+PatologiaInfecção HPV                                               Hugo Sousa                                         BS...
+    Características Gerais
+    Vírus do Papiloma Humano (HPV)    Características Gerais       Vírus com distribuição ubíqua           Independente...
+    Vírus do Papiloma Humano (HPV)    Características Gerais       Descritos quase 200 tipos de HPV
+    Vírus do Papiloma Humano (HPV)    Características Gerais       Família Papillomaviridae       Estrutura icosaédrica...
+    Vírus do Papiloma Humano (HPV)    Características Gerais       Vírus de DNA cadeia dupla           Genoma com 8000p...
+    Vírus do Papiloma Humano (HPV)    Características Gerais    GENE   FUNCTION    E1     DNA-dependent ATPase, ATP depen...
+    Vírus do Papiloma Humano (HPV)    Características Gerais       Baixo-Risco:           HPV6,  11, 13, 40, 42, 43, 44...
+     Vírus do Papiloma Humano (HPV)     Características Gerais    HPV-associated diseases                              HP...
+    Vírus do Papiloma Humano (HPV)    Características Gerais       Baixo-Risco:           HPV6,  11, 13, 40, 42, 43, 44...
+    Vírus do Papiloma Humano (HPV)    Características Gerais       Baixo-Risco:           HPV6,  11, 13, 40, 42, 43, 44...
+    Vírus do Papiloma Humano (HPV)    Características Gerais       Baixo-Risco:           HPV6,  11, 13, 40, 42, 43, 44...
+    Vírus do Papiloma Humano (HPV)    Características Gerais       Alto-Risco           HPV16,  18, 31, 33, 35, 39, 45,...
+    Vírus do Papiloma Humano (HPV)    Características GeraisYearly Incidence Counts of HPV-Associated Cancers in the Unit...
+    Infecção
+    Vírus do Papiloma Humano (HPV)    Infecção       Infecção Basal       Activação Replicação viral           E1, E2,...
+    Vírus do Papiloma Humano (HPV)    Infecção       Infecção Basal       Activação Replicação viral           E1, E2,...
+    Vírus do Papiloma Humano (HPV)    Infecção
+    Mecanismo de Carcinogénese
+    Vírus do Papiloma Humano (HPV)    Mecanismo de Carcinogénese    Major Events    Escape   à Resposta Imunológica    ...
+    Vírus do Papiloma Humano (HPV)    Mecanismo de Carcinogénese
+    Vírus do Papiloma Humano (HPV)    Mecanismo de Carcinogénese
+    Vírus do Papiloma Humano (HPV)    Mecanismo de Carcinogénese    Integração Viral    DNA    Episomal: expressão de E2...
+    Vírus do Papiloma Humano (HPV)    Mecanismo de Carcinogénese
+    Vírus do Papiloma Humano (HPV)    Mecanismo de Carcinogénese – E6                                      Moody and Laim...
+    Vírus do Papiloma Humano (HPV)    Mecanismo de Carcinogénese – E7                                      Moody and Laim...
+    Vírus do Papiloma Humano (HPV)    Mecanismo de Carcinogénese
+    Vírus do Papiloma Humano (HPV)    Mecanismo de Carcinogénese
+    CANCRO COLO DO ÚTERO
+    Cancro do Colo do Útero
+    Cancro do Colo do Útero    Distribuição Mundial
+    Cancro do Colo do Útero    Distribuição Mundial
+    Cancro do Colo do Útero    Em Portugal       4ª neoplasia na mulher       Neoplasia urogenital       Alta taxas:  ...
+    Cancro do Colo do Útero    Etiologia       1842 – A culpa era da profissão…       1901 – A culpa era da religião…  ...
+    Cancro do Colo do Útero    Etiologia       1980’s – Associação com HPV       Infecção por HPV é um factor        ne...
+    Cancro do Colo do Útero    Patologia       Desenvolvimento de Lesões Precursoras que podem evoluir para Cancro      ...
