13,000 peer reviewed system. scientific publications support this claim. Translate Many of our reagents are available as research-grade and GMP-grade products, making the transition to clinical therapy that much easier. We also manufacture CE-marked instruments and reagents for use in a clinical setting. MACS Cell Separation MACSmolecular A large panel of MACS We provide products for MicroBeads and MicroBead Kits protein isolation and Discover. Advance. Translate. are available for the isolation detection, mRNA purification of virtually any cell type. The and amplification, cDNA cells can be separated manually synthesis and labeling, using MACS Magnets, or microRNA analysis, as well as automatically with the microarray technologies and autoMACS® Pro Separator. instrumentation. Also we offer genomic services: gene and microRNA expression analyses, array-CGH, and bioinformatics. MACS Cell Analysis CliniMACS® We provide a large selection  With the CliniMACS® Cell of monoclonal antibodies and Separation System, Miltenyi kits for fluorescence Biotec has successfully taken microscopy and flow the step from research into cytometry. The innovative clinic. MACSQuant® Analyzer is an extremely compact, easy-to-use benchtop flow cytometer. The instrument is fully automated, enabling absolute cell counting, and rare cell analysis.4 5
  4. 4. Taking tumor tissue to task Tumor immunology Tumor tissue dissociation Interaction between immune system and cancer cells Tissue dissociation that is The immune system plays a crucial role in host protection against subsequent tumor growth and angiogenesis. We bring you carcinogenesis by eliminating tumor cells. However, some of the a large array of tools to advance your research in tumor reliable, reproducible, and rapid tumor cells are not detected by the immune system and a variety immunology, taking you from bench to bedside. of immunologic mechanisms contribute to tumor escape and The analysis of tumor cell and stem cell populations requires Find out more at effective methods for tissue dissociation followed by the isolation of viable cells. Isolate viable cells from tumors with ease using the gentleMACS™ Dissociator Solid tumors are made up of a mixture of cell types which are interconnected to each other and surrounded by an Tumor Lymphoid organ extracellular matrix composed of a variety of proteins and Dendritic cell polysaccharides. The gentleMACS™ Dissociator reliably dissociates the extracellular matrix and cell adhesion IL-10 The gentleMACS Dissociator and gentleMACS Tubes are designed for components without harming cell integrity. TGF-β efficient, reliable, and easy tissue dissociation. Dendritic Monocyte Specialized programs and protocols are optimized for tumor cell IL-4 dissociation. Preparate your single-cell suspensions from Treg cell various primary human or implanted IL-6 mouse tumors using: IL-10 MDSC Tumor TH2 cell antigen Naive CD4+ • gentleMACS human tumor dissociation programs CSC T cell TGF-β • gentleMACS mouse tumor dissociation programs IL-2 • Tumor Dissociation Kits Macrophage NK cell IL-10 Treg cell Automated dissociation of tissues assures that results are TGF-β TGF-β IL-10 reproducible and reliable — all of that in a much shorter CD8+ T cell timeframe. MDSC Macrophage The gentleMACS™ Dissociator at a glance CD8+ T cell Two types of gentleMACS Tubes are available: C Tubes and M Tubes. C Tubes generate single-cell suspensions for cell biology applications • Time-saving automated tissue dissociation (e.g. cell separation and cell culture). M Tubes allow for a thorough homogenization of tissues or cells for molecular applications. • Consistent, reliable results IL-4 iNKT cell IL-5 • Optimized programs for multiple applications IL-4 Monocyte IL-10 IL-10 • Closed system enabling sterile sample handling IL-13 IL-13 TGF-β CD8+ T cell • Specific programs and protocols were developed for cellular and molecular applications B cell Visit to learn more about how the Treg cell TH2 cell gentleMACS Dissociator can advance your research. Dendritic cell Circulating tumor cell MDSC: Myeloid-derived suppressor cell CSC: Cancer stem cell Tumor escape: Some tumor cells survive as they become insensitive to the elimination process due to genetic or epigenetic alterations. These cells continue to proliferate in an uncontrolled manner and more immune cells are attracted to the tumor site.6 7
