Detection and characterization of plant viruses on major food crops in togo (West Africa)
Upcoming SlideShare
Loading in...5
×
 

Detection and characterization of plant viruses on major food crops in togo (West Africa)

on

  • 2,016 views

PLANT VIRUSES DIAGNOSTIC TECHNIQUES,COLLABORATIVE PROJECTS ON:COWPEA VIRUSES,CASSAVA BEGOMOVIRUSES. OTHER PLANT VIRUSES UNDER STUDIES

PLANT VIRUSES DIAGNOSTIC TECHNIQUES,COLLABORATIVE PROJECTS ON:COWPEA VIRUSES,CASSAVA BEGOMOVIRUSES. OTHER PLANT VIRUSES UNDER STUDIES

Statistics

Views

Total Views
2,016
Views on SlideShare
2,016
Embed Views
0

Actions

Likes
0
Downloads
32
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

CC Attribution-NonCommercial LicenseCC Attribution-NonCommercial License

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Detection and characterization of plant viruses on major food crops in togo (West Africa) Detection and characterization of plant viruses on major food crops in togo (West Africa) Presentation Transcript

  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA). Y. Mawuena Dieudonné GUMEDZOE , Professor, Director of Research University of Lome/ Faculty of Agriculture/ Plant Virology & Biotechnology Lab (LVBV). B.P.1515 LOME TOGO FAX (228) 2218595 E-mail : [email_address] Member of the academies: AAS, TWAS
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • SEMINAR PRESENTED AT
    • IITA
    • IBADAN, NIGERIA
    • 16th MAY 2008
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • MAIN HEADLINES
    • `I. INTRODUCTION
    • `II. LVBV AND OBJECTIVES
    • `III.PLANT VIRUSES DIAGNOSTIC TECHNIQUES
    • `IV. COLLABORATIVE PROJECTS ON:
    • COWPEA VIRUSES
    • CASSAVA BEGOMOVIRUSES
    • `V. OTHER PLANT VIRUSES UNDER STUDIES
    • `VI. CONCLUSION AND PERSPECTIVES
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • I. INTRODUCTION (1)
    • PLANT VIRUSES :
    • DEFINITION :
    • Submicroscopic,
    • `intracellular particles and
    • `obligate parasites consisting
    • `of nucleic acid and protein.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • I. INTRODUCTION (2)
    • ECONOMIC IMPORTANCE :
    • 1) Responsible of major
    • diseases and significant
    • economic losses to
    • several agricultural and
    • horticultural crops
    • around the world .
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • I. INTRODUCTION (3)
    • ECONOMIC IMPORTANCE
    • 2) IN AFRICA VIRUS DISEASES OF CROPS RANK SECOND AFTER FUNGI
    • CONTROL MEASURES
    • NO DIRECT CHEMICAL METHODS AVAILABLE TO CONTROL THEM
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • II. LVBV AND OBJECTIVES(1)
    • LVBV: The Plant Virology and Biotechnology Laboratory, 1987, with the following objectives:
    • Develop diagnostic tools for the identification of plant pathogens especially plant viruses
    • Detect, identify and characterize plant viruses in Togo and elsewhere in Africa
    • Train students (MSc. and Ph.D levels) and technicians in plant pathology and biotechnology
      • Establish collaboration with other research centers working in the same fields.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • II. LVBV AND OBJECTIVES(2) DURING THIS SEMINAR ARE:
    • TO PRESENT RESULTS OBTAINED ON THE IDENTIFICATION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO USING A COLLABORATIVE APPROACH ,
    • THE LESSONS LEARNT FROM THIS COLLABORATIVE APPROACH,
    • THE NEED FOR CONCERTED EFFORTS AMONG SCIENTISTS, IN ORDER TO FULLY EXPLOIT THE EXISTING EXPERTISE, KNOWLEDGE, FACILITIES, AND OPPORTUNITIES.
  • DETECTION AND CHARACTERIZATION PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO.
    • III. PLANT VIRUSES DIAGNOSTIC TECHNIQUES(1)
