Aula04 tecnicas diagnostico virologia parte 2 final

3,195 views
3,020 views

Published on

2 Comments
1 Like
Statistics
Notes
No Downloads
Views
Total views
3,195
On SlideShare
0
From Embeds
0
Number of Embeds
24
Actions
Shares
0
Downloads
193
Comments
2
Likes
1
Embeds 0
No embeds

No notes for slide

Aula04 tecnicas diagnostico virologia parte 2 final

  1. 1. VirologiaAno Lectivo 2010/11 Técnicas Diagnóstico Virologia – Parte II
  2. 2. real-time PCR Técnicas Biologia Molecular TÉCNICAS DE BIOLOGIA MOLECULAR  Detecção do genoma viral  Futuro do diagnóstico de vírus  Necessidade de equipamento e pessoal treinadoAula 4 - Técnicas Diagnóstico Virologia - Parte II 2
  3. 3. real-time PCR Técnicas TÉCNICAS Biologia Molecular  Métodos de Amplificação  Polimerase Chain Reaction (PCR)  Restriction Fragment Lenght Position (RFLP)  Single Strand Conformation Polymorphism (SSCP)  Reverse Transcriptase - Polimerase Chain Reaction (RT- PCR)  Real-Time PCR  Sequenciação  Métodos de Hibridização  Captura Híbrida  Southern Blot  Hibridização em tiras  CHIPSAula 4 - Técnicas Diagnóstico Virologia - Parte II 3
  4. 4. 4  Extracção Ácidos NucleicosAula 4 - Técnicas Diagnóstico Virologia - Parte II
  5. 5. real-time PCR Técnicas Extracção Ácidos Nucleicos Biologia Molecular  Líse alcalina;  Neutralização;  Precipitação de Proteínas e detritos celulares;  Purificação Ácidos Nucleicos  Precipitação  Eluição em colunasAula 4 - Técnicas Diagnóstico Virologia - Parte II 5
  6. 6. real-time PCR Técnicas Extracção Ácidos Nucleicos Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 6
  7. 7. real-time PCR Técnicas Extracção Ácidos Nucleicos Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 7
  8. 8. real-time PCR Técnicas Extracção Ácidos Nucleicos Biologia Molecular  Utilização Nucleases  Remoção DNA  Remoção RNA Add DNase + DNase (protein) Add RNase + RNase (protein)Aula 4 - Técnicas Diagnóstico Virologia - Parte II 8
  9. 9. real-time PCR Técnicas Extracção Ácidos Nucleicos Biologia Molecular Avaliação Ácidos Nucleicos por Espectofotometria UV Estimar a concentração de DNA e RNA a ~260nm. [dsDNA] ≈ A260 x (50 µg/mL) [ssRNA] ≈ A260 x (40 µg/mL)Aula 4 - Técnicas Diagnóstico Virologia - Parte II 9
  10. 10. 10  Técnicas de Amplificação ANAula 4 - Técnicas Diagnóstico Virologia - Parte II
  11. 11. real-time PCR Técnicas Polymerase Chain Reaction Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 11
  12. 12. real-time PCR Técnicas Polymerase Chain Reaction Biologia Molecular  Amplifica um fragmento de DNA especifico;  Amplificação através de ciclos repetidos que vão permitir obter milhões de cópias do fragmento pretendido;  Fragmento pretendido está localizado entre duas regiões de DNA de sequência conhecida; 5’ – (…) ATGCGTATCGATCGATATCGATAAGCTAGCTAGGCTA (…) – 3’ 3’ – (…) TACGCATAGCTAGCTATAGCTATTCGATCGATCCGAT (…) – 5’ Região AlvoAula 4 - Técnicas Diagnóstico Virologia - Parte II 12
  13. 13. real-time PCR Técnicas Polymerase Chain Reaction Biologia Molecular MISTURA DE REACÇÃO:  DNA  Primers: Oligonucleótidos de cadeia simples com sequência complementar às sequências alvo do ADN (idealmente 20-24 nucleótidos);  Buffer: Solução tampão para estabilizar a reacção;  Mg2+ (Magnésio): Ajuda na ligação dos nucleótidos e estabilidade da Taq;  dNTP’s: Nucleótidos livres (A, T, C, G);  Taq polimerase: Enzima termo-estável (+/-72ºC) que efectua a cópia da sequencia alvo do ADN.Aula 4 - Técnicas Diagnóstico Virologia - Parte II 13
