0
Winning the race against virus threats to   food crops in sub-Saharan Africa:       What we do and how we do it!          ...
Outline1. Introduction: The challenges2. What we do and how we do it!           •   Clonal crops           •   Seed crops ...
1. The challenges                    www.iita.org
Food security and poverty reduction                                                   through agriculture development     ...
Virus diseases•Cause yield and quality loses•Losses are often insidious. Frequently less conspicuous and go unnoticed or u...
Drivers of virus spread/evolutionAgriculture intensification• Raising population demand on food production• Rapid expansio...
Viruses are built to win? • Intracellular pathogens, completely dependent on hosts. • Difficult to eliminate them, without...
• Diverse crops• Diverse viruses• Diverse vectors• Diverse modes of virus spread &• Diverse agro-ecologies                ...
Diversity in viruses        Types worked at IITA                               www.iita.org
Diverse vectors and modes of disseminationWhiteflies       AphidsBeetles          ThripsLeafhoppers      Mealybugs        ...
Ecological diversity:                                          Clonal and seed crops Viruses of clonal crops –STATIC      ...
2. What we do?                 www.iita.org
What we do?                                                                              Strategic Objectives         1. U...
What we do?                                                         Ways to win the race                     Plant Health ...
3. How do we do it?                      www.iita.org
Inter-disciplinary approach              Core business                                       Inter-disciplinary business  ...
Crop specific activitiesCassavaCassava mosaic begomoviruses & brown streak        Maize•Epidemiology                      ...
Generic activitiesPlant health monitoring & quarantine•Virus indexing•Establishment of virus-free clonal and seed germplas...
How we do it!Case Studies                    www.iita.org
Cassava virology1. CMD and CBSD diversity2. Alternative hosts of CMD3. Improve diagnostics4. Virus-host interactions and h...
Cassava mosaic diseaseCaused by a complex of 7 species either alone or in mixed infection•African cassava mosaic virus (AC...
CMG Distribution                                                                        • Surveys were conducted in 7 coun...
Tracking the spread of EACMV-UG             2009                                             2008                         ...
CMG Distribution                                                            Conclusions•ACMV is predominate, followed by m...
Recombinant ACMV•Two types of ACMV detected: Wild type and Recombinant ACMV• Entire AV1 and AV2 (ca 1000 bp) in DNA-A segm...
Alternative hosts to CMGVACMV+EACMVSenna occidentalisLeucana leucocephalaManihot glazioviiCombretum confertumGlycine max (...
Cassava brown streak virus                                                     Potyviridae: Ipomovirus                    ...
FJ687181 CBSV (GRL00508) pCP               FJ687175 CBSV (GRE05008) pCP               FJ687169 CBSV (GRE03908) pCP        ...
Improved diagnosticsCBSV and CMBVs are complex and often necessitates multiple tests.Cassava brown streak virus•Sequence i...
Simultaneous detection of                  ACMV and EACMV complexPrimer           Sequence (5’ to 3’)    Length (nts)     ...
Multiplex PCR for simultaneousACMV              EACMCV             detection of CMBV and CBSV                             ...
Ongoing / future prioritiesCBSD• Improvement in diagnostics – NASH and RT-PCR (GLCI)• Alternative hosts for CBSV (GLCI)• I...
Maize virology  1. Host plant resistance to Maize streak virus  2. Mechanisms of resistance  3. High-throughput phenotypin...
Screening for MSV resistance                           6-7 DAS Material selection           1                  0          ...
High-throughput phenotyping for MSVDisease evaluation0 = No infection or escape1 = Most resistant (less than 10% streaks)2...
Good recovery                   Susceptible                Good recovery                                              www....
Performance of maize genotypes                                                                                            ...
Virus concentration vs Severity score              0.80              0.60                                                 ...
Recovery mechanism offers                                           protection to MSV          6.0          5.0          4...
MSV resistance in S1 testcrosses     • Field experiment for incidence, severity and agronomic performance     • 6 S1 cross...
On-going and future plans• Further characterization of promising lines and release to farmers• Augment resistance to MSV i...
Yam virology                        • Diversity and distribution of viruses infecting yams                          in Wes...
Virus reported to infect                                        Dioscorea yams in West Africa        Virus                ...
Yam virus diagnostics• Diagnostic tools established for all major yam  viruses. -Poly and monoclonal antibodies for Yam mo...
Yam virus diagnostics &                  symptomatology• Uneven distribution of viruses in tubers• Variation in symptom ex...
Evaluation of mapping population                                                   Virus indexing   Following evaluationSl...
Evaluation of mapping population                          www.iita.org
Yam brown spot disease (YBSD)          (Potential CBSD of yam?)       • A virus-like disease of unknown etiology         r...
Studies on IBSD etiology                                1                                2                                ...
Studies on IBSD etiology• Wide spread in Cote d’Ivoire• Known for about 40 to 60 years                                    ...
Phenotyping yams for                                                       virus resistance                               ...
Phenotyping yams for                                                              virus resistance                        ...
Next steps• Determine the diversity of viruses in West Africa and improve diagnostic  tools• Understand the etiology of YB...
Soybean virology                        • Baseline studies to assess the impact of                          virus diseases...
Baseline studies in Nigeria     Virus                       Abbreviation    Genus           Vectors1    Bean pod mottle   ...
www.iita.org
2.7                                      2.5                                                          3.4                 ...
Virus incidence in various states                  120                  100    % infection                   80           ...
Relative abundance of viruses in Nigeria                CpSMV                BICMV                  SMV                CpS...
Relative abundance of viruses in                                      latent infections            0.7 CMeV            1.5...
Distribution of viruses in NigeriaAgro-ecological zone   State       Viruses present                                      ...
New whitefly-transmitted                     begomoviruses in soybean                             [Legumoviruses]         ...
Novel features                                    CRA                                                      CRB      AC4   ...
96    AYVV       AJ558120                                                                                                 ...
Search for resistance to CPMMV    TGX 1448-2E   TGX1903-1F    TGX1951-4E    TGX1440-1E    TGX1903-3F    TGX1954-1F    TGX1...
Soybean reaction to CPMMV               250               200No. of seeds               150               100             ...
Disease of unknown etiology     • Virus-like disease of       unknown etiology.     • Extreme reduction in       leaf lami...
