Marker Assisted Gene Pyramiding for Disease Resistance in Rice

10,097 views
9,837 views

Published on

Why marker assisted gene pyramiding?
 For traits that are simply inherited, but that are difficult or expensive to measure phenotypically, and/or that do not have a consistent phenotypic expression under specific selection conditions, marker-based selection is more effective than phenotypic selection.
 Traits which are traditionally regarded as quantitative and not targeted by gene pyramiding program can be improved using gene pyramiding if major genes affecting the traits are identified.
 Genes with very similar phenotypic effects, which are impossible or difficult to combine in single genotype using phenotypic selection, can be pyramided through marker assisted selection.
 Markers provides a more effective option to control linkage drag and make the use of genes contained in unadapted resources easier.
 Pyramiding is possible through conventional breeding but is extremely difficult or impossible at early generations..
 DNA markers may facilitate selection because DNA marker assays are non destructive and markers for multiple specific genes/QTLs can be tested using a single DNA sample without phenotyping.

CONCLUSION:
• Molecular marker offer great scope for improving the efficiency of conventional plant breeding.
• Gene pyramiding may not be the most suitable strategy when many QTL with small effects control the trait and other methods such as marker-assisted recurrent selection should be considered.
• With MAS based gene pyramiding, it is now possible for breeder to conduct many rounds of selections in a year.
• Gene pyramiding with marker technology can integrate into existing plant breeding program all over the world to allow researchers to access, transfer and combine genes at a rate and with precision not previously possible.
• This will help breeders get around problems related to larger breeding populations, replications in diverse environments, and speed up the development of advance lines.

For further queries please contact at isag2010@gmail.com

Published in: Technology, Business
28 Comments
31 Likes
Statistics
Notes
No Downloads
Views
Total views
10,097
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
0
Comments
28
Likes
31
Embeds 0
No embeds

No notes for slide

Marker Assisted Gene Pyramiding for Disease Resistance in Rice

  1. 1. 1
  2. 2. Xa4 Gm2, Pi-7(t) Marker Assisted Gene Pyramiding for Disease Resistance in Rice Pi-5(t) Xa3 Pi-2(t) Xa5 Bph2 Xa7 Xa21 Pi-4(t) Pi(t) Xa13 Gm4t Name of speaker: - Thakare Indrapratap S. Course No: - MBB 692 Degree : - Ph.D(Agri.) Reg No:- 04-1247-2010 Major Guide : - Dr. Patel D. B. Date : - 06/04/2013 Minor Guide : - Dr. Fougat R. S. Time : - 16.00 hrs 2
  3. 3. CONTENTINTRODUCTIONOBJECTIVEGENERAL PRINCIPLES AND MARKER ASSISTED GENE PYRAMIDINGMAIN FACTORS AFFECTING GENE PYRAMIDINGINTEGRATING GENE DISCOVERY, VALIDATION AND PYRAMIDINGCASE STUDIESCONCLUSIONFUTURE THRUST 3
  4. 4. INTRODUCTION  Rice is the world’s most important food crop and a staple food for more than half of the world’s population. More than 90% of the world’s rice is produced and consumed in Asia, where 60% of the people live.  In the last six decades, rice production has steadily kept in pace with the population growth rate, mainly due to the gains from the technologies of green revolution era such as semi-dwarf, fertilizer responsive high yielding varieties and other associated managerial technologies.  Rice is the 1st choice of Biotechnologists Rice is a model crop for genetic and breeding research  Small genome size :45 x 10 6 bp.  Gene bank with 1,00,000  Highly dense molecular map accessions  Several wild species  YAC and BAC libraries  Transformation protocols &  T-DNA insertion and deletion4 mutants  Huge database 4
  5. 5. AREA, PRODUCTION AND PRODUCTIVITY OF RICE Table no.1 Area, production and productivity Area Productivity Regions Production (MT) (Mha) (kg/ha) World India 44 2207 100 Gujarat 0.68 1903 1.62 5