  5. 5. The driving force of tumor development Targeting cancer stem cells Cancer stem cells Tools for the enrichment and analysis of CSCs Reinterpreting tumor biology Tumor type Cell surface marker Effective tools for cancer Before separation CD44+ Cells Classical tumor biology asserts that any malignantly Acute myeloid leukemia (AML)35 CD34+/CD38 – stem cell research Breast cancer36 ESA+/CD44+/CD24 –/Lineage – transformed cell is immortal and may give rise to other equally potent cancerous cells. Ovarian cancer37–39 CD133+ Isolate cancer stem cells with ease using our MicroBead CD44+/CD117+ reagents and kits, which are optimized to ensure a high Forward scatter Forward scatter Recent studies suggest that this hypothesis may not be the CD24+ purity and yield of target cells. case, and that the clinical properties of human tumors may Glioblastoma* 40–42 CD133+ be the result of a small population of transformed stem cells CD15+ • Reliably isolate viable and pure populations of cancer within the tumor — cancer stem cells. Medulloblastoma 40,41,43 CD133 + stem cells from solid tumors and cancer cell lines. CD15+ • Isolate cells on your own schedule whenever Small cell and non-small CD133+ the sample becomes available. CD44-PE CD44-PE Cancer stem cells cell lung cancer44 • Target any cell marker of your choice. Cancer stem cells (CSCs), also known as tumor-initiating cells Hepatocellular carcinoma45 CD45–/CD90+ • Use enriched samples for downstream applications (TICs), are thought to drive the process of tumorigenesis on the Prostate cancer⁵ CD44+/A2B1 hi/CD133+ such as flow cytometric or molecular analysis. CD+ cells were isolated from a mixture of U (CD+) and  (CD –) basis of self-renewal and the generation of an aberrant tumor Colon cancer 6,46–49 CD133 + cell lines and then isolated using the CD MicroBeads, an LS Column, and cell upon CSC division. CSCs would therefore effectuate tumor a MidiMACS™ Separator. Cells were fluorescently stained with CD-PE and CD44+ metastasis and tumor relapse; a theory that is contrary to CD26+ MicroBeads: reagents for the isolation analyzed by flow cytometry using the MACSQuant Analyzer. classical tumor biology hypotheses. Melanoma50–53 CD20+ of cancer stem cells ABCB5+ MicroBeads reagents can be used directly or in combination CD271+ for the enrichment or depletion of defined cell markers: Possible implications of this hypothesis: Pancreas adenocarcinoma54 CD44+/CD24+/EpCAM+ Original fraction Positive fraction • Metastases are mediated by CSCs and not • CD133 MicroBead Kit1–8 Renal carcinoma 55 CD133 enhances vascularization • New: CD44 MicroBeads any tumor cell. Head and neck squamous cell CD44+ • New: CD24 MicroBead Kit • CSCs are resistant to conventional chemotherapies carcinoma (HNSCC)56 and facilitate tumor relapse. • CD20 MicroBeads CD44-APC CD44-APC * CD expression may be affected by cell culture conditions. A better understanding of CSC pathogenesis would not only Cell surface markers of cancer stem cells in different types of tumors. • CD15 MicroBeads serve to improve diagnostic procedures, but also to develop For a respective product list please refer to pages –. • CD45 MicroBeads therapies that specifically target these cells, hindering tumor recurrence. • CD271 (LNGFR) MicroBead Kit s Read further to discover how Miltenyi Biotec can help Target any cell type from any species CD24-FITC CD24-FITC you make strides in cancer research or visit: For maximum flexibility, indirect magnetic labeling with MACS MicroBeads allow the use of any primary antibody for cell isolation. Monoclonal or polyclonal primary antibodies CD -CD+ cells were isolated from CML cell line KZ. CD+ cells were of your choice can be either unconjugated, biotinylated, or first depleted using the CD MicroBead Kit and then positively selected for CD using the CD MicroBeads. Cells were fluorescently stained with fluorochrome-conjugated. CD-APC and CD-FITC and analyzed by flow cytometry using the • Anti-Fluorochrome MicroBeads MACSQuant Analyzer. • Anti-Biotin MicroBeads • Anti-Isotype MicroBeads • Streptavidin MicroBeads 8 9
  6. 6. Hematological tumors Tumor vascularization Multiple myeloma and B-CLL Endothelial cells, pericytes, and endothelial progenitors High performance in hematological Novel tools to assess Before separation CD34+ cells Before separation CD34+ cell fraction cell enrichment and analysis Before separation Isolated iNKT+ cells tumor vascularization Before separation Isolated iNKT+ cells CD309 (VEGFR-2/KDR)-APC Miltenyi Biotec continues to expand on a significant portfolio Vascularization of a developing solid tumor is considered to be of MACS Products for hematological research. These include a key step in tumor growth, invasion and metastasis. New vessel CD45-FITC CD34-FITC CD45-FITC products for the investigation of normal hematopoiesis and formation involves the recruitment of endothelial progenitor R5 reagents for the study of hematological malignancies. cells (EPCs) from bone marrow, resulting in an increase of EPC R4 levels in times of significant tumor growth. Leukemic stem cells It has been proposed that transformation of hematopoietic CD34-PE CD34-PE Using EPCs to evaluate tumor progression CD133/2 (293C3)-PE CD133/2 (293C3)-PE stem cells results in the generation of leukemic stem