New soybean disease in                                   Southern Africa•Incidence of soybean phyllody was high in Mozambi...
Next steps• Evaluation of soybean genotypes for resistance to  abundant viruses (CPMMV, SMV, CMV, BPMV, CABMV)• Characteri...
Cowpea virology                               Focus:                               • Evaluation of germplasm              ...
Important viruses of                                    cowpea in West Africa               Virus              Abbreviatio...
Distribution of cowpea infecting  viruses in West Africa in 2008                         www.iita.org
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Winning the race against virus threats to food crops in sub-Saharan Africa
Upcoming SlideShare
Loading in...5
×

Winning the race against virus threats to food crops in sub-Saharan Africa

1,339

Published on

The challenges. What we do and how we do it:
• Clonal crops
• Seed crops
• Germplasm health and quarantine
• Diagnostics
• Capacity building

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
1,339
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
35
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Transcript of "Winning the race against virus threats to food crops in sub-Saharan Africa"

  1. 1. Winning the race against virus threats to food crops in sub-Saharan Africa: What we do and how we do it! A review from August 2007 P Lava Kumar Contract Review Seminar, 12 April 2010 www.iita.org
  2. 2. Outline1. Introduction: The challenges2. What we do and how we do it! • Clonal crops • Seed crops • Germplasm health and quarantine • Diagnostics • Capacity building3. Future plan Stay fit and competitive4. Conclusions www.iita.org
  3. 3. 1. The challenges www.iita.org
  4. 4. Food security and poverty reduction through agriculture development • 10% increase in agriculture productivity in Africa is associated with 7.2% decrease in poverty (IFPRI 2004). N = 327.2 million t 76% IITA crops 6% 35 7% 140 Production, tonnes (x 1 000,000) 1 1 8% 37% 30 2 120 cassavaArea, ha (x 1 000,000) 25 11% 100 musa 20 80 15 2 3 yam 15% 16% 3 60 maize 10 4 5 4 40 4 6 7 6 7 5 20 0 0 Maize Sorghum Cassava Rice Wheat Musa Yams www.iita.org
  5. 5. Virus diseases•Cause yield and quality loses•Losses are often insidious. Frequently less conspicuous and go unnoticed or untreated.Direct and indirect losses: •Reduction in growth •Reduction in vigor •Reduction in quality & market value •Reduction in transboundary trade •Costs of maintaining health• MSV: $180 million to $480 million at 5% annual incidence• CMD: 42% yield reduction in EACMV-UG affected region• CBSD: $100 million in 2003 www.iita.org
  6. 6. Drivers of virus spread/evolutionAgriculture intensification• Raising population demand on food production• Rapid expansion in area• New crops & varieties, continuous cultivation (absence of breaks)Effects of Global Warming Effects of climate variability / change • Distribution of pests and diseases • Changes in geographical distribution of hosts and pathogens • Altering crop yields and losses due to changes in efficacy of management strategies Source: Nature Vol 438, No. 7066 www.iita.org
  7. 7. Viruses are built to win? • Intracellular pathogens, completely dependent on hosts. • Difficult to eliminate them, without eliminating the host • Do viruses are there to protect hosts from invasive plants? • For instance virus resistance in wild relatives / landraces and susceptibility of introduced species supports this thought. (new encounter diseases of introduced crops) CMD in cassava MSV in maize CSSV in cocoa Rosette of groundnut• New paradigm - Viruses are evolutionary drivers• There is little choice for host and virus – either they Source:Wiki adjust or both will perish Virus• Why is it important here?•Viruses have mechanisms to negate preventive tactics www.iita.org
  8. 8. • Diverse crops• Diverse viruses• Diverse vectors• Diverse modes of virus spread &• Diverse agro-ecologies www.iita.org
  9. 9. Diversity in viruses Types worked at IITA www.iita.org
  10. 10. Diverse vectors and modes of disseminationWhiteflies AphidsBeetles ThripsLeafhoppers Mealybugs www.iita.org
  11. 11. Ecological diversity: Clonal and seed crops Viruses of clonal crops –STATIC Viruses of seed crops - DYNAMIC• Infected clones retain viruses • Only seed-transmitted viruses are indefinitely (What goes in stays retained and passed to next forever!). generation.• Increase in incidence incrementally • Incidence depends on the vectors Reduction depends on the and virus sources (seed-borne / replacement of infected stocks. volunteer plants / alternative hosts). Conditions favoring insects favor high incidence• In general viruses have narrow host range. • In general, broad host range• Predictable annual situation. • Unpredictable annual situation. Different viruses – crops demands different tactics www.iita.org