  6. 6. LIST OF VARIOUS DISEASES IN RICE Table 2 :Estimated yield loss range in yield Bacterial Diseases Estimated annual rice1. Bacterial Blight [Xanthomonas oryzae pv. oryzae (Ishiyama) Swing et alloss % .]2. Bacterial Leaf Streak [Xanthomonas oryzae pv. oryzicola (Fang et al.) Swing et al.] Diseases Fungal Diseases1. Rice Blast [Magnaporthe grisea (Cooke) Sacc.]2. Sheath Blight [Rhizoctonia solani Kuhn] Blast 40 – 75 Spot [Bipolaris oryzae3. BrownBacterial leaf blight (Breda de Haan) Shoemaker] - 604. Leaf Scald [Microdochium oryzae (Hashioka &Yokogi) Samuels & I.C. Hallett]5. Narrow Brown Spot [Cercospora janseana (Racib.) O. Const.] 206. Stem Rot [Sclerotium oryzae Cattaneo]7. Sheath Rot [Sarocladium oryzae (Sawada) W. Gams & D. Hawksworth] Brown spot 12- 438. Bakanae [Fusarium fujikuroi Nirenberg]9. False SmutSheath blight virens (Cooke) Takahashi] [Ustilaginoidea Virus Diseases 7 – 401. Tungro [Rice tungro bacillifor virus and spherical virus]2. Grassy Stunt [Ricesmut stunt virus] False grassy3. Ragged Stunt [Rice ragged stunt virus] 10 - 44Nematode Diseases1. Root Knot [Meloidogyne graminicola Golden & Birchfield]2. White Tip [Aphelenchoides besseyi Christie] Sheath rot 3 – 20 Rice knowledge portal, 6
  7. 7. Bacterial leaf Blight (Xanthomonas oryzae pv. oryzae)  Disease is characterized by linear yellow to straw coloured stripes with wavy margin, generally on both edges of the leaf, rarely on one edge.  Stripes usually starts from tip and extend downwards.  Drying, twisting of the leaf tip and rapid extension of marginal blight lengthwise and crosswise to cover large areas of leaf.  Blighting may extend to the leaf sheaths and culms, killing the tiller or the whole clump.  The blight phase of disease usually appears 4-6 weeks after transplanting. 7
  8. 8. Table 3: Bacterial blight resistance genes in rice Gene Cultivar Isolate/race References Xa-1 and Xa-2 Kogyoku Japanese race I and II Sakaguchi (1967) Ezuka et al., (1975), Ogawa et al., Xa-3 Wase Aikoku, Chukogu-45 Japanese race II and III (1986) Petpisit et al., (1977), Sidhu et al., Xa-4 IR20, IR22, IR1529-680-3 Philippine race I (1978) Petpisit et al., (1977), Sidhu et al., xa-5 IR1545-248, BJ-1,IR291-7, DV85 Japanese races (1978), Singh et al., (1983), Blair and McCouch (1997) Malaget sunsong, IR994-102, Xa-6 IR1698-241, Zenith Philippine race I Sidhu et al., (1978) Xa-7 DV85, DV87 Philippine race I Sidhu et al., (1978,1979) xa-8 P1231129 Philippine isolates Sidhu et al., (1978,1979) Xa-9 Sateng Philippine isolates Singh et al., (1983) Xa-10 Cas209 Philippine and Japanese isolates Yoshimura et al., (1983) Ogawa and Yamamoto (1986), xa-11 IR8, RP9-3 Japanese isolates Ogawa et al., (1991) Xa-12 Kogyoku and Java14 Japanese and Indonesian isolates Ogawa et al., (1978a,b) xa-13 Long grain Philippine isolates Zhang et al., (1996b)8 Xa-14 TN(1) Japanese isolates Taura et al., (1989) 8 Continue….
  9. 9. Gene Cultivar Isolate/race References xa-15 M41 Japanese isolates Noda (1989) Xa-16 Tetep and IR24 Japanese isolates Noda (1989) Xa-17 Asominori Japanese isolates Ogawa et al., (1989) Xa-18 Toyonishiki Burmese isolates Ogawa and Yamamoto (1986) Xa-19 XM5 Japanese isolates Taura et al., (1991) Xa-20 XM6 Japanese isolates Taura et al., (1992) Xa-21 O. longistaminata Philippine and Japanese isolates Khush et al., (1990) xa-22 Zhachanglong Chinese isolates Lin et al., (1996) Xa-23 O. nivara Indian isolates Kumar (1999) DV85, DV86, Xa-24 Aus295 Philippine race 6 Lee et al., (2001) Philippine, Chinese and Japanese Xa25 HX3 isolates Gao et al., (2001) Xa26 Minghui 63 Chinese isolate Yang et al., (2003) Philippine, Chinese and Japanese Xa27 O. minuta isolates Gu et al., (2004) Xa28 Lota sail Philippine 2 and 5 Lee et al., (2003) Xa29 O. officinalis Not fully characterized Tan et al., (2004) Xa30 O. rufipogan Philippine isolate Jaiswal et al., (2004)9 Xa31 ZCL Chinese isolates Wang et al., (2008) 9
  10. 10. Rice Blast Pyricularia oryzae Pyricularia grisea (anamorph) Magnaporthe grisea (teleomorph) 10
  11. 11.  Large lesions usually develop a greyish center, with a brown margin on older lesions. Under conducive conditions, lesions on the leaves of susceptible lines expand rapidly and tend to coalesce, leading to complete drying of infected leaves. Resistant plants may develop minute brown specks, indicative of a hypersensitive reaction. Besides attacking the leaves, the fungus may also attack the stem at the nodes, causing neck rot, or at the panicle, causing panicle blast. 11
  12. 12. Management• Practicing field sanitation such as removing weed hosts, rice straws, ratoons, and volunteer seedlings is important to avoid infection caused by this disease.• Proper application of fertilizer, especially nitrogen, and proper plant spacing are recommended for the management of bacterial leaf blight.The use of resistant varieties is the most effective andthe most common management practices. 12