+    Cancro do Colo do Útero    Patologia       Colo Útero Normal Normal                                   Histologia    ...
+    Cancro do Colo do Útero    Patologia       CIN 1                       Histologia                       Citologia
+    Cancro do Colo do Útero    Patologia       CIN 2                       Histologia                       Citologia
+    Cancro do Colo do Útero    Patologia       CIN 3                       Histologia                       Citologia
+    Cancro do Colo do Útero    Patologia       Carcinoma In Situ                            Histologia                  ...
+    Cancro do Colo do Útero    Patologia       Carcinoma Invasor                            Histologia                  ...
+    Cancro do Colo do Útero    Patologia       Carcinoma Invasor
+    Métodos de Diagnóstico
+    Diagnóstico Infecção HPV    Métodos       Métodos Indirectos           Colposcopia           Teste Papanicolau…   ...
+    Diagnóstico Infecção HPV    Métodos
+    Diagnóstico Indirecto
+    Diagnóstico Indirecto    Colposcopia, Papanicolau…       Teste do Papanicolau           Detecta células com alteraç...
+    Diagnóstico Indirecto    Colposcopia, Papanicolau…       Teste do Papanicolau           Detecta células com alteraç...
+    Técnicas Amplificação
+    Técnicas Amplificação    PCR Assays       Amplificação de um fragmento de DNA especifico;       Amplificação atravé...
+    Técnicas Amplificação    PCR Assays       Small portion of genome targeted           Allows testing of samples with...
+    Técnicas Amplificação    PCR Assays
+    Técnicas Amplificação    PCR AssaysFig. 1. Outline of the HPV-DNA genome, presented in a linear form. The position of...
+    Técnicas Amplificação    PCR Assays       Primers           MY09: 5´- CGT CCM ARR GGA WAC TGA TC – 3´           MY...
+    Técnicas Amplificação    Genotipagem    RFLP (Restriction Fragment Length Polymorphism)    Análise   de polimorfismo...
+    Técnicas Amplificação    Genotipagem
+    Técnicas Amplificação    Genotipagem                                                                   Baixo-Risco   ...
+    Técnicas Amplificação    Genotipagem
+    Técnicas de Hibridização
+    Técnicas de Hibridização       Alvo – DNA ou RNA       Utilização de sondas        específicas       Possibilidade...
+    Técnicas de Hibridização    Captura Híbrida    Principio da técnica    Hibridização de Ácidos Nucleicos    Amplific...
+    Técnicas de Hibridização    Captura Híbrida      45 minutes        at 65ºC      60 minutes        at 65ºC            ...
+    Técnicas de Hibridização    Southern Blot
+    Técnicas de Hibridização    Hibridização em Tiras
+    Técnicas de Hibridização    CHIPs       Tubos ou lâminas com sondas        específicas para cada subtipo;       Tip...
+    Técnicas de Hibridização    CHIPs
+    Técnicas de Hibridização    CHIPs       56        18          66        16
+    Casos Clínicos
+    Caso Clínico #1       História Clínica         37 anos         Sexo feminino         Divorciada         2 filhos...
+    Caso Clínico #1       História Clínica                      Diagnósticos Diferenciais         37 anos             ...
+    Caso Clínico #1       Citologia           Células atípicas            Lesão baixo grau                             ...
+    Caso Clínico #2       História Clínica           8 anos           Sexo masculino       Sinais e Sintomas        ...
+    Caso Clínico #2       História Clínica                       Diagnósticos Diferenciais           8 anos           ...
+    Caso Clínico #2       Sangue – Biologia Molecular           DNA CMV neg           DNA RSV neg           RNA InfA,...
+    Prevenção
Como se pode prevenir? Castidade!?!?!? Abstinência sexual !?!?!? Monogamia !?!?!?
Como se pode prevenir? Uso de Preservativo  É a medida mais eficaz para prevenir DST e travar a sua disseminação, mas não...