    • TWO BROAD CATEGORIES :
    • A) BIOLOGICAL STUDIES
    • SYMPTOMATOLOGY
    • TRANSMISSION TESTS
    • B) INTRINSIC PROPERTIES OF VIRUS PARTICLES;
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • III. VIRUSES DIAGNOSTIC TECHNIQUES (2)
    • B) INTRINSIC PROPERTIES OF VIRUS PARTICLES
    • ELECTRON MICROSCOPY
  • DETECTION AND CHARACTERIZATION PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO.
    • III. DIAGNOSTIC TECHNIQUES (3)
    • SEROLOGICAL AND MOLECULAR TECHNIQUES
    • (COAT PROTEIN AND NUCLEIC ACID)
    • COAT PROTEIN (SEROLOGICAL TESTS)
    DOUBLE DIFFUSION IN GEL ELISA TEST
  •   1. Coating ELISA plates with appropriate dilute antisera 2. Puting Antigens in place (Crushing samples in buffer and use the extracts) 3. Add conjugated antisera 4. Add susbtrat and stop the reaction when the yellow color appears III. DIAGNOSTIC TECHNIQUES(4) DIFFERENTS STEPS OF THE DAS-ELISA TEST Healthy Samples Infected Samples DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
  • DETECTION AND CHARACTERIZATION PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO.
    • III.DIAGNOSTIC TECHNIQUES(5)
    • MOLECULAR TESTS
    • `(VIRAL NUCLEIC ACID) DOT-BLOT /
    • `HYBRIDISATION ASSAYS /
    • `PCR (amplification of specific
    • `DNA Fragments )
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO. PLANT VIRUSES : DETECTION AND CHARACTERIZATION WHY ? FIRST STEPS FOR EPIDEMIOLOGICAL STUDIES IN ORDER TO DEVELOP STRATEGY TO CONTROL THEM. DIFFICULTIES : MORE DIFFICULT TO IDENTIFY AND CHARACTERIZE THAN OTHER PLANT PATHOGENS, REQUIRED ELABORATE AND EXPENSIVE EQUIPMENT AND REAGENTS , LACK OF EXPERTISE, INADEQUATE FUNDING AND FACILITIES IN SSA COUNTRIES.   III. DIAGNOSTIC TECHNIQUES(6) WHY IS IT SO IMPORTANT TO DETECT AND CHARACTERIZE PLANT VIRUSES ? 1) They represent the first steps for epidemiological studies in order to develop control measures 2) During diseases surveys rapid diagnosis is needed 3) Important for plant quarantine and seed certification and also for plant breedimg programmes 4)Detection and characterization represent a vital task for plant virologists working in SSA countries.
  • DETECTION AND CHARACTERIZATION PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO. PLANT VIRUSES : DETECTION AND CHARACTERIZATION WHY ? FIRST STEPS FOR EPIDEMIOLOGICAL STUDIES IN ORDER TO DEVELOP STRATEGY TO CONTROL THEM. DIFFICULTIES : MORE DIFFICULT TO IDENTIFY AND CHARACTERIZE THAN OTHER PLANT PATHOGENS, REQUIRED ELABORATE AND EXPENSIVE EQUIPMENT AND REAGENTS , LACK OF EXPERTISE, INADEQUATE FUNDING AND FACILITIES IN SSA COUNTRIES.   III.DIAGNOSTIC TECHNIQUES(5bis) DIFFICULTIES ENCOUNTERED DURING PLANT VIRUSES DETECTION / CHARACTERIZATION ? 1) Plants viruses are more difficult to identify than other plant pathogens 2) They require elaborate and expensive equipments and reagents 3) In most SSA countries there is a lack of critical scientific expertise 4) Inadequate research funding 5) Research facilities and other items (irregular power and water supplies) are not always available.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • III. DIAGNOSTIC TECHNIQUES(7)
    • 1 ) DETECTION AND CHARACTERIZATION PLAY A CRITICAL ROLE IN THE MANAGEMENT OF THESE VIRUS DISEASES
    • 2) THEY REQUIRE DIFFERENT METHODS (BIOLOGICAL, SEROLOGICAL AND MOLECULAR TECHNIQUES) WHICH ARE NOT ALWAYS AVAILABLE IN MOST SSA COUNTRIES THEREFORE WE NEED TO JOINT OUR EFFORTS TOGETHER IN COLLABORATIVE PROJECTS
  •   DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO IV. COLLABORATIVE PROJECTS(1) We are reporting here the results obtained during two collaborative projects: 1) A PILOT PROJECT ON COWPEA VIRUSES IDENTIFICATION WHICH HAVE INVOLVED SCIENTISTS FROM DEVELOPED AND DEVELOPING COUNTRIES AND ONE CENTRE OF CGIAR) (IITA).