  13. 13. CONVENTIONAL TO MOLECULAR TECHNIQUES: Through conventional breeding, Selection for crop improvement is carried out on phenotypic character, which is the result of genotypic and environmental effects. Some traits like disease resistance are governed by two or more (poly)genes, or may appear to be quantitatively expressed due to low heritability. The difficulties of phenotype based selection can be overcome by direct selection for genotype using DNA markers that co segregate with the genes of interest (disease resistant genes etc.) The development of DNA (or molecular) markers has irreversibly changed the disciplines of genetics and plant breeding. To date, many potential genes (including many single genes and QTL’s) that confer resistance to potential plant pathogens have been mapped in economical crops. 13
  14. 14. WHAT IS A MARKER? All living organisms are made up of cells that are programmed by genetic material called DNA. This molecule is made up of a long chain of nitrogen-containing bases (there are four different bases-adenine [A], cytosine [C], guanine [G] and thymine [T]). A Molecular marker is a small region of DNA showing sequence polymorphism in different individuals with in a species (or) among different species. It is readily detected and whose inheritance can easily be monitored. A wide range of molecular techniques are now available to detect the polymorphism at DNA level. 14
  15. 15. Hybridization based e.g RFLP Hybridization based e.g RFLP PCR basedArbirtary primers e. g RAPD, ISSR, AFLP Specific primer Specific sequence based e .g SCAR, CAPs, Repeat based e.g SSR SNPs 15
  16. 16. RAPD RFLP SSR AFLP SNP16 16
  17. 17. MARKER-ASSISTED SELECTION According to Bertrand and Mackill (2008), “The marker aided selection (MAS) assumes that the target gene is identified and selected based on the closely linked markers”. A successful MAS requires that a gene be mapped and closely linked to a marker, otherwise which is very difficult to examine or evaluate by conventional approaches Why Marker Assisted Selection ? Selection at seedling stage possible Selection of traits with low heritability Distinguishing homozygotes from heterozygotes Pyramiding of Resistance Genes Selection for recessive gene, etc. 17
  18. 18. (1) LEAF TISSUE SAMPLINGMapping populationsF2 progenies (2) DNA EXTRACTIONF2 derived F3 (F2:3)DH linesBC progenies’ (3) PCRRILsNILs, Els & ABPs (4) GEL ELECTROPHORESIS (5) MARKER ANALYSIS 18
  19. 19.  Reliability: Marker should co-segregate or be closely linked with the desired trait. Marker A QTL <5 cM DNA quality and quantity: some marker technique require large amount and high quality of DNA. Technical procedure: The screening technique should have high reproducibility across laboratories. Cost: It should be economical to use and be user friendly. Level of polymorphism: Marker must be polymorphic. Marker Marker 19
  20. 20. P1 x P2Susceptible Resistant F1 F2 large populations (e.g. 2000 plants) 20
  21. 21.  Plants are equipped with a variety of mechanisms to defend themselves against infection by fungi, viruses, bacteria, nematodes, insects, and even other plants. After the rediscovery of Mendel’s laws, plant breeders have used disease resistance (R) genes to produce more resistant varieties. Plant defenses are activated by the specific interaction between the product of a disease (R) resistance gene in the plant and the product of a corresponding avirulence (Avr) gene in the pathogen (Flor, 1971). Properties of R-gene: “R” genes enable plants to recognize specific races of a pathogen and mount effective defence response including a rapid induction of localized necrosis at the site of infection (the hypersensitive response), increasing expression of defence-related genes, production of anti microbial compounds, lignin formation and oxidative burst in many plant-pathogen interactions 21
  22. 22. What is gene pyramiding? Gene pyramiding is defined as a method aimed at assembling multiple desirable genes from multiple parents into a single genotype for specific trait.  Objectives:- 1. Enhancing trait performance by combining two or more complementary genes 2. Remedying deficits by introgression of genesX Major Gene from other sourcesa Pi-4 Pi 3. Increasing the durability of disease and/or4 (t) (t) disease resistance Minor Gene 4. Broadening the genetic basis of releasedXa Pi-21 Xa5 2(t) cultivars Xa Xa 7 3 Source of gene ? 22