Como se pode prevenir? Teste do Papanicolau... Rastreio  o   Detecta células com alterações                              ...
Como se pode prevenir?Vacinas profiláticas oferecem grandes promessas no futuro… Merck® (Gardasil™)  Vacina tetravalente ...
Como se pode prevenir?Vacinas profiláticas em Portugal•Vacina integrada no Programa Nacional de Vacinação(Despacho n.º 837...
+PatologiaInfecção HPV                                               Hugo Sousa                                         BS...
Upcoming SlideShare
Loading in...5
×

Patologia hpv

3,532

Published on

0 Comments
3 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
3,532
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
122
Comments
0
Likes
3
Embeds 0
No embeds

No notes for slide

Patologia hpv

  1. 1. +PatologiaInfecção HPV Hugo Sousa BScH Microbiology MSc Oncology PhD Biomedical Sciences MD Student _________________________________________ Serviço Virologia – Lab Biologia Molecular Grupo Oncologia Molecular IPO Porto FG EPE
  2. 2. + Características Gerais
  3. 3. + Vírus do Papiloma Humano (HPV) Características Gerais  Vírus com distribuição ubíqua  Independentemente do género, idade, etnia ou localização geográfica  Vírus epitelio-mucosotrópico  Infecta células epiteliais e mucosas
  4. 4. + Vírus do Papiloma Humano (HPV) Características Gerais  Descritos quase 200 tipos de HPV
  5. 5. + Vírus do Papiloma Humano (HPV) Características Gerais  Família Papillomaviridae  Estrutura icosaédrica ( 55nm)
  6. 6. + Vírus do Papiloma Humano (HPV) Características Gerais  Vírus de DNA cadeia dupla  Genoma com 8000pb  positivo  2 genes estruturais (L1 e L2)  7 ou 8 genes precoces (E1 a E8)
  7. 7. + Vírus do Papiloma Humano (HPV) Características Gerais GENE FUNCTION E1 DNA-dependent ATPase, ATP dependent helicasE; Allow unwinding of the viral genome and act as an elongation factor for DNA replication. E2 Responsible for recognition and binding of origin of replication. Exists in two forms: full length (transcriptional transactivator) and truncated (transcriptional repressor). The ratio of these found in the heterotrimeric complex formed before complexing with E1 regulates transcription of viral genome. E3 ???? E4 Late Expression: C terminal binds intermediate filament, allowing release of virus-like particles. Also involved in transformation of host cell by deregulation of host cell mitogenic signalling pathway. E5 Obstruction of growth suppression mechanisms: e.g EGF receptor; activation of mitogenic signalling pathways via transcription factors: c-Jun and c-Fos (important in ubiquitin pathway degradation of p53 complex by E6). Inactivation of p21 (p53 induced expression halts cell cycle until DNA is proof-read for mutations). E6 Transformation of host cell by binding p53 tumour suppressor protein. E7 Transforming protein, binds to pRB/p107. E8 ?????