  12. 12. 2. What we do? www.iita.org
  13. 13. What we do? Strategic Objectives 1. Understand the foe 2. Develop tools to monitor them 3. Establish technologies to prevent viruses (win over the virus) 4. Disseminate the technologies Characterize viruses Develop serological and nucleic acid- (Biological and biochemical) based diagnostic tools Fundamental and appliedStudy virus-vector interactions and virology research for Ensure germplasm health safety and disease epidemiology mitigating the impact of virus quarantine monitoring diseases Develop disease control options, Knowledge and technology transfer including resistant varieties to stakeholders www.iita.org
  14. 14. What we do? Ways to win the race Plant Health Monitoring Breeding Programs Virus-free stocks All All Exclusion Prevention(Cassava & banana) Quarantine & Inspection Cultivation of resistant varieties Breeding programs (From countries) Planting virus free material Conventionally bread / IPM / IDM transgenics Reduce spread Methods to reduce Reduce impact All Vector control impact of virus Cultivation of Physical barriers tolerant varieties Seed testing infections Avoidance by cultural methods Reduce sources of inoculum Field isolation Eliminate crop refuge, Plant spacing / alternative alternate sources dates Not effective in SSA www.iita.org
  15. 15. 3. How do we do it? www.iita.org
  16. 16. Inter-disciplinary approach Core business Inter-disciplinary business Virus Disease Transgenic Plant Breeding resistance Resistant Viral genes Varieties Virus isolation Host R genes Germplasm screening for resistanceBiochemical, molecular & Wild and Cultivated DISEASE Virus characterization species MANAGEMENT Biological Properties Virus isolates Diagnostic tools Disease Epidemiology Monitoring Quarantine Bioassays Vector biology Serological & Virus survival and spread Nucleic-acid assays Environmental factors Virology – Breeding – Biotechnology – Germplasm – Quarantine – Extension www.iita.org
  17. 17. Crop specific activitiesCassavaCassava mosaic begomoviruses & brown streak Maize•Epidemiology Maize streak virus•Virus diversity and diagnostics • Host resistance•Host resistance and seed systems•Whitefly control Cowpea & soybean Bean pod mottle virusYam Blackeye cowpea mosaic virusYam potyvirus & badnavirus complex Cowpea mottle virus•Epidemiology Cowpea mild mottle virus•Virus diversity and diagnostics Cowpea yellow mosaic virus•Host plant resistance Cowpea aphid-borne mosaic virus•Seed systems Cucumber mosaic virus Southern bean mosaic virusBanana Cowpea chlorotic mottleBanana bunchy top Soybean mosaic virus•Epidemiology Tobacco ringspot virus•Investigations on management options Tobacco streak virus Soybean begomovirusesCocoa • Host resistanceCocoa swollen shoot virus • Diversity and distribution•Distribution and diversity•Seed systems www.iita.org
  18. 18. Generic activitiesPlant health monitoring & quarantine•Virus indexing•Establishment of virus-free clonal and seed germplasm•Facilitation of germplasm distributionDiagnostics•PCR and ELISA-based approaches•Viruses, fungi, bacteria and others•MycotoxinsCapacity building•Graduate and post-graduates (MSc & PhD)•Training courses & workshops for groups•Methods manual•Public database•Supply of tools and materials www.iita.org
  19. 19. How we do it!Case Studies www.iita.org
  20. 20. Cassava virology1. CMD and CBSD diversity2. Alternative hosts of CMD3. Improve diagnostics4. Virus-host interactions and host resistance5. Whitefly vector: dynamics, host interaction and controlOJ Alabi and RA Naidu (WSU, USA) SA Akinbade & OpeR Hanna, J Legg, G Melaku, E Kanju, P Ntawuruhunga & P Kulakow•USAID-linkage grant, GLCI, IFAD, USAID•IITA Opportunity Grant, Travel Grant & Strategic Grant www.iita.org
  21. 21. Cassava mosaic diseaseCaused by a complex of 7 species either alone or in mixed infection•African cassava mosaic virus (ACMV)•East African cassava mosaic virus (EACMV)•South African cassava mosaic virus (SACMV)•EACMV-Cameroon, EACMV-Malawi, EACMV-Kenya, EACMV-ZanzibarEACMV-Uganda (Recombinant virus) www.iita.org
  22. 22. CMG Distribution • Surveys were conducted in 7 countries • Samples analyzed by differential PCR & sequencing 80 70 60 ACMV% incidence 50 Both 40 None 30 EACMV 20 UgV 10 0 9 9 09 8 ia 08 08 89 -0 -0 -0 er ie 08 e la a a 07 ig on or n n go on N ha ha n Iv Le An ni o d G G er Be ra e am er ot C Si C •Only ACMV was detected in samples in Mali and Niger. •EACMV-UG was detected in Angola and Cameroon. www.iita.org
  23. 23. Tracking the spread of EACMV-UG 2009 2008 2009•As of 2005, Spread in 2.6 million sq. km causing an estimated loss of 47% in affected countries. •Spread into Cameroon in West-Central Africa •Spread into Angola in Southern Africa •Also reported from Burkina Faso and Togo in 2009 Kumar et al, 2008; Akinbade et al., 2010 www.iita.org