  23. 23. WHY MARKER ASSISTED PYRAMIDING? For traits that are simply inherited,  Markers provides a more effective but that are difficult or expensive to option to control linkage drag and measure phenotypically, and/or make the use of genes contained in that do not have a consistent unadapted resources easier. phenotypic expression under specific selection conditions!  Pyramiding is possible through conventional breeding but is Traits which are traditionally extremely difficult or impossible at regarded as quantitative and not early generations.. targeted by gene pyramiding program!  DNA markers may facilitate selection because DNA marker Genes with very similar phenotypic assays are non destructive and effects, which are impossible or markers for multiple specific difficult to combine in single genes/QTLs can be tested using a genotype using phenotypic single DNA sample without selection! phenotyping. 23
  24. 24. GENERAL PRINCIPLES AND MARKER ASSISTED GENE PYRAMIDINGBasicassumptions Locations of a series of genes of interest (target genes) thus the linkage relationship between them is known Target genotype for these genes is defined prior to selection as the genotype with favorable alleles at all loci of interest The genotype of an individual can be identified by these genes or markers linked to them A collection of lines containing all the target genes should be availableMinimal population size for recovery of desirable genotype Number of genes is large and/or linkage relationships are complex, many computations are required if a purely mathematical prediction method is used Computational requirements will be further increased if markers are not completely linked to the target genes (i. e. are not diagnostic) Special computer software has been developed to compute the frequencies of all possible genotypes in the segregating populations (Servin et al., 2002) 24
  25. 25. MAIN FACTORS AFFECTING GENE PYRAMIDING 1. Characteristics of the target traits/genes  The genes to be pyramided are functionally well characterized and markers used for selection equal to the gene itself (perfect marker), gene pyramiding will be more successful.  One or two markers per gene can be used for tracing the presence/absence of the target genes.  Bulk Segregant Analysis (BSA) is the preferred method for identification of markers tightly linked to a major gene (Michelmore et al., 1991)  In BSA, plants from a segregating population are grouped according to phenotypic expression of the trait into two bulks.  These bulks are screened with a large numbers of markers to identify the markers that are genetically linked to trait locus25 25
  26. 26. 2. Reproductivecharacteristics Propagation capability of a crop is determined by the number of seeds produced by a single plant. A fairly large F2 population can be obtained by collecting seed from many F1 plants of the cross between two homozygous parents, from F3 generation seed can only be collected from a single plant. Efficiency of hybridization may be an important constraint for some crop species. When wild relatives are used as donor of desirable genes, many more reproduction related constraints may exist including cross incompatibility between wild species and cultivated crop. 26
  27. 27. Founding Parents P1 P2 P3 P4 P5 P6 H(1)(2) H(3)(4) H(5)(6) Gene Pyramiding Scheme Pedigree H(1,2)(3,4) Node H(1,2)(3,4)(5,6) Fixation step Root genotype Ideotype H(1,2,3,4,5,6)(1,2,3,4,5,6)Figure : -1 A distinct gene pyramiding scheme cumulating six targetHospital et al., genes.2004 27
  28. 28. Stepwise RP1 × DP1 Simultaneous RP1×DP1 RP1×DP2transfer transfer F1 × RP1 F1 × F1 BC1F1 × RP1 F1 × RP1 BC3F1 BCdF1 × RP1 IRP1 × DP2 BCdF1 F1 × IRP1 BCdF2 BC1F1 × IRP1 RP = Recurrent parent, DP = Donor parent, BC3F1 BC = Backcross, IRP = Improved recurrent parent Figure:- 2 Different scheme for backcrossing for gene pyramiding 28
  29. 29. RP1 × DP1 RP1 × DP2 F1 × RP1 F1 × RP1 BC1F1 × RP1 BC1F1 × RP1 BCdF1 × BCdF1 RP= Recurrent parent, BCdF2 DP= Donor parent, BC= Backcross BCdF1 Simultaneous and step wise transferFigure3: Different scheme for backcrossing for gene pyramiding 29
  30. 30. Foreground selection, recombinant selection andbackground selection (Collard and Mackill 2008) Foreground Recombinant Background selection selection selection1 2 3 4 1 2 3 4 1 2 3 4 30
