1 Obura E,  1 Midega C,  1 Khan ZR,  2 Pickett J and  1 Masiga D  1 ICIPE: International centre of Insect Physiology and E...
Model of sustainable small-holder mixed farming at ICIPE, Mbita Organic Manure Non-chemical cereal pest management Enough ...
Napier stunt disease Which leafhopper species is transmitting Napier stunt disease?
ICIPE collected 22 plant sucking Hoppers from Bungoma, Busia, Kitale and Suba areas, Kenya
The plant sucking hoppers were reared in cages at ICIPE, Mbita
22 plant sucking Hoppers and their phytoplasma status For full data contact authors Family Insect Species PCR Testing/Phyt...
60 Days phytoplasma infection, 10 gravid female insects Disease monitoring cage The Hoppers were tested for Phytoplasma tr...
Only R. banda   transmitted phytoplasma 1.2-kb Plants before phytoplasma inoculation Plants after phytoplasma transmission...
7/12 plants developed symptoms and died after 6 months
MBS Transmitted phytoplasma formed clade with NGS NGS-E BrGWL BGWL SGGS SCGS SCWL RYD NGS-K NGS-U NGS-Ex NGS-D NGS-Recilia...
The Genus  Maiestas  (= Recilia ) 23 Species Afrotropical R. mica: blast disease phytoplasma in oil palm seedlings (WA) R....
ICIPE has Barcoded  Recilia banda >Recilia banda COI partial sequence atactttatcttagggagatgaactagaatcttggggatttctttaagaaga...
Patterns of NGS phytoplasma acquisition and transmission by the leafhopper R. banda <ul><li>Phytoplasma acquisition time l...
Life cycle of NSD in the region Recilia banda (1-3 days) (≥5 mins) (7-10 days)
R. Banda survives and breed well on diseased plants The phytoplasma seems to confer survival advantage to the insect
R. banda density in the field <ul><li>Up to 20 insects/m2 collected from Diseased Napier grass plot </li></ul><ul><li>Only...
There is up to 60% infected insects in nearby healthy plots after Rouging diseased plants by farmers Up to 40% infected in...
Loop mediated isothermal amplifcation of DNA for rapid detection of phytoplasma M  +  -  1  2  3  4  5  6  7  8  M  -  +  ...
30 cultivars are being screened for phytoplasma resistance at ICIPE, Mbita
18 cultivars confirmed susceptible Known Germplasm Farmer selected For full data contact the authors For full data contact...
17 Wild host grasses are being screened for R. banda survival and phytoplasma transmission 1. Cynodon dactylon 2. Digitari...
Phytoplasma diseased  Cynodon dactylon  in Busia area, western Kenya (Obura et al., NDR, 2010)
C. dactylon is Common/important grass for turf and wild rangeland in eastern Africa
MS-Minimal survival (1 week) S&B-Survival and Breeding P-Successful phytoplasma transmission  NS-No survival 7 cereals hav...
3/12 pearl milet samples infected with phytoplasma M  -  +  1  2  3  4  5  6  7  8  9  10  11  12 R. Banda breeds and tran...
Pearl millet is a very important cereal
<ul><li>At ICIPE </li></ul><ul><li>Discriminate R. banda in eastern Africa </li></ul><ul><li>Identify a phytoplasma resist...
<ul><li>Dr. Mike Wilson, National Museum of Wales, Cardiff, UK  </li></ul><ul><li>Dr. Tadashi Ishikawa, Tokyo University o...
THANK YOU
Upcoming SlideShare
Loading in …5
×

Napier stunt disease is transmitted by a leafhopper vector Maiestas (=Recilia) banda in Western Kenya

2,803 views
2,436 views

Published on

A presentation prepared by Obura E., Midega C., Zeyaur K., Pickett J. and Masiga D. for the ASARECA/ILRI Workshop on Mitigating the Impact of Napier Grass Smut and Stunt Diseases, Addis Ababa, June 2-3, 2010.