  24. 24. CMG Distribution Conclusions•ACMV is predominate, followed by mixed infection of ACMV and EACMV.•Other viruses found are EACMV and EACMCV, but not SCMV or other EACMV’s•EACMV-UG was detected only in Angola and Cameroon•DNA-A segments of ACMV, EACMCV and EACMV-UG sequenced were96-98% identical to previously reported sequences g i|1 4 8 8 9 7 7 4 7 || E a s t Afric a• Evidence of EACMCV (recombinant g i|2 2 1 3 6 0 4 3 4 |E a s t Afr ic a g i|8 9 3 3 0 6 1 7 |e E a s t Afr ic a n species) in Ghana even in 1989, ten 99 g i|8 9 3 3 0 6 7 1 |e E a s t Afric a n g i|7 2 2 9 2 8 8 | E a s t Afric a n c years before its discovery. g i|7 2 2 9 2 8 2 | E a s t Afric a n c g i|1 4 8 8 9 7 7 4 0 || E a s t Afric a g i|8 9 3 3 0 5 5 5 |E a s t Afr ic a n• Isolates have same age as the first ever 100 51 g i|8 9 3 3 0 5 8 3 |E a s t Afr ic a n g i|8 9 3 3 0 9 4 2 |E a s t Afr ic a n sequences of ACMV published in 1980s. g i|8 9 3 3 0 7 4 8 | E a s t Afric a n g i|8 9 3 3 0 9 6 3 |E a s t Afr ic a n 74 g i|8 9 3 3 0 9 6 3 E a s t Afr ic a n g i|3 8 9 2 5 6 9 |E a s t Afr ic a n• First ever recombinant ACMV 70 g i|7 0 0 8 1 1 3 |S o u th Afric a n AC M V F N4 3 5 2 7 7 found in in Angola 100 G h a n a 1 9 8 9 AC M V IC M V AY 7 3 0 0 3 5 .2 100 S L C M V |NC 0 0 3 8 6 1 E AC M C V -T z 1 AY 7 9 5 9 8 3 100 E AC M C V -NG E U6 8 5 3 2 3 100 E AC M C V -Iv o ry AF 2 5 9 8 9 6 G h a n a -1 9 8 9 - E AC M C VKumar et al., 2008; Akinbade et al., 2010 www.iita.org
  25. 25. Recombinant ACMV•Two types of ACMV detected: Wild type and Recombinant ACMV• Entire AV1 and AV2 (ca 1000 bp) in DNA-A segment in recombinant ACMV has high similarities with EACMV.• Named as ACMV-ANG. Further studies required to assess its affect on pathogenicity. A16.3RecACMV Recombinant ACMV-ANG A16.3UGMld Potential parent of ACMV ACMVX17095 ACMVAJ427910 ACMVICAF259894 ACMVSvrAF126802 ACMVMldAF126800 ACMVTZAY795982 EACMZVAJ717562 EACMKVKEAJ71758 0 SACMVNC003803 EACMCVAF112354 EACMCVNG EACMCVIC EACMMVAJ006460 EACMVKEAJ717542 EACMVTZ EACMVUG2Mld Potential parent of AV1 and AV2 EACMVUG2Svr EACMVNC004674 www.iita.org
  26. 26. Alternative hosts to CMGVACMV+EACMVSenna occidentalisLeucana leucocephalaManihot glazioviiCombretum confertumGlycine max (soybean)ACMV onlyRicinus communis Centrosema SidaAbelmoschus esculentus (Okra)*Centrosema pubescensSida cordifolia*• ACMV and EACMCV has high homologies• Indicates active migration between cassava and other hosts Leucana Okra• Risk of novel recombinations *New record in 2009 Alabi et al., 2008 www.iita.org
  27. 27. Cassava brown streak virus Potyviridae: Ipomovirus ? Prior to 2005 Post 2005 ?• First recognized in 1920s.• Affecting 1.6 million people in Eastern Africa• Kenya, Uganda, Tanzania, Malawi and Mozambique• Suspected in DRC, Burundi and Rwanda www.iita.org
  28. 28. FJ687181 CBSV (GRL00508) pCP FJ687175 CBSV (GRE05008) pCP FJ687169 CBSV (GRE03908) pCP AY008440 CBSV (type C) CP GQ329864 CBSV-Tz (full sequence) 200... FJ687179 CBSV (GRL00108) pCP FJ687178 CBSV (GRE07108) pCP FN434437 CBSV-Tan 70 (full sequence) ... Ug Ke CBSV Diversity FJ687182 CBSV (GRL00808) pCP FJ687184 CBSV (GRL01008) pCP FJ687164 CBSV (GRAO7208) pCP Tz FJ687197 CBSV (GRS00608) pCP FJ687170 CBSV (GRE04408) pCP FJ687176 CBSV (GRE05108) pCP FJ687166 CBSV (GRE03108) pPC FJ687173. CBSV (GRE04708) pCP FJ687172 (GRE04608) pCP FJ687168 CBSV (GRE03708) pCP • About 50 partial coat protein (3’end) sequences generated at IITA. FJ687167 CBSV (GRE03608) pCP FN434436 CBSV-Mo 83 (full sequence) 2... M FJ687191 CBSV (GRL02708) pCP FJ687186 CBSV (GRL01408) pCP FJ687202 CBSV (GRS05708) partial CP61 82 FJ687201 CBSV (GRS05608) Partial CP FJ687185 CBSV (GRL01308) pCP FJ687183 CBSV (GRL00908) pCP • High diversity, two groups, but no FN423417 CBSV-CP (Nampula-Mozambique ... FJ687196 CBSV (GRS00208) pCP FJ687192 CBSV (GRL02908) pCP evidence of geographic separation. FJ687188 CBSV (GRL01808) pCP FJ687165 CBSV (GRA07308) pCP 81 FJ687194 CBSV (GRL03308) pCP 61 FJ687180 CBSV (GRL00408) pCP AY007597 CBSV CP FJ687205 CBSV (GRS07008) partial CP FJ687199 CBSV (GRS03208) pCP FJ687203CBSV (GRS5908) partial CP FJ687200 CBSV (GRS05208) partial CP FJ687204 CBSV (GRS06308) partial CP FJ687198 CBSV (GRS01708) pCP FJ687189 CBSV (GRL02308) pCP 100 FN433933 CBSVM 43 2007 (M a alawi:Salima) AY008442 CBSV (type A) CP FJ821795 CBSV (KBH1) CP 79 FN433932 CBSV-M 42 2007 (M a alawi:Chit... UG, Ken, Mal 64 FJ821794 CBSV (KBH2) CP 92-95% AF311053 CBSV 61 69 AF311052 CBSV FN434109 CBSV-Ug 23 (full sequence) 2... 86-87% 67 FJ687195 CBSV (GRL03408) pCP FJ687193 CBSV (GRL03108) pCP 70 66 FN423418 CBSV-CP (Naliendele-2-Tanzan... FN433930 CBSVKenya 125 1999 (Kenya:K... FN423416 CBSV-CP (Naliendele-1 Tanzan... 100 70-71% AY008441 CBSV (type B) CP FN433930 CBSV Kenya 125 1999 (Kenya:K... FN433931 CBSV-Ke 54 1997 (Kenya:Kilifi) 95 Sh1.1 U 100 89 Sh1.4 U CBSV-TZ-Short-1 FJ185044. CBSV-Uganda (2006) 92 CBSV-TZ-Short-2 61 EU916832 CBSV (BSA4) CP N 012698 CBSVisolate M full geno... C LB3 EU916830 CBSV (IGA8) CP FN434437 CBSV-Tan 70 (full sequence) ... 