  31. 31. INTEGRATING GENE DISCOVERY, VALIDATION AND PYRAMIDING Advanced back cross QTL Tanksley and Nelson (1996) To identify and introgress favourable alleles from unadapted donors into elite background. Generating an elite by donor hybrid Backcrossing to the elite parent to produce BC1 population which is subjected to marker/or phenotypic selection against undesirable donor alleles Genotyping BC2 or BC3 population with polymorphic molecular markers Evaluating the segregating BC2F2 or BC2F3 population for traits of interest and QTL analysis Selecting target genomic regions containing useful donor alleles for the production of NILs in the genetic background Evaluation of the agronomic traits of the NILs and elite controls in replicated environments Ye and Smith.,2008 31
  32. 32. Introgression lines (ILs)  Eshed and Zamir (1994a, 1994b)  ILs are produced by systematic backcrossing and introgression of marker defined exotic segments in the background of elite varieties.  Considered to be similar to a genomic library with a huge genome of insert.  ILs enable phenotypic analysis of specific QTL and offer a common genetic background in which direct comparison of two line can be used to evaluate phenotype conditioned by a single introgressed exotic segment (Tanksley et al., 1996)  ILs are a valuable resources for the unravelling of gene function by expression profiling or map based cloning (Eshed and Zamir 1995)  If necessary, undesirable genes should and can be eliminated by chromosome recombination in the progeny between IL and recurrent parent and screened by MAS. Ye and Smith.,2008 32
  33. 33. 33
  34. 34. Introgression of Xa4, Xa7 and Xa21 for resistance to bacterial blight in1 thermo-sensitive genetic male sterile rice (Oryza sativa L.) for the development of two-line hybridsTGMS 1 x AR32-19-3-3 R=0-5 cm lesion(No Xa gene) (Xa21) length MR=5.1-10 cm MS=10.1-15 cm S=15.1 and above F1 x 1R-BB4/7 (Xa4/Xa7) Figure:- 4 (3-way cross) F1 Phenotypic distribution of 1,364 F2 plants F2 (1364 plants) from the cross of TGMS 1/Ar32-19- a) PXO99, 3/IRBB4+7. Races of XOO b) PXO86, pathogen c) PXO61 Maligaya, Philippines Perez et 34
  35. 35. Table 5 : Mean lesion length of sterile F2 Table 4 :- Distribution of Xa gene/ gene 13 plants showing resistance combination in 111 potential reaction to PXO61 , PXO86 & TGMS F2 plants showing pollen PXO99 14 days after inoculation. sterility under green house condition and pollen fertility in ~25˚C indoor growth chamberaXa gene/gene No of Mean lesion length(cm)combinations plants (F2) PX061 PX086 PX099Xa4 alone 12 2.65 11.46 13.40Xa7 alone 1 10.80 3.07 17.25Xa4/Xa47 78 1.16 1.50 13.81Xa4/Xa7/Xa21 20 1.27 1.65 4.72 Maligaya, Philippines Perez et 35 al.,2008
  36. 36. Table 6 :Fertile F2 plants showing highly resistant to PXO61, PCO86 and PXO99 Xa Mean lesion Xa gene(s) gene/gene length(cm) present combinations PX061 PX086 PX099 PR36944-96 0.73 1.00 1.50 Xa7 + Xa21 PR36944-131 0.55 0.45 2.37 Xa7 + Xa21 PR36944-158 0.57 0.57 2.17 Xa7 + Xa21 PR36944-169 0.45 0.53 1.55 Xa7 + Xa21Fig 5 PCR detection of Xa7 and PR36944-175 0.45 0.44 0.8 Xa7 + Xa21(Aa) Xa21 in representative F2 PR36944-176 0.53 0.53 2.77 Xa7 + Xa21 plants showing resistant PR36944-190 0.40 0.50 2.97 Xa7 + Xa21 reaction to three Xoo races. PR36944-452 1.25 0.80 2.00 Xa7 + Xa21 They found 11 lines with PR36944-470 1.30 2.47 2.35 Xa21 presence of 294 bp alleles carrying Xa7 gene alone. PR36944-1147 1.29 0.50 1.20 Xa7 + Xa21(Aa) PR36944-1345 0.38 0.43 1.25 Xa7 + Xa21 Maligaya, Philippines Perez et 36 al.,2008
  37. 37. Marker assisted introgression of bacterial blight resistance in2 Samba Mahsuri, an elite rice variety. Table 7 : Microsatellite markers that are polymorphic between SS1113 and Samba Mahsuri Samba Mahsuri- medium slender grain indica rice variety Very popular among farmer and consumer Highly susceptible to many pest and diseases Chemical control is not effective Hyderabad, India Sundaram et 37 al.,2008
  38. 38. Donor Line-SS1113 (Xa21,Xa13, Xa5) & Recipient line-Sambha MashuriXa21- PTA248-0.2 cMXa13-RG136-~1.5 cMXa5-RG556-~0.1 cM SS1113 (Xa21,Xa13, Xa5) X Sambha Mashuri F1 Plants Confirmed for heterozygosity using ‘R’ gene(s) linked markers Back crossed with recurrent parent 11 plants heterozygous for three ‘R’ genes (Xa21,Xa13, Xa5) Subjected to background selection using 50 SSR marker found to be Polymorphic between the parental lines across the genome Plants having maximum recurrent parent genome were backcrossed to generate BC2F1 plants BC4F1 stage Selfing BC4F2 lines Screening for ‘R’ genes using linked molecular marker 38