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • IV. COLLABORATIVE PROJECTS(2)
    • IDENTIFICATION AND CHARACTERIZATION OF CASSAVA BEGOMOVIRUSES INVOLVING OUR LABORATORY AND TWO PARTNERS (CIRAD-BIOS AND IITA)
  •   DETECTION AND CHARACTERIZATION PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO.
    • IV. COLLABORATIVE PROJECTS(3)
    • COWPEA VIRUSES IDENTIFICATION
    • A) OBJECTIVES OF THE PROJECT
    • 1) TO MAKE AVAILABLE
    • SEROLOGICAL DIAGNOSTIC
    • TESTS FOR NARS .
    • 2) PRODUCE ANTISERA (POLY-AND MONOCLONAL
    • TO BlCMV AND CAMV (POTY)
    • 3) DEVELOP SEROLOGICAL STANDARDIZED DIAGNOSTIC TOOLS (COWPEA VIRUSES ).
    • 4) SHARE EXPERIENCES IDEAS AND MATERIALS AMONGST SCIENTISTS.
    • EXTEND TO OTHER PLANT VIRUSES.
  •   DETECTION AND CHARACTERIZATION PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO. IV COLLABORATIVE PROJECTS(4) B) ANTISERA AND PLANT MATERIALS USED DURING OUR STUDIES WERE FROM VRS OR IITA . C) METHODS 1)SURVEYS FOLIAR SAMPLES COLLECTED THROUGHOUT THE COUNTRY ON COWPEAS AND WEEDS (FARMERS’FIELDS/ EXPERIMENTAL PLOTS). 2) IDENTIFICATION OF VIRUSES SEROLOGY (DOUBLE DIFFUSION IN AGAROSE, ELISA AND PCR).
  •   DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
    • IV. COLLABORATIVE PROJECTS(5)
    • D) RESULTS
    • IDENTIFICATION OF VIRUSES
    • 63.12 % samples reacted to serological tests. Cowpea viruses (6) detected and present in various agro-ecological zones :
    • - BlCMV(Potyvirus)(serotypes)
    • - CAMV (Potyvirus)(serotypes)
    • - CMeV (Carmovirus)
    • - CMMV (Carlavirus)
    • - CPMV (Comovirus)
    • - SBMV-CS (Sobemovirus)
      • CPMV (WIDESPREAD).
      • MIXED INFECTIONS .
  •   DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO IV. COLLABORATIVE PROJECTS : COWPEA VIRUSES(6) D) RESULTS (continued) BlCMV/ CAMV and their serotypes were identified on cowpea/ weeds. Acanthospermum hispidum ( serotypes F, G / CAMV B / BlCMV) Cassia occidentalis ( serotypes A,B/ BlCMV ) Passiflora foetida ( serotypes C,D/ CAMV ) Desmodium tortuosum ( serotypes C,D/CAMV ) Abutilon mauritianum ( serotypes C, E/CAMV ) Centrosema pubescens (serotypes C,F,G/ CAMV) Pupalia lappacea (serotypes: C,D,E,F/CAMV ).
    • IV. COLLABORATIVE PROJECTS (7)
    • 2) REACTIONS OF COWPEA CULTIVARS AND
      • OTHER PLANT SPECIES TO COWPEA VIRUSES :
    • SCREENING OF COWPEA CULTIVARS USING CLONED VIRUS ISOLATES OF CAMV, CPMV, CMeV AND SBMV REVEALED THAT THE FOLLOWING COWPEA CULTIVARS WERE RESISTANT : IT82E-32, IT83S-818, TVX1850-01E, TVU410 AND TVU 645 .
    • THE USE OF THESE RESISTANT COWPEA CULTIVARS COULD REDUCE LOSSES CAUSED BY THESE VIRUSES IN COWPEA GROWING AREAS.
    DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • IV COLLABORATIVE PROJECTS(8)
    • CASSAVA BEGOMOVIRUSES IDENTIFICATION
    • Objectives
    • 1) TO MAKE AVAILABLE SEROLOGICAL
    • DIAGNOSTIC TESTS FOR NARS
    • 2) TO IDENTIFY AND CHARACTERIZE CASSAVA BEGOMOVIRUSES IN TOGO AND ELSEWHERE IN AFRICA (BY USING TAS-ELISA WITH MONOCLONAL AND POLYCLONAL ANTIBODIES, AND PCR)
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • IV. COLLABORATIVE PROJECTS (9)
    • Cassava Begomoviruses
    • A) Objectives continued)
    • 3) Analysis of taxonomic identity of the different components of these Begomoviruses (using PCR and sequencing) which will give insight into the genetic drift within these virus population in Togo.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • IV. COLLABORATIVE PROJECTS(10)
    • A) Objectives(continued)
    • 4) Develop strategies to control these Cassava Begomoviruses (by using all available technologies),