79-80% EU916827 CBSV (NTG10) CP Tz, Moz EU916829 CBSV (LWR2) CP EU916828 CBSV (HMA9) CP 96% FN434109 CBSV-Ug 23 (full sequence) 2... 100 FN434436 CBSV-M 83 (full sequence) 2... o DQ837304 CBSV (WKS) pCP99 DQ837303 CBSV (NAM) pCP DQ837302 CBSV (MKN) p 100 GQ329864 CBSV-Tz (full sequence) 200... 54 Ten11.2 U 72 EU916831 CBSV (BSA2) CP EU916825 CBSV (MLB3) CP NC 006941 CVYV 84 NC 012698 EU916826 CBSV (MLB9) CP 84 FN433932 CBSV-Ma 42 2007 (Malawi:Chit... FN433933 CBSV Ma 43 2007 (Malawi:Salima) NJ Tree of full-length CBSV genomes FN433931 CBSV-Ke 54 1997 (Kenya:Kilifi) 0.1 Sequences from Genebank CBSV-TZ-Long-1 Lg1.1 U 87 Lg1.3 U CBSV-TZ-Long-2 www.iita.org
  29. 29. Improved diagnosticsCBSV and CMBVs are complex and often necessitates multiple tests.Cassava brown streak virus•Sequence information points to divergent types (2 species and several strains?)Cassava mosaic begomoviruses (CMBVs) in SSA• African cassava mosaic• East African cassava mosaic• East African cassava mosaic Cameroon virus• East African cassava mosaic Zanzibar virus• East African cassava mosaic Malawi virus• East African cassava mosaic Kenya virus• East African cassava mosaic virus-Uganda• South African cassava mosaic virus• Indian cassava mosaic www.iita.org
  30. 30. Simultaneous detection of ACMV and EACMV complexPrimer Sequence (5’ to 3’) Length (nts) Size (bp)CMBRep/F CRTCAATGACGTTGTACCA 19ACMVRep/R CAGCGGMAGTAAGTCMG 17 368 for ACMVEACMVRep/R GGTTTGCAGAGAACTACATC 20 650 for EACMV • Detects all CMBs reported in SSA, with exception of EACMZV, SACMV, ICMV, SLCMV Alabi et al., 2008 www.iita.org
  31. 31. Multiplex PCR for simultaneousACMV EACMCV detection of CMBV and CBSV CBSV-S1/S2 + CMB CBSV-L1/L2 + CMB Sap DNA&RNA ACMV & Sap DNA & RNA M1 2 3 4 5 6 7 1 2 34 5 6 7 M1 2 3 4 5 6 7 1 2 34 5 6 7 M EACMCV EACMV ACMV CBSV Lanes 1 to 4: CBSV infected samples Lane 5: Healthy cassava Lane 6: CMD afffected cassavaPrimer name Sequence (5’ to 3’) Lane 7: CBSD affected cassava Lane M: Molecular weight marker (100 kb ladder)CBSVcp-L1 CAGAATAGTGTTGCTGCAGGTAACBSVcp-L2 CTACATTATTATCATCTCCCBSVcp-S1 GCAGGTAAGGCGTTTGTGCBSVcp-S2 TCTACCAACATTCGCTG Kumar et al., 2009 www.iita.org
  32. 32. Ongoing / future prioritiesCBSD• Improvement in diagnostics – NASH and RT-PCR (GLCI)• Alternative hosts for CBSV (GLCI)• Impact of CBSV strains on host resistance (GLCI & USAID)• Understand the causation of root necrosis (GLCI)• CBSV evolution and within field and location diversity (USAID)• ELISA-based assays to CBSV (USAID / GLCI)• Protocol for the production of CBSV-free tissue culture material (GLCI)CMD and CBSD• Whitefly management programs as away to reduce disease incidence (IITA Strategic grant)Generic• Monitoring programs to prevent the spread of CBSD and EACMV-UG spread CMGV and CBSV diversity and its impact on host resistance• Development of dual resistant cassava varieties www.iita.org
  33. 33. Maize virology 1. Host plant resistance to Maize streak virus 2. Mechanisms of resistance 3. High-throughput phenotyping for MSV • MSV is restricted to only Africa • The most damaging disease of maize in SSA • Annual losses, $120 – 480 million • Breeding for MSV resistance is integral in our programsA Menkir and S HearneM Salaudeen, O Taiwo, A Razaq•DTMA and Core funds www.iita.org
  34. 34. Screening for MSV resistance 6-7 DAS Material selection 1 0 7 60 54 Days after 10 3 48 sowing 42 36 30 14 9-10 DAS Inoculation with leaf hoppers 30 to 50 DASSymptom scoringat weekly intervals 13-14 DAS First symptoms (most genotypes have 3-4 days incubation period) www.iita.org
  35. 35. High-throughput phenotyping for MSVDisease evaluation0 = No infection or escape1 = Most resistant (less than 10% streaks)2 = Resistant (10-25% streaks)3 = Moderately resistant (25-50% streaks)4 = Susceptible (50-75% streaks)5 = Highly susceptible (>75% streaks)Virus quantification in plants by ELISARep # 1 Rep # 2 Rep # 3 Rep # 4 Control line Test line S5 S4 S3 S2 S1 www.iita.org
  36. 36. Good recovery Susceptible Good recovery www.iita.org
  37. 37. Performance of maize genotypes Group A High recovery 5.0 MsvS10 Severity score 4.0 MsvS09 3.0 MsvS18 2.0 MsvS08 1.0 Msv S26 0.0 MsvS07 1 2 3 4 5 6 MsvS12 MsvS04 Weeks Group B MsvS11 MsvS20 5.0 MsvS03 4.0 MsvS17 3.0score Msv S30 2.0 MsvS19 1.0 MsvS02 No recover Group C 0.0 MsvS22 1 2 3 4 5 6 MsvS06 Msv S27 Weeks MsvS01 6.0 MsvS16 MsvS14 5.0 MsvS15Moderate recovery Severity MsvS24 4.0 Msv S28 3.0 MsvS13 2.0 MsvS21 1.0 MsvS23 0.0 1 2 3 4 5 6 Msv S25 Msv S29 Weeks Pool 6 control www.iita.org
  38. 38. Virus concentration vs Severity score 0.80 0.60 Leaf 1ODv values 0.40 leaf 2 Leaf 3 0.20 After 6 weeks 0.00 MX10 MX5 MX3 MX4 6.0 5.0 Week 1 4.0 Week 2 score Week 3 3.0 week 4 2.0 week 5 1.0 week 6 0.0 MX10 MX5 MX3 MX4 Group A B Genotype C D www.iita.org