  39. 39. Figure: - 6 Foreground selection at BC1 F1 generation using R gene linked PCR based markersHyderabad, India Sundaram etal.,2008 39
  40. 40. Table no 8: Number of R gene heterozygotes identified and estimation of recurrent parent genome contribution. Table no. 9: Number of line with multiple R gene combinationsHyderabad, India Sundaram et 40al.,2008
  41. 41. Fig 7: Evaluation of bacterial blight resistance in gene pyramid lines.Hyderabad, India Sundaram et 41al.,2008
  42. 42. Table no 10: Grain yield of three-gene pyramid lines along with donor and recipient lines as recorded in Advanced variety trial 1- NIL of All India Coordinated Rice Improvement. Hyderabad, India Sundaram et al.,2008 42
  43. 43. Marker-assisted breeding of Xa4, Xa21 and Xa27 in the restorer lines of3 hybrid rice for broad-spectrum and enhanced disease resistance to BLB Introduced the Xa4, Xa21 and Xa27 genes into the restorer lines of Mianhui 725 or 9311 genetic backgrounds and pyramided the three R genes in the progeny derived from the cross between the two lines. NIL - Xa27 gene in the genetic background of 9311 [9311(Xa27)] and another line with the Xa4 and Xa21 genes in the genetic background of Mianhui 725 (WH421) were firstly developed through MAS. A new restorer line carrying Xa4, Xa21 and Xa27, designated as XH2431, was selected from the F8 progeny of the cross between 9311(Xa27) and WH421 through marker- assisted breeding and pedigree selection. XH2431 and II You 2431, the hybrids derived from cytoplasmic male-sterile line II- 32A and restorer line XH2431, conferred high resistance to all 23 Xoo strains collected from 10 countries. The development of XH2431, 9311(Xa27) and WH421 provides a set of restorer lines with broad-spectrum and enhanced resistance to BB for hybrid rice. Restorer lines CMS line Source of Res genes Cultivar Res Genes 9311 IRBB27 Xa27 II-32A Mianhui 725 IRBB21 Xa21 IR-64 Xa4 Singapore Luo et 43
  44. 44. Improvement of Restorer MH725 (Xa4 and Xa21)(Xa4) IR64 X MH725 (Xa21) IRBB21 X MH725 BC4F1 plants X BC 4F1 plants F1 plants (183 individuals) Selection for Xa4 and Xa21 homozygous plants were selected using markers RN224 and PTA248 F2 plants hommozygous for (Xa4Xa4, Xa21Xa21) WH421 44
  45. 45. WH421 X Improved R9311(Xa4Xa4,Xa21Xa21) (Xa21Xa21) F1 F2 (172) First round of selection Xa21 (PTA248) 54 plants homozygous for Xa27Second round of selection Xa27 RFLP marker 5198 10 plants homozygous for Xa 21 & Xa27 Xa24-RM224 2 Plants (Xa4, Xa21, Xa27) Intercrossed Progeny was evaluated for agronomic traits XA2431 45
  46. 46. Fig. 8 MAS of NIL of Xa27 in 9311 genetic Fig. 9 MAS of NIL of Xa4 and Xa21 in MH725 background. Genomic DNA of genetic background. PCR products individual B6F2 plants, the Xa27 donor amplified from genomic DNA of F2 IRBB27 and the recurrent female individuls, the Xa4 donor IR64 and the parent 9311 was digested with Xa21 donor IRBB21 with marker restricted enzymes SpeI and SacI, RM224 for Xa4 (a) and marker pTA248 fractionated on a 0.8 % agarose gel and for Xa21 (b) were fractionated on 3.5 % hybridized with the 32P-labeled Xa27 (a) and 1.5 % (b) agarose gels, probe 5198 in Southern blot analysis respectively. Singapore Luo et 46 al.,2012
  47. 47. Fig. 10 This figure shows selection of F2 plants crossing Xa4 and Xa21 in homozygous condition Singapore Luo et 47 al.,2012
  48. 48. Fine mapping and DNA marker-assisted pyramiding of the three major4 genes for blast resistance in rice Table no.11 : -Plant material , restriction enzymes and RFLP markers used in Southern analysisBlast Chrom Isoline Donor Populat Number of RFLP Polymorpresistan osome Parents ion Size restriction markers hicce gene enzyme tested markers testPi1 11 C101LA Lac23 160 30 10 5 CPiz5 6 C101A A5173 120 12 9 5 51Pita 12 C101PK Pai-kan- 80 30 14 6 T tao The polymorphic markers were subsequently identified and used to probe the Segregating populations to identify any additional closely linked markers. Manila, Philippines Hittalmani et al.,2000 48
  49. 49. Table no12:- Distances of the DNA markers from the blast resistance genes on different chromosomes Gene Chromosome Marker Restriction Distance enzyme Pi1 11 Npb181 DraI 3.5 cM RZ576 DraI 7.9 cM (14 cM)a Piz5 6 RZ64 EcoRI 2.1 cM (2.8 cM) a RZ612 EcoRI 7.2 cM RG456 XbaI (5.4 cM) a RG64-SAP HaeIII (2.8 cM) a Pita 12 RG869 HEcoRV 5.4 cM (15.3 cM) a RZ397 EcoRV 3.3 cM (18.1 cM) a RG241 ScaI 5.2 cM Manila, Philippines Hittalmani et 49 al.,2000
