Your SlideShare is downloading. ×
Current and future animal vaccine research activities at ILRI
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Introducing the official SlideShare app

Stunning, full-screen experience for iPhone and Android

Text the download link to your phone

Standard text messaging rates apply

Current and future animal vaccine research activities at ILRI

420
views

Published on

Prepared by ILRI's Vaccine team, 1 July 2014

Prepared by ILRI's Vaccine team, 1 July 2014


0 Comments
3 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
420
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
24
Comments
0
Likes
3
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Current  and  future  animal  vaccine   research  ac2vi2es  at  ILRI   Vaccine  Biosciences   Interna.onal  Livestock  Research  Ins.tute   1st  July  2014   Contact:    ilri-­‐vaccines@cgiar.org  
  • 2. ILRI  Nairobi  campus   A lab in Africa at the foot of Kenya’s Ngong Hills ★  
  • 3. Google’s  view  of  the  ILRI  campus  -­‐   laboratory  and  farm  facili2es   BecA  -­‐ ILRI  Labs   Secure   Animal   Disease   Facility   Farm  and   paddocks  
  • 4. Importance  of  animal  health  research  in   the  developing  world   Ø  Livestock  offer  a  powerful  pathway  out  of  poverty  for  ~750  million  poor  farmers  in   South  Asia  and  Africa  by  providing  nutri2onal  and  economic  security.   Ø  Infec2ous  livestock  diseases  feature  prominently  among  the  constraints  faced  by   livestock  agriculture.   u  Endemic  diseases   u  Epidemic/pandemic  diseases   u  Trans-­‐boundary  diseases   u  Emerging  and  re-­‐emerging  diseases   u  Zoono2c  diseases  and  food  safety       Ø  Vaccines  are  the  most  effec2ve  disease  interven2on  deployed  especially  in   developing  countries  but  most  vaccines  if  they  exist  are  sub-­‐op2mal.   Ø  For  many  reasons  diseases  are  neglected  problems  in  affected  countries,  a  situa2on   exacerbated  by  a  general  lack  of  investment,  vaccine  R  &  D  and  manufacturing   capacity.    
  • 5. List  of  current  ILRI  high  priority   diseases  targeted  for  control   Ø  African  swine  fever  (ASF)  –  swine   u  African  disease  threatens  the  global  $150  billion/year  pig  industry   Ø  Contagious  bovine  pleuropneumonia  (CBPP)  –  caZle   u  Regional  losses  to  CBPP  amount  to  ~  $60  million/year     Ø  East  Coast  fever  (ECF)  –  caZle   u  Regional  losses  exceed  $300  million/year;  kills  ~  1million  caZle/year     Ø  Peste  de  pe2ts  ruminants  (PPR)  –  small  ruminants   u  Losses  in  Kenya  alone  amount  to  ~  $13  million/year       Ø  Ri_  Valley  Fever  (RVF)  –  small  ruminants,  caZle  and  human   u  2006/7  outbreak  in  Kenya  cost  ~  $30  million   o   309  human  cases  in  Kenya,  Somalia  and  Tanzania;  140  deaths   Vaccines  save  lives  and  livestock  and  contribute  to  food  security   and  poverty  allevia5on  
  • 6. ILRI’s  vaccine  R  &  D  pathway  to  impact   Marke&ng) Market) assessment) Proof0of0principle) laboratory/field) Clinical) development) Manufacturing) Product)development)partnerships))Research)partnerships) Disease)selec&on) Lead)vaccine)molecules) Vaccine)op&miza&on) Scaled0up)produc&on) Delivery) NARS,&Universi.es,&ARIs,&Regional&and& sub7regional&R&D&organiza.ons,&PPP&& Target)product)profile) Phase)I,)II,)III)trials) Regulatory)processes) Con&nued)monitoring) PPP,&Private&sector,&Regional&networks,&FAO,&OIE,&PANVAC,& AU7IBAR,&NARs,&NGOs& Ø  ILRI’s  compara2ve  advantage  is  mainly  in  the  discovery  phase  to  proof-­‐of-­‐principle   under  laboratory  and  field  condi2ons.   Ø  Different  entry  points  in  pathway  depending  on  disease  targeted  for  control.   u  Improvement  of  exis2ng  vaccines   u  Development  of  subunit  vaccines   u  Laboratory  and  field  based  diagnos2cs  