  39. 39. Recovery mechanism offers protection to MSV 6.0 5.0 4.0 Group A Group B 3.0 Group C 2.0 Pool 6 control 1.0 0.0 1 2 3 4 5 6• No evidence of resistance to leafhopper feeding.• Incubation period is 3-4 days in genotypes evaluated so far• Most genotypes showed recover type resistance (reduction in chlorotic streaks as well as virus concentration)• No indication of symptom remission.• No immunity www.iita.org
  40. 40. MSV resistance in S1 testcrosses • Field experiment for incidence, severity and agronomic performance • 6 S1 crosses were highly resistant to MSV and good agronomic performance. • Resistance is superior to what has been found in MSV transgenics (Shepherd et al., 2007) 80.0 3.5 67.6Disease incidence (%) 70.0 3.0 3 58.3 Disease severity 2.8 60.0 2.5 2.5 50.0 45.0 45.2 2.1 2.0 2.02 Incidence 40.0 1.5 Severity 30.0 20.0 1 10.0 0.5 0.0 0 1WPI WPI3WPI WPI5WPI6WPI WPI8WPI WPI 2 4 7 9 Time (week) Salaudeen et al., 2010 www.iita.org
  41. 41. On-going and future plans• Further characterization of promising lines and release to farmers• Augment resistance to MSV in other backgrounds• Identification of association markers for MSV (DTMA)• Mechanisms of resistance• Host-MSV interactions www.iita.org
  42. 42. Yam virology • Diversity and distribution of viruses infecting yams in West Africa • Characterization of YBSD • Development of diagnostic tools • Symptomology and synergistic interactions • Host resistance • Evaluation of mapping population • Virus-free seed systemsR Asiedu and A SartieO Patricia, R Ronke, M Toually and S Asala,•IFAD and Core funds www.iita.org
  43. 43. Virus reported to infect Dioscorea yams in West Africa Virus Distribution Disease importance Yam mosaic virus Worldwide High (YMV; Potyvirus) Yam mild mosaic virus Worldwide High* (YMMV; Potyvirus) Cucumber mosaic virus Worldwide High* (CMV; Cucumovirus) Dioscorea bacilliform viruses (many Worldwide High* strains and species) (DBV; Badnavirus) Dioscorea sansibarensis bacilliform Benin Not known*** virus (DsBV; Badnavirus) Yam internal brown spot virus Cote d’Ivory, Benin(?), High** (IBSV; Badnavirus*) The Caribbean Dioscorea ring mottle virus Togo Not known*** (DaRMV; Potyvirus) Dioscorea mottle virus Nigeria Not known*** (DMoV; Comovirus?)*Often detected in mixed infection; known to have synergistic effect on symptom expression**Virus-like disease of unknown etiology***Limited information on virus characters www.iita.org
  44. 44. Yam virus diagnostics• Diagnostic tools established for all major yam viruses. -Poly and monoclonal antibodies for Yam mosaic virus, Yam mild mosaic virus, Yam badna viruses available.-Specific and generic primers for PCR/RT-PCR based diagnostics.-Methods for virus detection in tubers established. www.iita.org ©Lava - 09
  45. 45. Yam virus diagnostics & symptomatology• Uneven distribution of viruses in tubers• Variation in symptom expression in plants germinated from the same tuber.• Evidence of synergistic interaction between YMV and YMMV. www.iita.org ©Lava - 09
  46. 46. Evaluation of mapping population Virus indexing Following evaluationSl. AccessionNo. name Genotype details* Tuber Plant 1 TDr 93-2 Resistant to YMV Y ng - 2 TDr 1621 Resistant to YMV Y ng - 3 TDr 1640 Resistant to YMV Y Y Susceptible 4 TDr 89/ 02665 Resistant to YMV Y - - 5 TDr 97/ 00777 Highly susceptible to YMV Y Y, B Susceptible 6 TDr 93-32 Highly susceptible to YMV Y Y Moderately Tolerant (Promising) 7 TDr 95/ 18531 Susceptible to YMV Y Y, B Susceptible 8 TDr 747 Susceptible to YMV Y Y, B Susceptible 9 TDr3661 Susceptible to YMV - Y, B Moderately Tolerant (Promising)10 TDr 2261 Susceptible to YMV Y Y, B Susceptible11 TDr 95-127 No information Y Y, B Susceptible12 TDr 95/ 01932 No information Y ng -13 TDr 99/ 02789 No information Y Y, B Moderate14 TDr 98/ 01317 No information Y Y, B Moderately Tolerant (Promising)15 TDa85/ 00250 Resistant to anthracnose Y,B Y, B Moderately Tolerant (Promising)16 TDa87/ 01091 Resistant to anthracnose Y Y, B Moderately Tolerant (Promising)17 TDa95/ 00328 Susceptible to anthracnose Y, B Y, B Tolerant (Recommended18 TDa95- 310 Susceptible to anthracnose Y, B Y, B Tolerant Recommended19 TDa92- 2 Susceptible to anthracnose Y, B Y, B Susceptible20 TDa98/ 01166 No information Y Y, B Tolerant (Recommended) www.iita.org
  47. 47. Evaluation of mapping population www.iita.org
  48. 48. Yam brown spot disease (YBSD) (Potential CBSD of yam?) • A virus-like disease of unknown etiology recognized in Cote d’Ivory in early 1980s, and in Benin in 2008. • Symptoms are similar to the internal brown spot disease (IBSD) first reported from the Caribbean in mid 1970s. • Loss in tuber quality. • This can emerge as a serious threat.B www.iita.org ©Lava - 09
  49. 49. Studies on IBSD etiology 1 2 31 4 3 2 5 1 2 3 4 5 www.iita.org ©Lava - 09