  50. 50. Fig.11 Schematic diagram showing marker-assisted selection for pyramiding the three major genes for blast resistanceManila, Philippines Hittalmani etal.,2000 50
  51. 51. Table no 12: List of isogenic lines and the segregating populations used in pyramiding geneLINES/ LINE/ Resist PoplVARIETIES CROSS genes sizeCO39 Recurrent None parentC101LAC Isogenic line Pi1C101A51 Isogenic line Piz5C101PKT Isogenic line Pita AF2 populationBL12 Pi1/Piz5 Pi1+Piz5 150BL14 Pi1/Pita Pi1+Pita 250BL24 Piz5/Pita Piz5+Pita 150 BBL124 Piz5/Pi1/Pita Piz5+Pi1+Pit 180 aFig12 : PCR banding pattern of RG64 marker linked to Piz-5 blast resistant gene segregating in the F2 population of the cross C101PKT (isoline for Pita). Manila, Philippines Hittalmani et 51 al.,2000
  52. 52. Table no 13: Evaluation of susceptibility of isolines and the gene pyramids to select blast isolates Lines IK81-25 C9232-5 C9240-2 C9240-5 V86010 P06-06 C101LAC S S MR R R R C101A51 R R S S R R C101PKT R R MR R S S BL12 R R S R R R BL14 R R S R R R BL24 R R S R R R BL124 R R S R R R CO39 S S S S S SManila, Philippines Hittalmani etal.,2000 52
  53. 53. Figure13: Identification of the Piz-5 resistant gene in the F2 generationsegregating Figure 14 : Two and the three gene pyramids for the three genes. as identified by RZ536 for Pi1 (A), RZ397 for Pita (B) and the RG64 PCR marker for the Piz-5 gene (C) M= Molecular weight Manila, Philippines markerHittalmani et used as the standard 53 al.,2000
  54. 54. 5 Marker aided pyramiding of rice for BLB and blast disease Using marker-assisted selection in a backcross breeding program, four bacterial blight resistant genes namely Xa4, xa5, xa13, Xa21 have been introgressed into the hybrid rice parental lines KMR3, PRR78, IR8025B, Pusa 6B and the popular cultivar Mahsuri. Genes Markers Types Xa21 pTA248 STS Xa5 RM122 SSR Xa4 Npb181 STS Xa13 RG136 CAPS Hyderabad, India Shanti et al., (2010) 54
  55. 55. Flow chart 1:- for Pyramiding restorer genes 55Hyderabad, India Shanti et al., (2010)
  56. 56. Flow chart 2:- Pyramiding restorer genes 56Hyderabad, India Shanti et al., (2010)
  57. 57. Figure 15: Foreground selection using resistance gene linked PCR based markers for the four BB genes at BC1F1 57 Hyderabad, India Shanti et al., (2010)
  58. 58. Table 14: Reaction of 10 isolates from Maruteru to the parents and pyramidsBB resistant genes Isolates from Maruteru (Lesion length in cm) Xoo Xoo Xoo Xoo Xoo Xoo Xoo Xoo Xoo Xoo 1 2 3 4 5 6 7 8 9 10Mahsuri Parent 21.3 20.0 22.3 20.0 18.3 11.0 10.0 17.8 21.0 20.3Mahsuri pyramid 1.5 2.5 3.0 3.2 3.3 2.0 1.3 2.5 2.3 2.5KMR3 18.0 20.0 20.0 25.0 21.0 15.0 14.0 14.0 15.0 21.0ParentKMR3 2.0 2.0 1.0 3.0 2.5 3.0 1.5 2.0 2.0 3.0PyramidPRR78 22.0 24.0 22.0 23.0 22.0 25.0 22.0 21.0 22.0 22.0ParentPRR78 1.8 2.0 1.5 2.0 2.0 2.5 3.0 1.5 1.0 2.5pyramidIRBB60 3.2 2.5 2.6 2.2 2.5 2.3 2.0 3.0 2.0 2.0Malagkit Sung Song 2.2 2.0 2.8 3.0 1.2 2.0 2.2 1.3 2.0 3.3(resistant check)TN1 (susceptible 20.6 18.0 20.0 16.3 20.0 18.0 23.0 17.5 18.2 25.0check) 58 Hyderabad, India Shanti et al., (2010)
  59. 59. Breeding of R8012, a Rice Restorer Line Resistant to Blast and Bacterial6 Blight Through Marker-Assisted Selection Made 25 crosses between five blast and five BB resistant germplasm accessions. Only one pair of parents, DH146 × TM487, showed polymorphism for all the markers to identify one blast resistance gene Pi25 and three BB resistance genes, Xa21, xa13 and xa5, thus it was used in the marker-assisted selection (MAS). F2 individuals of DH146 × TM487 were genotyped using flanking (SSR) markers of RM3330 and sequence tagged site (STS) marker SA7 for Pi25. The resistant F2 plants with Pi25 were used for pyramiding BB resistance genes Xa21, xa13 and xa5 identified by the markers pTA248 (STS), RM264 and RM153 (SSR), respectively in subsequent generations. After selection for agronomic traits and restoration ability among 12 pyramided lines, they acquired an elite restorer line, R8012 including all four target genes (Pi25+Xa21+xa13+xa5). Hybrid Zhong 9A/R8012 derived from the selected line showed stronger resistance to blast and BB, and higher grain yield than the commercial checks. China Zhan et al.,2012 59