cells (LSCs) Growing evidence suggests that the efficacy of anti-angiogenic — tumor cells with uncontrollable self-renewal capabilities. therapies can be quantitated by enumerating circulating EPCs. Flow cytometric analysis of CD+ cells isolated from peripheral blood Moreover, EPC numbers could also indicate tumor progression. CD+CD+CD (VEGFR-/KDR)+ EPCs were identified and enumerated In order to elucidate the pathogenic processes behind this mononuclear cells (PBMCs) using the CD MicroBead Kit, an MS Column, from a leukocyte sample and analyzed using the MACSQuant Analyzer. transformation, many researchers are currently focusing on and a MiniMACS™ Separator. Take the convenient route for EPC analysis using the the identification, enrichment, and characterization of LSCs. EPC Enrichment and Enumeration Kit: Accurately isolate LSCs within minutes: • Significantly reduces your analysis time by flow cytometry • CD34 MicroBead Kit⁹¹⁰ • Optimized for use with the MACSQuant Analyzer for Before separation CD138+ cells Before separation CD146+ cell fraction Before separation Isolated iNKT+ cells walk-away sample processing, flow cytometric gating, Before separation Isolated iNKT+ cells • CD34 MultiSort Kit¹¹ and EPC enumeration (coming soon) • Special protocol developed for EPCs are defined by the expression of CD34, CD133, and CD309 isolation of CD34+/CD38– cells¹² and are considered to be a parameter for assessing a number of CD19-APC CD34-FITC CD34-FITC CD19-APC diseases involving vascular repair. Multiple myeloma Isolate CD138+ cells with minimum hands-on time and a Stem cells making a niche for themselves maximum yield of target cells, even from weakly infiltrated myeloma patient samples. Recent reports suggest the existence of perivascular–cancer CD138-PE CD138-PE stem cell niches; microenvironments where endothelial cells CD146-APC CD146-APC • CD138 MicroBeads¹³¹⁴ and pericytes interact closely with self-renewing CSCs. • Whole Blood CD138 MicroBeads CD138+ plasma cells were isolated from human PBMCs using CD20 and CD138 We have developed specific MicroBeads for the efficient CD+ cells were separated from lipoaspirate using the CD MicroBead Investigating Hodgkin’s lymphoma MicroBeads, an LD and two MS Columns, and appropriate MACS Separators. Cells enrichment of endothelial cells and pericytes: Kit, an LS Column, and a MidiMACS Separator. Cells were stained with are fluorescently stained with CD138-PE and CD19-APC. CD-APC and CD-FITC. The hallmark indicator of Hodgkins lymphoma is the • CD146 MicroBead Kit identification of CD30+/CD15+ Reed-Sternberg cells. • CD105 MicroBeads These rare and highly fragile cells can be enriched using: • CD31 MicroBead Kit • CD30 MicroBeads Chronic lymphocytic leukemia B cell chronic lymphocytic leukemia is one of the most common types of leukemia. Isolation of untouched B cells can be achieved from tumor cell-containing samples using: • B Cell Isolation Kit (B-CLL)10 11
  7. 7. Spreading the tumor Capture circulating tumor cells Circulating tumor cells Tools for enrichment and analysis of CTCs Unravelling the mechanisms Magnetic labeling of a Achieve paramount performance in Enrich circulating tumor cells of metastasis specific cell population using MACS MicroBeads. circulating tumor cell detection for discovery research Circulating tumor cells (CTCs) are cells that are shed from the Analysis of circulating tumor cells is inherently limited by the MACS MicroBeads can be used for the isolation primary tumor and enter the circulation where they can spread sensitivity of the detection system. Overcome these limitations of circulating tumor cells from a variety of sources. to anatomical sites distant from the primary tumor and form with MACS Enrichment and Detection Kits. • Peripheral blood mononuclear cells (PBMCs) metastases. • Circulating tumor cells are enriched Retention of target cell • Bone marrow population in a column. using the desired cell marker. • Lymphoid tissue Towards a better understanding • Enriched cells can be directly stained while • Peripheral blood buffy coats of circulating tumor cells in the column minimizing cell loss. Circulating tumor cells are found at extremely low frequencies, • Stained cells are eluted and can be Consistent quality in CTC enrichment often at the detection limit of many analytical techniques. immedately used for cell analysis. Use one of the following MicroBead Reagents for the This places a great challenge on their identification and convenient enrichment of circulating tumor cells: characterization. To overcome this, pre-enrichment of A complete kit for enrichment and detection rare CTCs is necessary. 