  50. 50. Studies on IBSD etiology• Wide spread in Cote d’Ivoire• Known for about 40 to 60 years 5 3 4 1 2• Bètè-bètè is highly susceptible Distribution and severity of necrotic symptoms in tuber Tubers sections (mean)* 4 No. No. Percent 1 2 (apico- 3 (median- observed symp* symp* (Top) median) (middle) base) 5 (base) 178 105 60 3.0 3.0 2.8 2.5 2.1 www.iita.org
  51. 51. Phenotyping yams for virus resistance •D. rotundata accessions were evaluated in 2008-09 season. •987 accessions in total (3488 plants)Score:1 = highly resistant (no visible symptoms)2 = resistant (mild mottling/mosaic on few leaves)3 = moderately resistant (mild mottling/mosaic on most leaves)4 = susceptible (severe mottling / mosaic on most leaves)5 = highly susceptible (severe mosaic/mottling, stunting and distortion) www.iita.org
  52. 52. Phenotyping yams for virus resistance Susceptible 5% (Score 4) Resistant 7%Highly susceptible 5% (Score 2) (Score 5) •There is no immunity or very high resistance in these germplasm. N = 987 Moderately resistant 83% (Score 3)Score:1 = highly resistant (no visible symptoms)2 = resistant (mild mottling/mosaic on few leaves)3 = moderately resistant (mild mottling/mosaic on most leaves)4 = susceptible (severe mottling / mosaic on most leaves)5 = highly susceptible (severe mosaic/mottling, stunting and distortion) www.iita.org
  53. 53. Next steps• Determine the diversity of viruses in West Africa and improve diagnostic tools• Understand the etiology of YBSD• Symptomology and yield losses• Evaluation of mapping population for YMV• Virus-free seed systems www.iita.org
  54. 54. Soybean virology • Baseline studies to assess the impact of virus diseases on soybean • Evaluation of improved varieties and breeding lines against widespread/economically important viruses. • Monitor seed stocks and eliminate virus contaminated seed.H Tefera, C Fatokun,T Imbor, R Adesida and P Ogunsanya•TL2 and Core funds www.iita.org
  55. 55. Baseline studies in Nigeria Virus Abbreviation Genus Vectors1 Bean pod mottle BPMV Comovirus Beatles2 Black eye cowpea mosaic BICMV Potyvirus Aphids3 Cowpea aphid-borne mosaic CABMV Potyvirus Aphids4 Cowpea mottle CMeV Carmovirus Beatles5 Cowpea yellow mosaic CYMV Comovirus Beatles6 Cucumber mosaic CMV Cucumovirus Aphids7 Cowpea severe mosaic CpSMV Comovirus Beatles8 Cowpea mild mottle CPMMV Carlavirus Whiteflies9 Southern bean mosaic SBMV Sobemovirus Beatles10 Tobacco streak TSV Nepovirus Nematodes11 Soybean mosaic SMV Potyvirus Aphids12 Soybean chlorotic blotch* SbCBV Begomovirus Whiteflies13 Soybean mild mottle* SbMMV Begomovirus Whiteflies14 Cassava mosaic virus** CMD Begomovirus Whiteflies *New viruses; **New report Ezeri et al., 2009 www.iita.org
  56. 56. www.iita.org
  57. 57. 2.7 2.5 3.4 3.9 3.8 3.3 3.4 3.3 3.7 4.23.2 4.1 3 4.5 4 www.iita.org
  58. 58. Virus incidence in various states 120 100 % infection 80 60 40 20 0 Ba u a A d un a Ka a e yo hi o Ka o a er pl a as CT a gi ea b w n aw nu rn in ar uc Ko ig O ra Ka ra F ts Bo Kw d Be at N am Ta sa N State•Virus incidence exceed 50% in 13 of the 15 states (87%) surveyed www.iita.org
  59. 59. Relative abundance of viruses in Nigeria CpSMV BICMV SMV CpSMV TSV Virus BPMV SBMV CMeV CYMV CMV CABMV CPMMV 0 20 40 60 80 100 120 ProportionImbor et al., 2010 www.iita.org
  60. 60. Relative abundance of viruses in latent infections 0.7 CMeV 1.5 BPMV 1.5 CABMVvirus 2 CYMV 4 TSV 9 CMV CPMMV 99 Total = 166 100 0 20 40 60 80 100 % infection www.iita.org
  61. 61. Distribution of viruses in NigeriaAgro-ecological zone State Viruses present TotalDerived Sav Benue CPMMV,CABMV,CMV,CYMV, SBMV, BPMV, CMeV, TSV, SMV 9 Taraba CPMMV, CMV, CYMV, BPMV, CMeV, TSV,SMV 7 Kogi CPMMV 1 Oyo CPMMV, CMV 2 FCT CPMMV, CMV, BPMV, CMeV, TSV, CpSMV,SMV 7 Nassarawa CPMMV, CMV, BPMV,SMV 4Sud/Sahel/N.G.Sav Katsina CPMMV 1 Kano CPMMV, CABMV, CMV 3 Kaduna CPMMV, CMV, BPMV 3Sud/ South G.Sav Adamawa CPMMV 1 Niger CPMMV 1 Borno CPMMV 1 Kwara CPMMV, CMV 2Mid-Altitude, Sud/D.Sav Plateau CPMMV, CABMV, CMV, BPMV 4 Bauchi CPMMV 1 www.iita.org
  62. 62. New whitefly-transmitted begomoviruses in soybean [Legumoviruses] •Soybean chlorotic blotch virus (SbCBV) •Soybean mild mottle virus (SbMMV) •Begomoviruses (legumogroup) •Novel types within features of both new world and old world begomovirusesAlabi et al., 2010 www.iita.org
  63. 63. Novel features CRA CRB AC4 (2117…2410) AV1 (260…1021) SbCBV SbCBV 2647 bp BV1 2708 bp AC5 BC1 (373…1158) AC1 (701…995) (1219…2310) (1479…2567) AC3 (1018…1431) AC2 (1163…1579) First bipartite legumoviruses that lack AV2 gene; IR V2 (1…507) C4 SbMMV (2198…25) 2768 bp V1 C1 First monopartite legumovirus (299…1072)(1563…2612) C3 (1069…1473) C2 (1187…1624) www.iita.org