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
2,803
On SlideShare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
28
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • Introduced pests of vegetables and cut flowers with quarantine status in the EU
  • Napier stunt disease is transmitted by a leafhopper vector Maiestas (=Recilia) banda in Western Kenya

    1. 1. 1 Obura E, 1 Midega C, 1 Khan ZR, 2 Pickett J and 1 Masiga D 1 ICIPE: International centre of Insect Physiology and Ecology 2 Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ, UK Napier stunt disease is transmitted by a leafhopper vector Maiestas (=Recilia) banda in Western Kenya Presented at the ASARECA/ILRI Workshop on Mitigating the Impact of Napier Grass Smut and Stunt Diseases, Addis Ababa, June 2-3, 2010
    2. 2. Model of sustainable small-holder mixed farming at ICIPE, Mbita Organic Manure Non-chemical cereal pest management Enough fodder for livestock Soil conservation Increased maize, milk and meat production
    3. 3. Napier stunt disease Which leafhopper species is transmitting Napier stunt disease?
    4. 4. ICIPE collected 22 plant sucking Hoppers from Bungoma, Busia, Kitale and Suba areas, Kenya
    5. 5. The plant sucking hoppers were reared in cages at ICIPE, Mbita
    6. 6. 22 plant sucking Hoppers and their phytoplasma status For full data contact authors Family Insect Species PCR Testing/Phytoplasma status Cicadellidae Cofana spectra + Cofana unimaculata - Cofana polaris + Cicadulina mbila + Exitianus distanti + Exitianus attenuatus + Glossocratus afzelii + Recilia banda + Delphacidae Thriambus levis - Thriambus strenuus + Thriambus vegatatus - Leptodelphax cyclops - Leptodelphax maculigera - Leptodelphax dymas + Sogatella Manetho + Sogatella nigrigenis - Sogatella kolophon - Rhinotettix fuscipennis + Rhinotettix breviceps - Tagosodes cubanus. - Aphrophoridae Poophilus sp. - Clovia sp. -
    7. 7. 60 Days phytoplasma infection, 10 gravid female insects Disease monitoring cage The Hoppers were tested for Phytoplasma transmission
    8. 8. Only R. banda transmitted phytoplasma 1.2-kb Plants before phytoplasma inoculation Plants after phytoplasma transmission 1.2-kb M - + 1 2 3 4 5 6 7 8 9 10 11 12 M + - 1 2 3 4 5 6 7 8 9 10 1112
    9. 9. 7/12 plants developed symptoms and died after 6 months
    10. 10. MBS Transmitted phytoplasma formed clade with NGS NGS-E BrGWL BGWL SGGS SCGS SCWL RYD NGS-K NGS-U NGS-Ex NGS-D NGS-Recilia SCYL BD ROL
    11. 11. The Genus Maiestas (= Recilia ) 23 Species Afrotropical R. mica: blast disease phytoplasma in oil palm seedlings (WA) R. dorsalis: rice dwarf phytoreovirus, rice gall dwarf phytoreovirus, and rice orange leaf (ROL) phytoplasma (ASIA)
    12. 12. ICIPE has Barcoded Recilia banda >Recilia banda COI partial sequence atactttatcttagggagatgaactagaatcttggggatttctttaagaagattaatccgatttgaaatcaattcaatagatacaatctttgaagaaaaaagatcttataatattttaatcacttctcatgcaattattataatcttttttttagtaatacctgtaactataggtggatttggaaattgattagttcctttaatattaataactcctgacatagcttttccacgattaaataatttcaggttttgaattttactaccttctttaataatatttataagaagaataatattaaaaactggtgtaatagcaggatgaacaatttaccctcctttaacattacttaacagccatccagattactcaatagaattaactatttttaggcttcatttagcaggaatttcgtcaattttgagttcaattaattttataacaactacaattaacataagatccgtaaaatttataaaaattccattatttgtatgatcaattaattttactgctattttattaattttaacattgcctgtactagccggagcaattactatattattgtttgatcgaaattttaacacatcattttatgaccctacaggaagaggagatccaaggatgcagag For full details please contact authors
    13. 13. Patterns of NGS phytoplasma acquisition and transmission by the leafhopper R. banda <ul><li>Phytoplasma acquisition time longer: 1-3 days </li></ul><ul><li>Plant infection/inoculation time as short as 5 mins </li></ul><ul><li>Only 3 infected insects required to deliver enough phytoplasma dose to initiate infection to 1 potted Napier grass </li></ul><ul><li>Hoppers are infective for life (up to 60 days) </li></ul>
    14. 14. Life cycle of NSD in the region Recilia banda (1-3 days) (≥5 mins) (7-10 days)
    15. 15. R. Banda survives and breed well on diseased plants The phytoplasma seems to confer survival advantage to the insect
