• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Livestock research for Africa’s food security and poverty reduction
 

Livestock research for Africa’s food security and poverty reduction

on

  • 2,342 views

Presented by Jimmy Smith, Shirley Tarawali, Iain Wright, Suzanne Bertrand, Polly Ericksen, Delia Grace and Ethel Makila at a side event at the 6th Africa Agriculture Science Week, Accra, Ghana, 15-20 ...

Presented by Jimmy Smith, Shirley Tarawali, Iain Wright, Suzanne Bertrand, Polly Ericksen, Delia Grace and Ethel Makila at a side event at the 6th Africa Agriculture Science Week, Accra, Ghana, 15-20 July 2013

Statistics

Views

Total Views
2,342
Views on SlideShare
1,697
Embed Views
645

Actions

Likes
1
Downloads
49
Comments
1

14 Embeds 645

http://www.ilri.org 358
http://unjobs.org 101
http://clippings.ilri.org 89
http://www.ilri.cgiar.org 30
https://twitter.com 25
http://eventifier.com 12
http://eventifier.co 7
http://ilri.org 6
http://192.156.137.114 6
http://cloud.feedly.com 4
http://feeds.feedburner.com 4
http://mail.iconnect.co.ke 1
https://www.google.co.uk 1
https://translate.googleusercontent.com 1
More...

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

CC Attribution-NonCommercial-ShareAlike LicenseCC Attribution-NonCommercial-ShareAlike LicenseCC Attribution-NonCommercial-ShareAlike License

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel

11 of 1 previous next

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
  • Bonjour, Hi.
    I am from Togo (west Africa) and I want to ask how ILRI is leaded in our sub region and how it can help in a scholarship for a phD in livestock. Thanks
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • There MUST be a CGIAR logo or a CRP logo. You can copy and paste the logo you need from the final slide of this presentation. Then you can delete that final slide To replace a photo above, copy and paste this link in your browser: http://www.flickr.com/photos/ilri/sets/72157632057087650/detail/ Find a photo you like and the right size, copy and paste it in the block above.

Livestock research for Africa’s food security and poverty reduction Livestock research for Africa’s food security and poverty reduction Presentation Transcript