    • 5) Screen cassava cultivars and select which of them are resistant to these viruses.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
    • IV. COLLABORATIVE PROJECTS (11)
    • B) Materials and Methods
    • Plant materials, antisera, primers, reagents and virus isolates :
    • Provided by our lab or by our partners(Dr Schoenfelder, DSMZ GERMANY and Dr PETERSCHMITT, CIRAD-BIOS, France), or bought from different manufacturers
    • Reference sequences of the Begomoviruses CP gene are from GenBank databases.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO IV. COLLABORATIVE PROJECTS/ CASSAVA VIRUSES(12) TABLEAU 2 LIST OF POSITIVE CONTROLS USED Reference number DSMZ Origin Description PV-0421 Kenya ACMV-NG, Cassava infected leaves PV-0423 Kenya EACMV, Cassava infected leaves PV-0424 Sri Lanka ICMV, cassava infected leaves PV-0872/Ca-161 Cameroun EACMV, Cassava infected leaves
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
    • IV. COLLABORATIVE PROJECTS (13)
    • B) Materials and Methods
    • 2) Surveys
    • Cassava and weeds foliar samples (showing mosaic or mottling symptoms ) were collected from farmers’ fields and experimental plots in major cassava production areas in Togo .
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
    • IV. COLLABORATIVE PROJECTS (14)
    • B) Materials and Methods
    • 3) Identification of cassava Begomoviruses
    • The diagnosis of the three cassava Begomoviruses (ACMV, EACMV and ICMV) was performed by using:
    • -Serological test (TAS-ELISA) with monoclonal and polyclonal antibodies
    • PCR with specific primers (as designed by Fauquet et al.2000 and 2001) targeting the coat protein.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA) IV. COLLABORATIVE PROJECTS/CASSAVA VIRUSES(15) TABLEAU1 : SPECIFIC PRIMERS USED FOR THE IDENTIFICATION OF ACMV, EACMV, AND ICMV PRIMER SEQUENCE(5’ 3’) TARGET REGION JSP001 ATGTCGAAGCGACCAGGAGAT 5’ACMV/ EACMV CP JSP002 TGTTTATTAATTGCCAATACT 3’ACMV CP JSP003 CCTTTATTA ATT TGTCACTGC 3’EACMVCP JSP012 GTCCATATAGGTAARGTNATG 5’ICMV CP JSP013 CCTGCTCCTTGCTNGCYTART 3’ICMV CP
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
    • IV. COLLABORATIVE PROJECTS (16)
    • B) Materials and Methods
    • 3) Identification of cassava Begomoviruses (continued)
    • Specific Primers are as follows:
    • JSP001/JSP002 for ACMV
    • JSP001/JSP003 for EACMV
    • JSP012/JSP013 for ICMV
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
    • IV. COLLABORATIVE PROJECTS (17)
    • B) Materials and Methods (continued)
    • 4) Study of the molecular variability of cassava Begomoviruses
    • Sequencing: 52 and 62 isolates respectively of ACMV and EACMV were sequenced and partial sequences of ICMV isolates were obtained and compared with sequences from the GenBank databases and included in a phylogenetic analysis.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
    • IV. COLLABORATIVE PROJECTS (18)
    • C) Results
    • Molecular analysis by PCR of cassava foliar
    • samples using specific primers revealed that
    • ACMV (incidence rate of 73,59%) is not the only Begomoviruses occurring in Togo.
    • Two other Begomoviruses are also present, EACMV and ICMV with incidence rates of 44,62 and 4,01 respectively .
    • Mixed infections were also recorded (ACMV+EACMV/39.45%; ACMV+ICMV/1.72% and EACMV+ICMV/1.29%)
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
    • IV. COLLABORATIVE PROJECTS (19)
    • C) Results (continued)
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
    • IV. COLLABORATIVE PROJECTS (20)
    • C) Results (continued)
    • Identification of ACMV by PCR