  8. 8. + Vírus do Papiloma Humano (HPV) Características Gerais  Baixo-Risco:  HPV6,  11, 13, 40, 42, 43, 44, 54, 61, 70, 72, 81 e 89  Alto-Risco  HPV16,  18, 31, 33, 35, 39, 45, 51, 52, 56, 58 e 59  Provável Alto-risco: HPV26, 53, 66, 68, 73 e 82  Risco Indeterminado  HPV30, 32, 34, 62, 67, 69, 71, 74, 83, 84, 85, 87, 90 e 91
  9. 9. + Vírus do Papiloma Humano (HPV) Características Gerais HPV-associated diseases HPV types Skin w arts 1,2,3,4,7,10,26,27,28,29,41,48,57,60,63,65,75,76,77,78 Epiderm odysplasia verruciform is benign lesions 3,5,8,9,12,14,15,17,19,20,21,22,23,24,25,36,47,49,50 Epiderm odysplasia verruciform is squam ous cell carcinom a 5,8,14,17,20,47 Periungual squam ous cell carcinom a 16,34,35 Laryngeal papillom as 6,11 Oral focal epithelial hyperplasia 13,32 Squam ous cell carcinom a (tonsil) 16,33 Anogenital w arts 6,11,40,42,43,44,54,55,74 Low -grade anogenital intraepithelial neoplasia 6,11,16,18,30,31,33,34,35,39,40,45,51,52,56,57,58,59,61,64,66,67,68,70,71,72,73,74 High-grade anogenital intraepithelial neoplasia 16,18,31,33,34,35,39,45,51,52,56,58,59,68 Squam ous cell carcinom a (cervix m ostly) 16,18,31,33,35,39,45,51,52,56,58,59,68 Adenocarcinom a (cervix m ostly) 16,18
  10. 10. + Vírus do Papiloma Humano (HPV) Características Gerais  Baixo-Risco:  HPV6,  11, 13, 40, 42, 43, 44, 54, 61, 70, 72, 81 e 89  Provocam aparecimento de papilomas/verrugas…
  11. 11. + Vírus do Papiloma Humano (HPV) Características Gerais  Baixo-Risco:  HPV6,  11, 13, 40, 42, 43, 44, 54, 61, 70, 72, 81 e 89  Provocam aparecimento de papilomas/verrugas…
  12. 12. + Vírus do Papiloma Humano (HPV) Características Gerais  Baixo-Risco:  HPV6,  11, 13, 40, 42, 43, 44, 54, 61, 70, 72, 81 e 89  Provocam aparecimento de papilomas/verrugas…
  13. 13. + Vírus do Papiloma Humano (HPV) Características Gerais  Alto-Risco  HPV16,  18, 31, 33, 35, 39, 45, 51, 52, 56, 58 e 59  Desenvolvimento de lesões baixo/alto grau e cancro
  14. 14. + Vírus do Papiloma Humano (HPV) Características GeraisYearly Incidence Counts of HPV-Associated Cancers in the United States, 2003–2007
  15. 15. + Infecção
  16. 16. + Vírus do Papiloma Humano (HPV) Infecção  Infecção Basal  Activação Replicação viral  E1, E2, E4, E5  Amplificação Carga viral  10  1000 cópias/célula  Maturação vírus  1-3 semanas  Desenvolvimento de lesão  Semanas  Meses
  17. 17. + Vírus do Papiloma Humano (HPV) Infecção  Infecção Basal  Activação Replicação viral  E1, E2, E4, E5  Amplificação Carga viral  10  1000 cópias/célula  Maturação vírus  1-3 semanas  Desenvolvimento de lesão  Semanas  Meses
  18. 18. + Vírus do Papiloma Humano (HPV) Infecção
  19. 19. + Mecanismo de Carcinogénese
  20. 20. + Vírus do Papiloma Humano (HPV) Mecanismo de Carcinogénese Major Events Escape à Resposta Imunológica Integração DNA viral no DNA do hospedeiro Imortalização celular Instabilidade genómica
  21. 21. + Vírus do Papiloma Humano (HPV) Mecanismo de Carcinogénese
  22. 22. + Vírus do Papiloma Humano (HPV) Mecanismo de Carcinogénese
  23. 23. + Vírus do Papiloma Humano (HPV) Mecanismo de Carcinogénese Integração Viral DNA Episomal: expressão de E2 regula a expressão de E6 e E7 DNA integrado: perda de E2 permite expressão desregulada de E6 e E7 Promove  Inibição replicação viral  Instabilidade genética Confere vantagem selectiva para a proliferação de células Ocorre na maioria dos casos de HSIL Podem co-existir formas episomais com integradas
  24. 24. + Vírus do Papiloma Humano (HPV) Mecanismo de Carcinogénese
  25. 25. + Vírus do Papiloma Humano (HPV) Mecanismo de Carcinogénese – E6 Moody and Laimonis, 2010
  26. 26. + Vírus do Papiloma Humano (HPV) Mecanismo de Carcinogénese – E7 Moody and Laimonis, 2010
  27. 27. + Vírus do Papiloma Humano (HPV) Mecanismo de Carcinogénese