  • Livestock research for Africa’s food security and poverty reduction Jimmy Smith, Shirley Tarawali, Iain Wright, Suzanne Bertrand, Polly Ericksen, Delia Grace and Ethel Makila The 6th Africa Agriculture Science Week, Accra, Ghana, 15-20 July 2013
  • ILRI’s strategy Livestock research for food security and poverty reduction
  • Strategy in context • ILRI in the CGIAR • Livestock in Africa • Strategic issues • Elements of strategy • Topics for discussion
  • ILRI – a member of the CGIAR Consortium CGIAR consortium ILRI strategy Global livestock issues
  • Why bother with the livestock sector in Africa?
  • 3 out of 6 of the highest value African commodities are livestock Source: FAOSTAT, 2013
  • FAO, 2012 Annual % growth in consumption of livestock products between 1995 and 2005
  • Strategic issues Photo ILRI/Collins
  • Strategic issues Improve food security Deliver at scale Empower women Employ diverse approaches Address health and environmental problems Use new science Increase investments Develop capacity Ensure fit for purpose
  • Growth scenarios for livestock systems • ‘Strong growth’ – Where good market access and increasing productivity provide opportunities for continued smallholder participation. • ‘Fragile growth’ – Where remoteness, marginal land resources or agroclimatic vulnerability restrict intensification. • ‘High growth with externalities’ – Fast changing livestock systems potentially damaging the environment and human health • Different research and development challenges for poverty, food security, health and nutrition, environment
  • Mission (Purpose) WHY ILRI exists WHAT ILRI does HOW the strategy is operationalized Strategic objectives (informed by strategic issues – external and internal environment)) Critical success factors performance areas overlapping do NOT map to structure Key elements
  • Mission and vision ILRI envisions a world where all people have access to enough food and livelihood options to fulfill their potential. ILRI’s mission is to improve food and nutritional security and to reduce poverty in developing countries through research for efficient, safe and sustainable use of livestock—ensuring better lives through livestock.
  • What’s new? • Long term strategy • Outcomes and impacts (accountable; attribution; alignment) • Diversity: trajectories; species; ILRI strengths; partners • Livestock ‘goods’ and ‘bads’ • Mainstreaming gender; human health • Clientele: Beyond livestock producers; partners; capacity development
  • ILRI acts in three (mutually reinforcing) areas • To prove that better use of livestock can make a big difference in enough people’s lives through improved practice. • To influence decision-makers so that they will increase investment in livestock systems. • To ensure there is sufficient capacity in developing countries and among investors to use increased investment effectively and efficiently.
  • Strategic objective 1 ILRI and its partners will develop, test, adapt and promote science-based practices that—being sustainable and scalable— achieve better lives through livestock.
  • Strategic objective 2 ILRI and its partners will provide compelling scientific evidence in ways that persuade decision- makers—from farms to boardrooms and parliaments— that smarter policies and bigger livestock investments can deliver significant socio-economic, health and environmental dividends to both poor nations and households.
  • Strategic objective 3 ILRI and its partners will work to increase capacity amongst ILRI’s key stakeholders and the institute itself so that they can make better use of livestock science and investments for better lives through livestock.
  • The critical success factors
  • • The biomass crisis in intensifying smallholder systems • Vulnerability and risk in drylands • Food safety and aflatoxins • Vaccine biosciences • Mobilizing biosciences for a food-secure Africa
  • The biomass crisis in intensifying smallholder systems
  • The biomass crisis in intensifying smallholder systems Why does it matter? • Increasing livestock populations are putting pressure on demand for feed and increasing the competition for biomass • Feed is at the interface of positive and negative effects of livestock • Supports intensification , income and employment • Major input cost – feed:product price ratio increasing • Biomass production is major user of natural resources (land, water) • Increased intensification increases feed efficiency and reduces GHG emissions, water use, biomass use
  • The biomass crisis in intensifying smallholder systems What are we doing about it? Supporting sustainable intensification to produce more product from less biomass. Using a value chain approach to: 1) make better use of existing feed resources, 2) produce more and better feeds; 3) encourage and facilitate feed trading, processing and small scale business enterprises around feed • Tools for assessing feed resources and for prioritizing feed interventions • Select, breed and disseminate improved food-feed crops and forages and identify new feed ingredients • Identify feed surplus: deficit areas, facilitate fodder markets and design context specific feed processing approaches • Consider environmental impacts, including competition for biomass (e.g. soil OM) in smallholder systems and GHG and water implications