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO IV. COLLABORATIVE PROJECTS /Cassava Viruses (21) C) RESULTS (CONTINUED) IDENTIFICATION OF ICMV BY PCR
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO. TABLE NUCLEOTIDE SEQUENCE OF PAIRWISE COMPARISON OF EACMV/ICMV FROM GENBANK AND EU155147, EU1551478,EU155149 (EACMV) AND EU152125 (ICMV)FROM TOGO . (22) 92 61 61 61 ICMV EU152125 67 80 81 81 EACMV EU155149 71 96 96 96 EACMV EU155148 72 93 93 93 EACMV EU155147 ICMV AJ314739 Sri Lanka EACMV AY562424 Kenya EACMV AJ717534 Kenya EACMV AF423178 Uganda EACMV/ ICMV-TG
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO `IV.COLLABORATIVE `PROJECTS (23)/ ``C) Results `(continued) `Cassava `Viruses `: Distribution `of `cassava/ `Begomoviruse``s in Togo.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
    • IV.COLLABORATIVE PROJECTS (24)
    • D) LESSONS LEARNT FROM THESE COLLABORATIVE PROECTS
    • 1 ) ANTIBODIES PRODUCED, DISTRIBUTED TO COLLABORATORS
    • 2) USE OF STANDARDIZED SEROLOGICAL TESTS
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO
    • IV.COLLABORATIVE PROJECTS (25)
    • D ) LESSONS LEARNT FROM THESE COLLABORATIVE PROECTS (continued)
    • 3) WORKSHOPS (EXCHANGE OF IDEAS AND EXPERIENCES) AND TRAINING OF STUDENTS,
    • 4) COLLABORATIVE APPROACH EXTENDED (FOOD CROPS VIRUSES )
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO IV. COLLABORATIVE PROJECTS D) LESSONS LEARNT FROM THESE PROJECTS(cont.)(26) 5) NETWORKING SCIENTISTS, CGIAR CENTRES, DEVELOPED,DEVELOPPING COUNTRIES. 6) KEY OF SUCCESS CGIAR centres NARS(universities, research centres in developing countries ) NARS (developed countries ) 7) OTHER COLLABORATIVE PROJECTS ON PLANT VIRUSES DETECTION / CHARACTERIZATION a) Cassava Begomoviruses (Fargette et al.1985, 1988) b) TSWV (CHO et al. 1989)
  • V. OTHER PLANT VIRUSES UNDER STUDIES IN OUR LAB 1) RICE RICE YELLOW MOTTLE VIRUS (RYMV) 2) TOMATOES TOMV, TSWV AND TYLCV 3) YAM POTYVIRUSES YAM MOSAIC VIRUS (YMV) AND YAM MILD MOSAIC VIRUS (YMMV) IDENTIFIED DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO YMV RYMV
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • VI. CONCLUSION AND PERSPECTIVES
    • A) CONCLUSION (1)
    • Plant viruses are important economically in developing countries that are heavily dependent on agricultural production for food security, employment and export earnings,
    • These viruses affect numerous crops in the tropics causing losses that are usually substantial and sometimes devastating,
    • Their identification and characterization represent a vital task for plant virologists working in tropical regions before developing any strategy to control them.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • VI. CONCLUSION AND PERSPECTIVES
    • A) CONCLUSION (2)
    • The Plant Virology and Biotechnology Laboratory LVBV, in the frame of its objectives has detected and identified various viruses on the following crops:
    • Cowpeas: Six viruses identified and their geagraphic distribution established.
    • Screening tests revealed cowpea cultivars resistant to them (their use could reduce losses).
    • Cassava: Using TAS-ELISA and PCR, three Begomoviruses, ACMV, EACMV and ICMV were detected and characterized and their geographic distribution established.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • VI.CONCLUSION AND PERSPECTIVES
    • CONCLUSION (3)
    • Rice: Among major rice viruses identified throughout the world, only RYMV was identified so far in Togo
    • Tomatoes: The following viruses were detected, ToMV, TSWV and TYLCV
    • Yams: YMV and YMMV were identified.
    • Mixed infections were identified with various
    • combinations of these viruses .