  28. 28. + Vírus do Papiloma Humano (HPV) Mecanismo de Carcinogénese
  29. 29. + CANCRO COLO DO ÚTERO
  30. 30. + Cancro do Colo do Útero
  31. 31. + Cancro do Colo do Útero Distribuição Mundial
  32. 32. + Cancro do Colo do Útero Distribuição Mundial
  33. 33. + Cancro do Colo do Útero Em Portugal  4ª neoplasia na mulher  Neoplasia urogenital  Alta taxas:  Incidência 16 / 100 000  Mortalidade 6 / 100 000
  34. 34. + Cancro do Colo do Útero Etiologia  1842 – A culpa era da profissão…  1901 – A culpa era da religião…  60s – A culpa era da circuncisão…  70s – A culpa era dos Herpes…
  35. 35. + Cancro do Colo do Útero Etiologia  1980’s – Associação com HPV  Infecção por HPV é um factor necessário mas não suficiente  odds ratio: 60 (95% C.I. 49-73 Prof. Harald Zur Hausen (Nobel da Medicina 2008)
  36. 36. + Cancro do Colo do Útero Patologia  Desenvolvimento de Lesões Precursoras que podem evoluir para Cancro Infecção Ca Colo Útero 6 meses 3 anos 6 anos 10 anos
  37. 37. + Cancro do Colo do Útero Patologia  Colo Útero Normal Normal Histologia Citologia
  38. 38. + Cancro do Colo do Útero Patologia  CIN 1 Histologia Citologia
  39. 39. + Cancro do Colo do Útero Patologia  CIN 2 Histologia Citologia
  40. 40. + Cancro do Colo do Útero Patologia  CIN 3 Histologia Citologia
  41. 41. + Cancro do Colo do Útero Patologia  Carcinoma In Situ Histologia Citologia
  42. 42. + Cancro do Colo do Útero Patologia  Carcinoma Invasor Histologia Citologia
  43. 43. + Cancro do Colo do Útero Patologia  Carcinoma Invasor
  44. 44. + Métodos de Diagnóstico
  45. 45. + Diagnóstico Infecção HPV Métodos  Métodos Indirectos  Colposcopia  Teste Papanicolau…  Serologia….  Métodos Directos  Polimerase Chain Reaction (PCR)  Restriction Fragment Lenght Position (RFLP)  Reverse Transcriptase – PCR (RT- PCR) Amplificação  Real-Time PCR  Sequenciação  Captura Híbrida  Southern Blot  Hibridização em tiras Hibridização  CHIPS
  46. 46. + Diagnóstico Infecção HPV Métodos
  47. 47. + Diagnóstico Indirecto
  48. 48. + Diagnóstico Indirecto Colposcopia, Papanicolau…  Teste do Papanicolau  Detecta células com alterações
  49. 49. + Diagnóstico Indirecto Colposcopia, Papanicolau…  Teste do Papanicolau  Detecta células com alterações Normal Alterações celulares
  50. 50. + Técnicas Amplificação
  51. 51. + Técnicas Amplificação PCR Assays  Amplificação de um fragmento de DNA especifico;  Amplificação através de ciclos repetidos que vão permitir obter milhões de cópias do fragmento pretendido;  Fragmento pretendido está localizado entre duas regiões de DNA de sequência conhecida; 5’ – (…) ATGCGTATCGATCGATATCGATAAGCTAGCTAGGCTA (…) – 3’ 3’ – (…) TACGCATAGCTAGCTATAGCTATTCGATCGATCCGAT (…) – 5’ Região Alvo
  52. 52. + Técnicas Amplificação PCR Assays  Small portion of genome targeted  Allows testing of samples with poor quality DNA  Small changes in virus (variants or integration) may give false negative results  Consensus assays  Generally target L1 region  Type(s) determined by type specific hybridization, restriction digestion or sequencing  Type specific assays  Generally target E6/E7 region
  53. 53. + Técnicas Amplificação PCR Assays
  54. 54. + Técnicas Amplificação PCR AssaysFig. 1. Outline of the HPV-DNA genome, presented in a linear form. The position of the early (E), late (L) genes and the untranslated region (UTR) is indicated, aswell as the positions of the four most widely used primer sets CPI/II (Tieben et al., 1993), MY09/11 (Hildesheim et al., 1994), GP5+/6+ (Jacobs et al., 1997), SPF10(Kleter et al., 1998) and Roche Amplicor HPV assay with their respective amplimer sizes (the precise location of the primers, used in the Roche assay is unknown).The 291 bp fragment used for formal classification of HPV genotypes (Chan et al., 1995; de Villiers et al., 2004) is shown in the L1 region.