  • The biomass crisis in intensifying smallholder systems What is the next frontier? • What will the trajectory of demand be in Africa and what are the implications for biomass use? • Transitions vs sustainability • Technical vs. institutional solutions e.g. • Cellulolytic biomass upgrading? • More efficient livestock value chains? • Questions for discussion • What are the options for sustainable intensification through livestock feeding? • How can we best deal with the competition for biomass between livestock feeding and soil fertility?
  • Vulnerability and risk in the drylands
  • Vulnerability and risk in drylands Why does it matter? • Lots of livestock produced in the drylands • E.g. 80% if red meat consumed in Kenya • Risk inherent to dryland livestock production and risks are increasing • Renewed commitment from governments and donors to build resilience • Complex systems require innovative solutions from research and development
  • Vulnerability and risk in drylands What are we doing about it? • Hosting a Technical Consortium to support investment plans for resilience • Active partner in the Drylands CRP • Piloting Index – Based Livestock Insurance • Northern Kenya, Ethiopia • Promoting equitable commercialization • Fostering better land management
  • Vulnerability and risk in drylands What is the next frontier? • How can commercial pastoral livestock production lead to growth in risk-prone drylands? • Is there a long term role for livestock insurance in pastoral production systems?
  • Food safety and aflatoxins
  • Food safety and aflatoxins Why does it matter? • FBD is the most common disease in the world • FBD is the most serious agriculture associated disease • FBD is not just about illness: also livestock sector, trade and environmental impacts
  • Food safety and aflatoxins What are we doing about it? • Targeting interventions to 9 high value, high nutrition, high risk livestock & fish chains • Working with crop-centers to strengthen public health aspects of aflatoxins
  • Food safety and aflatoxins The big questions? • How to assure food safety in informal markets where most of the poor buy & sell? • How to wed food safety and nutrition? • Do aflatoxins stunt children as well as killing and causing liver cancer?
  • Vaccine biosciences
  • ILRI will initially focus on five prioritized diseases  African swine fever (ASF) – swine African disease threatens the global $150 billion/year pig industry  Contagious bovine pleuropneumonia (CBPP) – cattle Regional losses to CBPP amount to ~ $60 million/year  East Coast fever (ECF) – cattle Regional losses exceed $300 million/year; kills ~ 1million cattle/year  Peste de petits ruminants (PPR) – small ruminants Losses in Kenya alone amount to ~ $13 million/year  Rift Valley Fever (RVF) – small ruminants, cattle and human 2006/7 outbreak in Kenya cost ~ $30 million 309 human cases in Kenya, Somalia and Tanzania; 140 deaths Vaccines save livestock and contribute to food security and poverty alleviation Importance of animal health control in Africa
  • Vaccine Biosciences: new science platforms, new opportunities  Optimizing existing vaccines  Thermostabilization of attenuated viral vaccines  Establishing quality control and process improvement  Reverse vaccinology and immunology  Identification of vaccine antigens  Assessing protein and gene-based vaccine formulations   Pathogen & livestock genomics  Host and pathogen gene expression profiles  Pathogen population structure  Synthetic genomics  Manipulating bacterial genomes  Attenuating viruses by genome engineering ACTGGTACGTAGGGCATCGA TCGACATGATAGAGCATATA GCATGACGATGCGATCGACA GTCGACAGCTGACAGCTGAG GGTGACACCAGCTGCCAGCT GGACCACCATTAGGACAGAT GACCACACACAAATAGACGA TTAGGACCAGATGAGCCACA TTTTAGGAGGACACACACCA Bioinformatics tools Predict gene sequences and list candidate vaccine antigens Test experimental vaccine Clone genes of vaccine interest (100’s of genes) Filter genes via immunological assays Pathogen genome mining (1000’s of genes) Molecular immunology tools to assess immune responses in cattle (10’s genes)
  • Vaccinology capacity in Africa? Marke ng Market assessment Proof-of-principle laboratory/field Clinical development Manufacturing Product development partnershipsResearch partnerships Disease selec on Lead vaccine molecules Vaccine op miza on Scaled-up produc on Delivery NARS, Universi es, ARIs, Regional and sub-regional R&D organiza ons, PPP Target product profile Phase I, II, III trials Regulatory processes Con nued monitoring PPP, Private sector, Regional networks, FAO, OIE, PANVAC, AU-IBAR, NARs, NGOs  How do we stimulate and sustain an African vaccine R & D pathway to achieve impact?  How can we grow a biotech and vaccine manufacturing sector in Africa?
  • Mobilizing biosciences for a food-secure Africa
  • Building biosciences capacity in Africa Why? • Small holder agriculture is crucial for Africa • For the last 25 years the productivity of small farmers has declined • Availability and widespread use of quality farm inputs & technologies developed through biotechnology can improve productivity
  • Building biosciences capacity in Africa What? Capacity buildingCollaborative research Food safety & security Income generation Increased trade Climate change Environmental sustainability Technologies and services
  • Building biosciences capacity in Africa • How can we build bio-sciences capacity in Africa to move from research results to development impacts? • How can we keep the BecA-ILRI Hub relevant to the research needs and context of African scientists?
  • The presentation has a Creative Commons licence. You are free to re-use or distribute this work, provided credit is given to ILRI. better lives through livestock ilri.org