  • 7. Vaccines  save  lives  and  livestock  and  contribute  to  food  security   and  poverty  allevia5on   ILVAC  –  plan2ng  the  orchard   BASIC&RESEARCH& & Increase&our&knowledge&base& & “Knowledge&lays&the&founda>on& for&science&&&innova>on”& APPLIED&RESEARCH&! Develop&new&vaccines&&&diagnos>cs& ! “Vaccines&are&highly&effec>ve&an>I disease&interven>ons”& ! Study&hostIpathogen&interac>ons& & ! Map&immune&responses&to&infec>on& ! Characterize&pathogen&virulence& ! Inves>gate&disease&epidemiology& ! Dissect&pathogen&biology&&& diversity& ! Iden>fy&candidate&vaccine&and& diagnos>c&molecules& ! Assess&candidate&vaccine&molecules& ! Assess&aMenuated&pathogens& ! ThermoIstabilize&vaccines& ! Develop&easy&to&use&diagnos>c&tools& ! Assess&different&vaccina>on& systems& ! Facilitate&transla>on&of&research& outputs&to&commercial&products&
  • 8. Vaccines  save  lives  and  livestock  and  contribute  to  food  security   and  poverty  allevia5on   ILVAC  -­‐  a  vaccine  plaeorm   An#body(technologies( Vaccine(technologies( Cellular(technologies( Diagnos#c(technologies( Genomic(technologies( Contagious(bovine( pleuropneumonia(( East(Coast(fever( African(swine(fever(( Consor#a(for(research(&(product(development(and(capacity(development( Private(sector( GALVmed( CRPs( NARS( InterEgov( agencies( Improved(vaccines(and( diagnos#c(tools( Peste(des(pe##s(ruminants(( RiF(Valley(fever( Infec#ous(disease( research:(basic(&(applied( ILVAC(–(a(vaccine(plaIorm(
  • 9. A  poreolio  of  innova2on  and  vaccine   related  technology  plaeorms   Ø  Op2mizing  exis2ng  vaccines   u  Thermostabiliza2on  of  aZenuated  viral  vaccines   u  Establishing  quality  control  and  process  improvement       Ø  Reverse  vaccinology  and  immunology   u  Iden2fica2on  of  candidate  vaccine  an2gens   u  Assessing  protein  and  gene-­‐based    vaccine  formula2ons       Ø  Pathogen  &  livestock  genomics   u  Host  and  pathogen  gene  expression  profiles   u  Pathogen  popula2on  structure       Ø  Synthe2c  genomics   u  Manipula2ng  bacterial  genomes   u  AZenua2ng  viruses  by  genome  engineering   Yeast&with&M.#myc&LC& genome& (Delete&puta5ve&& virulence&factors)& Less&virulent&M.#myc&LC& ACTGGTACGTAGGGCATCGA TCGACATGATAGAGCATATA GCATGACGATGCGATCGACA GTCGACAGCTGACAGCTGAG GGTGACACCAGCTGCCAGCT GGACCACCATTAGGACAGAT GACCACACACAAATAGACGA TTAGGACCAGATGAGCCACA TTTTAGGAGGACACACACCA Bioinformatics tools Predict gene sequences and list candidate vaccine antigens Test experimental vaccine Clone genes of vaccine interest (100’s of genes) Filter genes via immunological assays Pathogen genome mining (1000’s of genes) Molecular immunology tools to assess immune responses in cattle (10’s genes)
  • 10. A  research  center  of  excellence  -­‐        a  vaccine  ini2a2ve  at  ILRI   Ø  Exploit  high-­‐end  science  and  technologies  to  accelerate  vaccine  development   Ø  Support  each  disease  focus  with  program  level  funding     Ø  Develop  global  research  and  product  development  partnerships     Ø  Provide  fellowships  for  training  and  scien2fic  leadership  in  developing  countries   Ø  Help  build  ins2tu2onal  capacity  for  vaccine  R  &  D  in  developing  countries     Ø  S2mulate  learning  between  veterinary  and  human  vaccine  communi2es     Ø  Provide  an  incubator  type  approach  to  leverage  ILRI  facili2es  
  • 11. Why  ILRI  for  a  vaccine  ini2a2ve?   Ø  Modern  bio-­‐molecular  laboratory  facili2es   Ø   Secure  animal  disease  facili2es  for  large    and  small  animals     Ø   Loca2on  and  access  to  diverse  pathogens   indigenous  livestock  and  wildlife     Ø  Track  record  in  teaching,  training  and  capacity  building     Ø  Ongoing  projects   o  Vaccine  development  against  neglected  livestock  diseases   o  One  Health  and  agricultural  associated  human  diseases   o  Highly  relevant  field  research   Ø  Networks  with  academic,  na2onal,  regional  and  interna2onal  organiza2ons,   including  the  public,  private  and  development  sectors    
  • 12. The  ILRI  Vaccine  Biosciences  group  
  • 13. The  presenta.on  has  a  Crea.ve  Commons  licence.  You  are  free  to  re-­‐use  or  distribute  this  work,  provided  credit  is  given  to  ILRI.   ilri.org Box 30709, Nairobi 00100, Kenya Phone: + 254 20 422 3000 Fax: +254 20 422 3001 Email: ILRI-Kenya@cgiar.org Box 5689,Addis Ababa, Ethiopia Phone: +251 11 617 2000 Fax: +251 11 617 2001 Email: ILRI-Ethiopia@cgiar.org other offices China • India • Mali Mozambique • Nigeria • Tanzania Thailand • Uganda • Vietnam Better lives through livestock ILRI is a member of the CGIAR Consortium BeKer  lives  through  livestock   ilri.org