  55. 55. + Técnicas Amplificação PCR Assays  Primers  MY09: 5´- CGT CCM ARR GGA WAC TGA TC – 3´  MY11: 5`-GCM CAG GGW CAT AAY AAT GG- 3  São primers degenerados e usam nucleótidos modificados:  M = A ou C  R = A ou G  W = A ou T  Y = C ou T  Fragmento de 449pb
  56. 56. + Técnicas Amplificação Genotipagem RFLP (Restriction Fragment Length Polymorphism) Análise de polimorfismos (mutações pontuais funcionais); Variação no tamanho de fragmentos de DNA provocada pela actividade diferencial de enzimas de restrição (cortam o DNA numa sequência específica) Presença de polimorfismo → Perda ou ganho de local de restrição → Variação no tamanho de fragmentos de DNA. 5’ – (…) ACTGA (…) – 3’ 3’ – (…) TGACT (…) – 5’
  57. 57. + Técnicas Amplificação Genotipagem
  58. 58. + Técnicas Amplificação Genotipagem Baixo-Risco HPV6, 11, 13, 40, 42, 43, 44, 54, 61, 70, 72, 81 e 89 Alto-Risco HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58 e 5 Provável Alto-risco HPV26, 53, 66, 68, 73 e 82 Risco Indeterminado HPV30, 32, 34, 62, 67, 69, 71, 74, 83, 84, 85, 87, 90 e 91
  59. 59. + Técnicas Amplificação Genotipagem
  60. 60. + Técnicas de Hibridização
  61. 61. + Técnicas de Hibridização  Alvo – DNA ou RNA  Utilização de sondas específicas  Possibilidade de diferenciação entre subtipos de vírus  Técnicas  Captura Híbrida  Hibridização em tiras  Southern Blotting  CHIPS
  62. 62. + Técnicas de Hibridização Captura Híbrida Principio da técnica Hibridização de Ácidos Nucleicos Amplificação sinal por Quimioluminescência Método semiquantitativo Método Hibridização amostras positivas com sondas específicas Complexo Sonda-Amostra é capturado por anticorpos de uma microplaca Reacção com anticorpo secundário conjudado com FA Adição de reagente e detecção por quimioluminescência
  63. 63. + Técnicas de Hibridização Captura Híbrida 45 minutes at 65ºC 60 minutes at 65ºC 15 minutes 30 minutes 60 minutes agitação
  64. 64. + Técnicas de Hibridização Southern Blot
  65. 65. + Técnicas de Hibridização Hibridização em Tiras
  66. 66. + Técnicas de Hibridização CHIPs  Tubos ou lâminas com sondas específicas para cada subtipo;  Tipagem de vírus:  HPV, HCV, HIV
  67. 67. + Técnicas de Hibridização CHIPs
  68. 68. + Técnicas de Hibridização CHIPs 56 18 66 16
  69. 69. + Casos Clínicos
  70. 70. + Caso Clínico #1  História Clínica  37 anos  Sexo feminino  Divorciada  2 filhos  Bom estado geral  Queixas principais  Escorrências esbranquiçadas  Dor durante acto sexual  Exame ginecológico  Colo uterino com zona vermelha peri-orificial extensa
