East Coast fever – outlook for a new 
vaccine 
Vish Nene 
Workshop on the distribution, delivery and improvement of the 
I...
A live vaccine via ITM for the control of ECF 
A live infection and treatment based method of vaccination 
Caused by Theil...
Entry points for subunit vaccine intervention 
Infected R. appendiculatus ticks 
schizont-infected cells 
sporozoites 
pir...
Technical advances in DNA/RNA/protein sequencing, glycomics, molecular & cellular biology, immunology, bioinformatics, nan...
p67N 
p67M 
p67C 
21 225 
226 571 
572 651 
9 709 
Average 
sporozoite 
bovine cell 
Parasite neutralizing Abs 
Antibodies...
A novel human antibody discovery platform
T-cell antigen discovery pipeline at ILRI - I ACTGGTACGTAGGGCATCGATCGACATGATAGAGCATATAGCATGACGATGCGATCGACAGTCGACAGCTGACAGC...
T-cell antigen discovery pipeline at ILRI - II 
By Anne Mølgaard 
High information 
positions 
HLA-A0201 
Pep de	in	MHC	gr...
Mapped parasite CTL antigens/epitopes 
CTL epitope 
Peptide sequence 
MHC class I gene 
BoLA sero-type 
Tp1214-224 
VGYPKV...
East Coast fever vaccine trials in cattle 
One candidate B-cell vaccine antigen 
~50% cattle immune to challenge in lab tr...
An East Coast fever R & D consortium 
Inception workshop: 27-29th Jan 2014
Antibodies 
Killer T-cells (CTLs) 
Map new pathogen antigens 
Map host response to infection & vaccination 
Comparative pa...
Improve live vaccine – sporozoite counts 
1.Enumerate live sporozoites 
2.Relate sporozoite counts to infectivity 
3.Relat...
Vaccines? 
Novel acaricides? 
Anti-tick? 
A role for vector control?
ECF Consortium -POC – in four years 
1.Best bet sporozoite antigens 
2.Best bet schizont antigens 
3.Best bet delivery sys...
The presentation has a Creative Commons licence. You are free to re-use or distribute this work, provided credit is given ...
Upcoming SlideShare
Loading in …5
×

East Coast fever—Outlook for a new vaccine

1,202 views

Published on

Presented by Vish Nene at the Workshop on the Distribution, Delivery and Improvement of the
Infection and Treatment Method Vaccine for East Coast Fever, Nairobi, 19-20 August 2014


Published in: Science
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,202
On SlideShare
0
From Embeds
0
Number of Embeds
414
Actions
Shares
0
Downloads
17
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

East Coast fever—Outlook for a new vaccine

  1. 1. East Coast fever – outlook for a new vaccine Vish Nene Workshop on the distribution, delivery and improvement of the Infection and Treatment Method vaccine for East Coast fever Nairobi, 19-20 August 2014
  2. 2. A live vaccine via ITM for the control of ECF A live infection and treatment based method of vaccination Caused by Theileria parva – a tick transmitted pathogen Vaccination method developed by KARI and ILRI in mid-1970’s The Muguga cocktail a commercial enterprise at CTTBD
  3. 3. Entry points for subunit vaccine intervention Infected R. appendiculatus ticks schizont-infected cells sporozoites piroplasms merogony Antigenic diversity - a hallmark of T. parva sporozoite neutralizing Abs sporozoite bovine cell schizont-specific CD8 killer T-cells (CTLs) CTL P CTL P
  4. 4. Technical advances in DNA/RNA/protein sequencing, glycomics, molecular & cellular biology, immunology, bioinformatics, nano-tech, computational biology, structural biology, microbiomes, etc. New paradigms in science are accelerating vaccine development research 1.Identification of candidate vaccine antigens 2.Immunogenicity studies with antigens 3.Laboratory challenge studies 4.Contained field trials
  5. 5. p67N p67M p67C 21 225 226 571 572 651 9 709 Average sporozoite bovine cell Parasite neutralizing Abs Antibodies to p67 mediate immunity to ECF
  6. 6. A novel human antibody discovery platform
  7. 7. T-cell antigen discovery pipeline at ILRI - I ACTGGTACGTAGGGCATCGATCGACATGATAGAGCATATAGCATGACGATGCGATCGACAGTCGACAGCTGACAGCTGAGGGTGACACCAGCTGCCAGCTGGACCACCATTAGGACAGATGACCACACACAAATAGACGATTAGGACCAGATGAGCCACATTTTAGGAGGACACACACCA Bioinformatics tools Predict ~ 5000 gene sequences & list candidate vaccine antigens Clone genes of vaccine interest Filter genes via IFN-g ELISPOT and lytic assays T. parva genome sequence A Random cDNA library B Candidate CTL antigens Map CTL epitopes
  8. 8. T-cell antigen discovery pipeline at ILRI - II By Anne Mølgaard High information positions HLA-A0201 Pep de in MHC groove Pep des exhibit a mo f Various algorithms available for predic on of pep de epitopes [Peptide] Control BoLA-N*04101/ no peptide BoLA-N*04101/Tp227-37 BoLA-N*04101/Tp229-37 CD8+ (PerCP) Flow cytometry assay
  9. 9. Mapped parasite CTL antigens/epitopes CTL epitope Peptide sequence MHC class I gene BoLA sero-type Tp1214-224 VGYPKVKEEML N*01301 A18 (HD6) Tp227-37 SHEELKKLGML T2b~ Tp249-59 KSSHGMGKVGK N*01201 A10 (T2a) Tp296-104 FAQSLVCVL T2c~ Tp298-106 QSLVCVLMK N*01201 A10 (T2a) Tp4328-336 TGASIQTTL N*00101 A10 (5.1) Tp587-95 SKADVIAKY T5~ Tp7206-214 EFISFPISL T7~ Tp8379-387 CGAELNHFL N*00101 A10 (5.1)
  10. 10. East Coast fever vaccine trials in cattle One candidate B-cell vaccine antigen ~50% cattle immune to challenge in lab trials How can this be improved? Twelve candidate T-cell vaccine antigens ~30% cattle immune to challenge in lab trials How can this be improved?
  11. 11. An East Coast fever R & D consortium Inception workshop: 27-29th Jan 2014
  12. 12. Antibodies Killer T-cells (CTLs) Map new pathogen antigens Map host response to infection & vaccination Comparative pathogen genomics Fill knowledge gaps for vaccine development & proof-of-concept (POC) Compare different vaccination systems
  13. 13. Improve live vaccine – sporozoite counts 1.Enumerate live sporozoites 2.Relate sporozoite counts to infectivity 3.Relate sporozoite counts to immunogenicity Guava easyCyte™ 5 high power laser (Merck-Millipore)
  14. 14. Vaccines? Novel acaricides? Anti-tick? A role for vector control?
  15. 15. ECF Consortium -POC – in four years 1.Best bet sporozoite antigens 2.Best bet schizont antigens 3.Best bet delivery systems 4.Combination of sporozoite and schizont antigens Phase 1: 70~80% immunity to defined parasite challenge/defined cattle Phase 2: broad-spectrum immunity
  16. 16. The presentation has a Creative Commons licence. You are free to re-use or distribute this work, provided credit is given to ILRI. better lives through livestock ilri.org

×