  64. 64. 96 AYVV AJ558120 100 CoTSV DQ875869 57 SbCLV AB050781 68 SiYMYuV DQ875873 77 AYVHuV DQ866124 SiGMV AF0841 TbLCYnV AJ512761 80 86 AbMV X15984 ToLCMYV AF327436 ToMHV Y14875 StaLCuV AJ810156 80 EpYVV AB007990 Asia 100 ToMoTV ToMoV AF012301 AY965901 VeYVV AM182232 97 BDMV M88180 81 66 PepLCV AF134484 61 ToLCSinV AJ508783 69 TYLCCNV AJ319675 79 89 CdTV AF101478 ToLCTWV DQ866125 55 95 ToLCVV DQ641705 SiGMCRV X99551 67 AYVSLV AF314144 SiGMHV Y11098 99 92 ChiLCV DQ6759 100 SiYVV Y11100-1 ToLCBDV AF188481 CLCrV AF480941 86 99 AEV AJ437618 DesLDV DQ875871 99 85 CYVMV AJ507777 PYMPV Y15033 99 85 PaLCuV Y15934 100 PYMV D00941 100 ToLCNDV DQ169056 India 73 BGMV TGMV M88687 K02030 100 ICMV Z24758 SLCMV AJ579307 99 SiMMV AJ5573 100 ToRMV AF291706 New World CLCuBV AY7050 55 Old World BYVMV AF241479 97 SiMoV AJ5574 100 OYVMV AJ0021 100 ToYSV DQ336351 100 CLCuGV AF155064 70 BGYMV AF173556 100 100 55 CLCUGV EU024120 MaYMFV AY044136 HoLCrV AY036009 56 MaMPRV AY044134 ACMV X17095 DiYMoV AF170101 TLCuKV EU350585 MeMV AY965899 92 75 TbLCZV AF350330 TYMLCV AY508994 85 ToCSV AF261885 99 PHYVV AY044163 75 88 ToYLCrV AY502935 RhGMV DQ356429 59 ChaYMV AJ223191 100 CabLCuJV DQ178609 66 61 93 OYLCrV EU024119 CabLCuV U65530 76 86 ToLCMLV AY502936 Africa 55 61 PepGMV AY928517 ToLCArV DQ519575 76 RhGMSV DQ6673 100 TYLCMalV AF271234 82 BCaMV AF110190 TYLCMLV FM212660 EuMV DQ3189 97 EACMCV AF112354 CuLCrV AF327559 91 82 EACMV AJ717542 MCLCuV AF4790 75 56 EACMMV AJ0060 97 SLCV M182 SACMV AF155806 100 SMLCV AF421553 100 EACMKV AJ717580 ToCMoV AF491306 97 EACMZV AJ717562 ‘Legumovirus’ CoGMV DQ641689 Africa CPGMV AF029217 100 CoYVV AY727904 SbCBV GQ472985 100 SLCCNV AF509742 100 SbCBV GQ472987 98 SLCPHV AB085794 100 SbMMV GQ472984 100 LYMV AF509798 DoYMV AY309241 ToLCGV AY190291 100 99 KuMV DQ641690 100 ToLCNDV DQ169057 Asia 66 RhYMV FM208848 ICMV Z24759 99 100 MYMIV AY049772 SLCMV AJ579308 100 96 HgYMV AJ627904 ClCMV DQ641693 100 MYMV AJ421642 95 PepLCIV AB2678 CoYVV AY727903 100 100 CoGMV DQ641688 Jute 100 100 TYLCKaV TYLCTHV DQ169055 X63016 DiYMoV AF1168 100 HgYMV AJ627905 100 100 PepGMV AY928516 100 New World 97 MYMV AJ867554 Old World SLCV M183 100 MYMIV AY049771 100 60 BGMV M88686 Americas 99 KuMV DQ641691 BDMV M88179 RhYMV FM208848 56 81 CdTV AF101476 ACMV X17096 100 ToMoV AY965900 100 SbCBV GQ472986 91 SiGMV AF049336 99 100 SbCBV GQ472988 SPLCESV EF6741 WmCSV AJ2653 SPLCGV AF326775 95 EACMCV AF112355 100 SPLCCaV EF6742 100 EACMV AJ704949 99 68 SPLCLaV IYVV EF67 AJ132548 Sweet potato 100 EACMZV AJ704942 100 EACMKV AJ704965 61 100 SPLCV BSCTV AJ586885 U02311 66 SACMV BSCTV www.iita.org AF155807 U02311
  65. 65. Search for resistance to CPMMV TGX 1448-2E TGX1903-1F TGX1951-4E TGX1440-1E TGX1903-3F TGX1954-1F TGX1485-ID TGX1904-4F TGX1955-4F TGX1740-2F TGX1904-6F TGX1956-1F TGX1830-20E TGX1908-8F TGX1961-1F TGX1835-10E TGX1910-14F TGX1963-3F TGX1844-18E TGX1932-1F TGX1965-7F TGX1844-4E TGX1935-3F TGX1971-1F TGX1869-31E TGX1937-1F TGX1972-1F TGX1871-12F TGX1945-1F TGX1987-10F TGX1876-4E TGX1949-7F TGX1987-14F TGX1889-12F TGX1950-7F TGX1987-43F TGX1895-33F TGX1951- 3F TGX1987-57F TGX1895-50F TGX1987-62F TGX1987-8F •47 elite lines evaluated in screenhouse •No immunity, variation in susceptibility •Activity in progress www.iita.org
  66. 66. Soybean reaction to CPMMV 250 200No. of seeds 150 100 50 0 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 Control Accessions (8 plants per accession) Susceptible check www.iita.org
  67. 67. Disease of unknown etiology • Virus-like disease of unknown etiology. • Extreme reduction in leaf lamina, stunting of plant and thickening of stems. • African soybean dwarf? www.iita.org
  68. 68. New soybean disease in Southern Africa•Incidence of soybean phyllody was high in Mozambique (15-25%)Virus disease incidence was very low in Southern Africa•Low incidence•CPMMV and SMV detected in few fields www.iita.org
  69. 69. Next steps• Evaluation of soybean genotypes for resistance to abundant viruses (CPMMV, SMV, CMV, BPMV, CABMV)• Characterization of soybean phyllody• Diagnostics for common soybean viruses• Characterization of new soybean infecting viruses www.iita.org
  70. 70. Cowpea virology Focus: • Evaluation of germplasm (landraces / improved varieties) for resistance to viruses [adding value to drought and striga resistance; earliness etc.] • Breeding for multiple virus resistance • Establishment of virus-free cowpea seed stocksC Fatokun, B OusmanK Ogunsola, R Adesida, P OgunsanyaCore and TL2 www.iita.org
  71. 71. Important viruses of cowpea in West Africa Virus Abbreviation Genus Vector1 Blackeye cowpea mosaic BlCMV Potyvirus Aphids2 Cowpea aphid-borne mosaic CABMV Potyvirus Aphids3 Cucumber mosaic CMV Cucumovirus Aphids4 Cowpea mottle CMeV Carmovirus Beetles5 Cowpea mosaic CPMV Comovirus Beetles6 Southern bean mosaic SBMV Sobemovirus Beetles7 Cowpea mild mottle CMMV Carlavirus Whiteflies *All these viruses are seed transmitted Viruses of minor importance (sporadic incidence): Bean pod mottle virus; Peanut mottle; Sunn-hemp mosaic; Cowpea golden mosaic; Cowpea severe mosaic virus www.iita.org
  72. 72. Distribution of cowpea infecting viruses in West Africa in 2008 www.iita.org
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×