  60. 60. Fig. 16. Reaction of pyramiding parents inoculated with M. grisea isolate 05-20-1 for neck blast resistance. Parent TM487 was susceptible while parent DH146 was resistant to the isolate 05-20-1.China Zhan et al.,2012 60
  61. 61. Table 15. The linkage markers of the bacterial blight and blast resistance genes and their primer sequences.Gene Character Chr. Marker Distance Sequence of the primer (5’-3’) (cM)Xa21 Dominant 11 pTA248 0.0 F: AGACGCGGAAGGGTTCCCGGA R: AGACGCGGTTCGAAGATGAAAXa13 Recessive 8 RM264 2.6 F: GTTGCGTCCTACTGCTACTTC R: GATCCGTGTCGATGATTAGCXa5 Recessive 5 RM153 5.6 F: GCCTCGAGCATCATCATCAG R: ATCAACCTGCACTTGCCTGGPi25 Dominant 6 SA7 1.7 F: CGGGTGAGTAAAACTTATCTGG R:TAGTGATTGAAACGGGTGCACTPi25 Dominant 6 RM3330 2.4 F: ATTATTCCCCTCTTCCGCTC R: AAGAAACCCTCGGATTCCTG China Zhan et al.,2012 61
  62. 62. Table 16. Reaction of the 12 selected pyramided F3 lines after inoculation with bacterial blight and blast pathogens.• ++, +– and – – represent homozygote, heterozygote and negative genotypes of the flanking markers, respectively.• LR, Leaf blast resistance; NR, Neck blast resistance; R, Resistance; S, Susceptible; MR, Moderate resistance.China Zhan et al.,2012 62
  63. 63. Fig. 17. Resistance reaction of pyramided lines inoculated with bacterial blight strains. 1, A leaf of a resistant plant TM487; 2, A leaf of a susceptible plant DH146; 3, A leaf of a susceptible plant L3; 4, A leaf of a moderately resistant plant L4.China Zhan et al.,2012 63
  64. 64. ICAR-Molecular Breeding for Biotic StressResistance in India (2005-2009) Centre Cultivar Genes for resistance to Bacterial Blight Blast Gall MidgeDRR, BPT 5204 xa13 + Xa21 Pi2 + Pi-kh Gm1+ Gm4HyderabadCRRI, Tapaswani, xa13+ Xa21 Pi2 + Pi9 Gm1 + Gm4Cuttack Lalat, IR 64, SwarnaIARI, Pusa Basmati 1, Xa13 + Xa21 Pi-kh + Piz-5 Not requiredNew Delhi Pusa6A/6B, PRR 78 64
  65. 65. DBT-GCP/ACIP Molecular Breeding for BioticStress Resistance in India (2009-2014) Name of the Bacterial Blast Gall Brown Target Varieties Centers Blight Midge Plant hopperDirectorate of xa13 + Pi-kh GM1+ Bph13+ Sampada,Rice Research Xa21 + Pi9 GM4 Bph18 Akshayadhan,(DRR), DRR17B andHyderabad RPHR-1005 (hybrid rice parental lines)IARI, New xa13 + Piz- - Bph18+ Pusa1121 andDelhi Xa21 5+ Bph20+ Pusa1401 Pi-kh Bph21Punjab xa13 + Bph13+ PAU-201,Agricultural Xa21+ Bph18 PAU3075-3-38University, Xa30 PAU3105-45Ludhiana 65
  66. 66. Cultivar development incorporating BLB R genes using Marker–Aided Selection Gene Pyramids Xa4, xa5,xa13,Xa21, Xa7 Samba Mahsuri IR64 Samba Mahsuri (xa5, Xa7, Xa21) (Xa5, xa13 and Xa21) (Xa5, xa13 and Xa21) CRIFC DRRIndonesia India IR64, Hybrid rice lines Swarna, IR64 (Xa4, xa5, Xa7, Xa21) (Xa4, xa5, xa13, Xa21) PhilRice CRRI Philippines India PR106 Pusa Basmati-1 Pusa Basmati-1 (Xa4, xa5, xa13, Xa21) (xa13, Xa21) (xa13, Xa21) PAU IARI India IndiaBLB pyramided lines of India 1. IR24 3. Samba Mahsuri 5. PR-106 7. Tapaswini 2. IR64 4. Pusa Basmati-1 6. Lalat 8. Swarna 66
  67. 67. Improved Samba Mahsurifirst Variety by Marker Assisted gene Pyramiding Samba Mahsuri Samba Mahsuri (Xa5, xa13 and Xa21) (Xa5, xa13 and Xa21) 67
  68. 68. Conclusion: Molecular marker offer great scope for improving the efficiency of conventional plant breeding. Gene pyramiding may not be the most suitable strategy when many QTL with small effects control the trait and other methods such as marker-assisted recurrent selection should be considered. With MAS based gene pyramiding, it is now possible for breeder to conduct many rounds of selections in a year. Gene pyramiding with marker technology can integrate into existing plant breeding program all over the world to allow researchers to access, transfer and combine genes at a rate and with precision not previously possible. This will help breeders get around problems related to larger breeding populations, replications in diverse environments, and speed up the development of advance lines 68
  69. 69. Future Thrust Need to have better scoring methods, larger population sizes, multiple replications and environments, appropriate quantitative genetic analysis, various genetic backgrounds and independent verification through advanced generations. Development of software for QTL mapping and minimal population requirement calculation, Mapping of disease resistance gene in major crops, Identify the new resources of desirable resistant genes. Development of stable/durable resistance varieties in rice. 69
  70. 70. 70

×