  71. 71. + Caso Clínico #1  História Clínica  Diagnósticos Diferenciais  37 anos  Candidíase  Sexo feminino  Herpes Genital  Divorciada  2 filhos  Lesão/Cancro do Colo do Útero  Bom estado geral  Queixas principais  Suspeitas  Escorrências esbranquiçadas  Vírus do Papiloma Humano  Dor durante acto sexual  Candida Albicans  Exame ginecológico  Herpes simplex 1/2  Colo uterino com zona vermelha peri-orificial extensa
  72. 72. + Caso Clínico #1  Citologia  Células atípicas Lesão baixo grau Citologia   Raspagens Colo do Útero  HPV Alto-Risco Positivo  Herpes Simplex 2 Positivo Histologia  Biópsia Colo do Útero  CIN 2
  73. 73. + Caso Clínico #2  História Clínica  8 anos  Sexo masculino  Sinais e Sintomas  Voz ciciada  Rouquidão  Odinofagia (dor à deglutição)  “Respiração rude”
  74. 74. + Caso Clínico #2  História Clínica  Diagnósticos Diferenciais  8 anos  Asma  Sexo masculino  Infecção respiratória  Cancro da Laringe  Sinais e Sintomas  Papilomatose Laríngea  Voz ciciada  Rouquidão  Suspeitas  Odinofagia (dor à deglutição)  Respiratory Syncicial Virus  “Respiração rude”  Cytomegalovirus  Influenza virus  Human Papillomavirus
  75. 75. + Caso Clínico #2  Sangue – Biologia Molecular  DNA CMV neg  DNA RSV neg  RNA InfA, B, C neg  DNA HPV neg  Biópsia  Lesao papilomatosa/verrucosa  HPV positivo Diagnóstico: Papilomatose laríngea Human Papillomavirus (HPV)
  76. 76. + Prevenção
  77. 77. Como se pode prevenir? Castidade!?!?!? Abstinência sexual !?!?!? Monogamia !?!?!?
  78. 78. Como se pode prevenir? Uso de Preservativo É a medida mais eficaz para prevenir DST e travar a sua disseminação, mas não confere protecção absoluta para a infecção por HPV… Exames ginecológicos regulares Precauções com parceiros e comportamentos de risco
  79. 79. Como se pode prevenir? Teste do Papanicolau... Rastreio o Detecta células com alterações Início actividade sexual Anual < 30 anos 18 21 30 ≈ 3/3 anos Citologia 2/3 anos ≥ 30 anos 30 Citologia + HPV 3 anos
  80. 80. Como se pode prevenir?Vacinas profiláticas oferecem grandes promessas no futuro… Merck® (Gardasil™) Vacina tetravalente (HPV6, 11, 16 e 18) Glaxo SmithKline® (Cervarix™) Vacina bivalente (16 e 18)
  81. 81. Como se pode prevenir?Vacinas profiláticas em Portugal•Vacina integrada no Programa Nacional de Vacinação(Despacho n.º 8378/2008, de 20 de Março)Merck® (Gardasil™)Vacina tetravalente (HPV6, 11, 16 e 18)
  82. 82. +PatologiaInfecção HPV Hugo Sousa BScH Microbiology MSc Oncology PhD Biomedical Sciences MD Student _________________________________________ Serviço Virologia – Lab Biologia Molecular Grupo Oncologia Molecular IPO Porto FG EPE
  1. Gostou de algum slide específico?

    Recortar slides é uma maneira fácil de colecionar informações para acessar mais tarde.

×