    16. 16. R. banda density in the field <ul><li>Up to 20 insects/m2 collected from Diseased Napier grass plot </li></ul><ul><li>Only up to 5 insects/m2 collected from Healthy Napier grass plot </li></ul><ul><li>Up to 100% of insects collected from Diseased Napier grass canopy are phytoplasma infected </li></ul><ul><li>Up to 20% of the insects in the healthy Napier grass plots are infected </li></ul>
    17. 17. There is up to 60% infected insects in nearby healthy plots after Rouging diseased plants by farmers Up to 40% infected insects collected in healthy canopy after a farm activity (walking, weeding) Eggs or Nymphs and adults are disseminated by farmers with Napier grass seed canes R. banda dispersal
    18. 18. Loop mediated isothermal amplifcation of DNA for rapid detection of phytoplasma M + - 1 2 3 4 5 6 7 8 M - + 1 2 3 4 5 6 7 8 A: Symptomatic B: Assymptomatic/-PCR M - + 1 2 3 4 5 6 7 8 M + - 1 2 3 4 5 6 7 8 LAMP gene target and Primers Assay Serial dilutions of DNA extracted from test plant   Initial DNA 1:10 2 1:10 4 1:10 6 Nested PCR + + - - LAMP + + + -
    19. 19. 30 cultivars are being screened for phytoplasma resistance at ICIPE, Mbita
    20. 20. 18 cultivars confirmed susceptible Known Germplasm Farmer selected For full data contact the authors For full data contact the authors Variety Name Resistant/Susceptible 1. Kakamega 1 S 2. Kakamega 2 S 3. Kakamega3 S 4. Kakamega5 S 5. Kakamega8 S 6. Ex Bokole S 7. French Cameroon S 8. Pakistan Hybrid S 9. Ex Matuga S 10. Ex-Mariakani S 11. Clone 13 S 12. Congo Kinshasha S 13. Gold Coast ongoing 14. Uganda Border S 15. Uganda L14 S 16. Nigeria 14 S 17. Nairobi L8 ongoing 18. Machakos Hairless S 19. South Africa L3 ongoing 20. Gold Coast Ongoing 21. Malawi Ongoing 22. Bana grass S Variety Name Resistant/Susceptible BV S BFTC Ongoing RT1 Ongoing RT2 Ongoing LO Ongoing OK Ongoing O2 Ongoing JO Ongoing
    21. 21. 17 Wild host grasses are being screened for R. banda survival and phytoplasma transmission 1. Cynodon dactylon 2. Digitaria scalarum 3. Echinochloa pyramidalis 4. Cenchrus ciliaris 5. Eragrostis superba 6. Setaria incrisata 7. Sporobolus pyramidalis 8. Eleusine indica 9. Panicum maximum 10. Heteropogon contortus 11. Hyperrhenia rufa 12. Bathrochloa bladhi 13. Bathrochloa insculpta 14. Themeda triandra 15. Dactyloctenium aegyptum 16. Sorghum sudanensis For full data contact the authors
    22. 22. Phytoplasma diseased Cynodon dactylon in Busia area, western Kenya (Obura et al., NDR, 2010)
    23. 23. C. dactylon is Common/important grass for turf and wild rangeland in eastern Africa
    24. 24. MS-Minimal survival (1 week) S&B-Survival and Breeding P-Successful phytoplasma transmission NS-No survival 7 cereals have been screened for R. banda survival and NSD transmission For full data contact the authors Common Name Scientific Name Survival Maize Zea mays NS Sugarcane Sacharum sp MS,P Pearl Millet Pennisetum glaucum S&B, P Rice Oryzae sativa MS,P Wheat Triticum aestivum NS Sorghum Sorghum vulgare NS Finger Millet Eleusine corocana NS
    25. 25. 3/12 pearl milet samples infected with phytoplasma M - + 1 2 3 4 5 6 7 8 9 10 11 12 R. Banda breeds and transmit phytoplasma to Pearl millet For full data contact the authors
    26. 26. Pearl millet is a very important cereal
    27. 27. <ul><li>At ICIPE </li></ul><ul><li>Discriminate R. banda in eastern Africa </li></ul><ul><li>Identify a phytoplasma resistant Napier grass cultivar </li></ul><ul><li>Develop genetic and Morphological markers for the selection of the resistant cultivar </li></ul><ul><li>Genetic transformation of Resistant cultivar </li></ul><ul><li>Study the wild grass host range of Napier stunt phytoplasma </li></ul><ul><li>Screen phytoplasma infection to other cereals </li></ul><ul><li>Study the genetic diversity of Recilia banda in eastern Africa </li></ul>
    28. 28. <ul><li>Dr. Mike Wilson, National Museum of Wales, Cardiff, UK </li></ul><ul><li>Dr. Tadashi Ishikawa, Tokyo University of Agriculture, Japan. </li></ul><ul><li>Biotechnology Unit, ICIPE </li></ul><ul><li>The Kilimo Trust, East Africa, the Gatsby Charitable Foundation, UK, and DAAD </li></ul>ACKNOWLEDGEMENT
    29. 29. THANK YOU

    ×