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • VI.CONCLUSION AND PERSPECTIVES
    • B) PESRSPECTIVES(4)
    • Identification and molecular characterization of viruses infecting cowpea, cassava, rice tomatoes and yams should continue with our partners,
    • Screening plant cultivars resistant to the viruses under studies
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • VI.CONCLUSION AND PERSPECTIVES
    • B) PESRSPECTIVES (5)
    • Lessons learnt from collaborative project bring us to the conclusion that we emphasised on concerted efforts to fully exploit the existing expertise, knowledge, facilities and opportunities,
    • We appealing for networking existing laboratories and by creating centres of excellence in plant virology, biotechnology in Africa .
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA)
      •   ACKNOWLEDGEMENTS
      • THE DIRECTOR GENERAL OF IITA
      • DRS BANDYOPADHYAY, RANAJIT , BI VROH ; AND THEIR COLLABORATORS
      • THE ORGANISERS OF THIS SEMINAR
    • ALL THE IITA STAFF IN THEIR DIFFERENTS COMPONENTS
      • ALL MY FRIENDS AND COLLEAGUES AND
      • MRS MARTINE ZANDJANAKOU
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • VI.CONCLUSION AND PERSPECTIVES
    • B) PERSPECTIVES(6)
    • We are involved in the training of students (MSc. and Ph.D; levels) and it is important to consider the following as high priorities :
    • Capacity building in plant virology, biotechnology and molecular biology,
    • Funding, Equipment and better environment for research activities.
    MERCI DE VOTRE AIMABLE ATTENTION THANK YOU FOR YOUR ATTENTION
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • VI.CONCLUSION AND PERSPECTIVES
    • B) PESRSPECTIVES(4 )
    • Identification and molecular characterization of viruses infecting cowpea, cassava, rice tomatoes and yams should continue with our partners,
    • Screening plant cultivars resistant to the viruses under studies
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • VI.CONCLUSION AND PERSPECTIVES
    • CONCLUSION (3)
    • Rice: Among major rice viruses identified throughout the world, only RYMV was identified so far in Togo
    • Tomatoes: The following viruses were detected, ToMV, TSWV and TYLCV
    • Yams: YMV and YMMV were identified.
    • Mixed infections were identified with various
    • combinations of these viruses .
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • VI.CONCLUSION AND PERSPECTIVES
    • B) PESRSPECTIVES (5)
    • Lessons learnt from collaborative project bring us to the conclusion that the emphasis should put on concerted efforts to fully exploit the existing expertise, knowledge, facilities and opportunities,
    • We are appealing for networking existing laboratories and by creating centres of excellence in plant virology, biotechnology in Africa.
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA)
      •   ACKNOWLEDGEMENTS
      • THE DIRECTOR GENERAL OF IITA
      • DRS BANDYOPADHYAY, RANAJIT , BI VROH ; AND THEIR COLLABORATORS
      • THE ORGANISERS OF THIS SEMINAR
    • ALL THE IITA STAFF IN THEIR DIFFERENTS COMPONENTS
      • ALL MY FRIENDS AND COLLEAGUES AT IITA AND
      • MRS MARTINE ZANDJANAKOU
  • DETECTION AND CHARACTERIZATION OF PLANT VIRUSES ON MAJOR FOOD CROPS IN TOGO (WEST AFRICA).
    • VI.CONCLUSION AND PERSPECTIVES
    • B) PERSPECTIVES(6)
    • We are involved in the training of students (MSc. and Ph.D; levels) and it is important to consider the following as high priorities :
    • Capacity building in plant virology, biotechnology and molecular biology,
    • Funding, Equipment and better environment for research activities.
    MERCI DE VOTRE AIMABLE ATTENTION THANK YOU FOR YOUR ATTENTION