1. Elution of target cells. • CD326 (EpCAM) MicroBeads21–27 The following Enrichment and Detection Kits have been 2. Fixation by adding Inside Fix. designed for optimal detection of circulating tumor cells: • ErbB-2 (HER2) MicroBeads23 Optimize the detection and analysis • CD326 (EpCAM) Tumor Cell Enrichment and Detection Kit • Carcinoma Cell Enrichment Kit28 of circulating tumor cells • ErbB-2 Tumor Cell Enrichment and Detection Kit • Anti-Melanoma (MCSP) Microbeads29,30 Circulating tumor cells can be easily enriched • Carcinoma Cell Enrichment and Detection Kit¹⁶-²⁰ • CD45 MicroBeads31–33 using the following markers prior to analysis: • Melanoma Cell Enrichment and Detection Kit Refer to for more details. • CD326 (EpCAM) For intracellular staining of cancer stem cells: • ErbB-2 (HER2) • Inside Stain Kit • Anti-Melanoma (MCSP, NG2) • Anti-Cytokeratin antibodies • CD45 • Anti-Cytokeratines 1. Application of the fixed cells onto a second column. 2. Permeabilization with Inside Perm. 3. Application of staining reagents onto the column. Elution, substrate incubation and flow cytometric or immunocytochemical Immunocytochemical detection of breast cancer cells enriched using evaluation. the Carcinoma Cell Enrichment and Detection Kit and stained with Anti-Cytokeratin-FITC and Anti-FITC-Alkaline Phosphatase plus substrate. In-column intracellular staining of CTCs isolated using the MACS Technology12 13
  8. 8. Molecular analysis Expression profiling and mitochondrial enrichment Excel in tumor molecular analyses State-of-the-art microRNA The faster approach to MACSmolecular provides a highly innovative range of products Send sample—receive results expression profiling mitochondria enrichment and services with a strong focus on microRNA and gene Use one of the high-quality miRXplore™ Microarray Kits—reliable Many studies have described mitochondrial abnormalities in expression profiling. tools for extensive microRNA expression profiling. tumor tissues and cancer cell lines. Investigators often rely Technical support for experimental on density centrifugation for mitochondrial enrichment—a design and microarray selection • Expert coverage of sequences Convenient microarray services for cancer research time-consuming and laborious technique. • microRNA miRXplore Microarrays • High sensitive microRNA profiling For laboratories who have no or limited access to microarray • Agilent Whole Genome Microarrays Benefit from the Mitochondria Isolation Kit: a faster technologies we offer a complete microarray service: from • Excellent specificity and simplier procedure that is also more accurate. sample preparation to the generation of a comprehensive • Consistent data RNA extraction and quality control • High yields of isolated mitochondria bioinfomatics report. • Sample independent normalization • Maintains organelle integrity We are an offically certified Agilent Service Provider with over Optional: • High purity levels 10 years experience in this field. • Amplification and quality control • SuperAmp Service1: 1–10,000 cells • Easy and straight forward operation Our high-quality Agilent Microarray Services—from RNA 100 • Size-independent isolation extraction to comprehensive bioinformatic services—result in 90 Synthesis and purification of 80 Relative signal intensity (%) Hepatocellular carcinoma cell RNA ready-to-publish data. For further information about our molecular services, fluorescently labeled probes 70 Glioblastoma cell RNA 60 visit Hippocampus RNA 50 Microarray analysis couldnt be easier Microarray hybridization 40 CD4+ T cell RNA • Send your samples to Miltenyi Biotec. 30 20 • Sample processing and analysis will be performed Image capture and 10 using stringent quality control standards. analysis of primary data 0 miR -27a miR -27a - mut1 miR -27a - mut2 • Our in-house bioinformatics team will compile Optional: Bioinformatics Services 2 Reverse-complementary miR-27a sequence a clear and comprehensive report of your data, including and synthetic variants a record of all experimental steps and data analyses. • Cluster Analysis miR-27a GCGGAACT TAGCCACTGTGAA • Discriminatory Genes Analysis mut1 GCGGAACT TACCCACTGTGAA • Pathway Analysis mut2 GCGGACC T TACCCACTGTGAA µMACS™ SuperAmp Technology for single cell analysis Probe-target specificity of miRXplore Microarray µMACS™ SuperAmp Technology enables gene expression Results and report profiling down to a single cell. The source RNA can be derived Data on CD-ROM from: 100 • cells sorted with MACS Technology 90 Relative signal intensity (%) 1 miRNAs cannot be amplified with the SuperAmp Service. 80 • laser-captured, microdissected cells 2 Please inquire for microRNA Bioinformatics Services. 70 • cells sorted by flow cytometry 60 50 • tissue biopsies 40 • 1–10,000 cells 30 20 10 0 miR-465A-5P miR-465B-5P miR-465C-5P miR-465D miR-465 family miR-465A-5P UAUUUAGAAUGGCACUGAUGUGA miR-465B-5P UAUUUAGAAUGGUGCUGAUCUG miR-465C-5P UAUUUAGAAUGGCGCUGAUCUG miR-465D  UAUUUAGAAUGGUACUGAUGUG Specific detection of miR-465 family members14 15