  14. 14. real-time PCR Técnicas Polymerase Chain Reaction Biologia Molecular PROCEDIMENTO  1º Passo: Abertura do ADN cadeia dupla (T=95ºC);  2º Passo: Annealing/Ligação dos Primers (Ta~50 a 65ºC);  3º Passo: Activação da Taq polimerase (T~75ºC); 5’ – (…) ATGCGTATCGATCGATATCGATAAGCTAGCTAGGCTA (…) – 3’ ATCCGAT (…) – 5’ 3’ – (…) TACGCATAGCTAGCTATAGCTATTCGATCGATCCGAT (…) – 5’ 5’ – (…) ATGCGTAAula 4 - Técnicas Diagnóstico Virologia - Parte II 14
  15. 15. real-time PCR Técnicas Polymerase Chain Reaction Biologia Molecular PROCEDIMENTO  4º Passo: Repetição dos passos anteriores por 30-45 ciclos no máximo;  FINAL: Obtenção de 2nºciclos copias do fragmento alvo.Aula 4 - Técnicas Diagnóstico Virologia - Parte II 15
  16. 16. real-time PCR Técnicas Polymerase Chain Reaction Biologia Molecular Electroforese em Gel de Agarose:  Separa as moléculas (proteínas ou ácidos núcleicos) de acordo com o seu peso molecular;  DNA e RNA possuem carga eléctrica negativa migram para o pólo positivo (quanto mais pequenas mais migram);  Brometo de Etídeo que se vai intercalar na dupla hélice de ADN e possibilitar a visualização dos fragmentos quando em exposição a luz UV;  Amostras da PCR carregadas no gel;Aula 4 - Técnicas Diagnóstico Virologia - Parte II 16
  17. 17. real-time PCR Técnicas Polymerase Chain Reaction Biologia Molecular Pólo Positivo (+) Pólo Negativo (-)Aula 4 - Técnicas Diagnóstico Virologia - Parte II 17
  18. 18. real-time PCR Técnicas Polymerase Chain Reaction Biologia Molecular APLICAÇÕES  Detecção de sequências específicas de DNA viral  Detecção AdV em amostras respiratórias  Detecção EBV em biópsias Nasofaringe  Detecção JCV em LCR  ... DESVANTAGENS  Altamente sensível a contaminação com quantidades residuais de DNA.  Falsos positivos e artefactos.Aula 4 - Técnicas Diagnóstico Virologia - Parte II 18
  19. 19. Restriction real-time PCR Fragment Técnicas Length Biologia Polymorphism (RFLP) MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 19
  20. 20. Restriction real-time PCR Fragment Técnicas Length Biologia Polymorphism (RFLP) Molecular  Baseada na técnica da PCR;  Análise de polimorfismos (mutações pontuais funcionais);  Variação no tamanho de fragmentos de DNA provocada pela actividade diferencial de enzimas de restrição (cortam o DNA numa sequência específica)  Presença de polimorfismo Perda ou ganho de local de restrição Variação no tamanho de fragmentos de DNA. 5’ – (…) ACTGA (…) – 3’ 3’ – (…) TGACT (…) – 5’Aula 4 - Técnicas Diagnóstico Virologia - Parte II 20
  21. 21. Restriction real-time PCR Fragment Técnicas Length Biologia Polymorphism (RFLP) MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 21
  22. 22. Restriction real-time PCR Fragment Técnicas Length Biologia Polymorphism (RFLP) MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 22
  23. 23. Restriction real-time PCR Fragment Técnicas Length Biologia Polymorphism (RFLP) Molecular APLICAÇÕES  Detecção de variantes Virais  Detecção variantes CMV – Associação com resposta a terapia  Detecção variantes HPV – Associação com patologias  Detecção variantes EBV – Associação com agressividade  ... DESVANTAGENS  Todas as do PCR  Sensível a contaminação por DNAses  ArtefactosAula 4 - Técnicas Diagnóstico Virologia - Parte II 23
  24. 24. Single Strand real-time PCR Conformation Técnicas Biologia Polymorphism (SSCP) MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 24
  25. 25. Single Strand real-time PCR Conformation Técnicas Biologia Polymorphism (SSCP) Molecular  Baseada na técnica da PCR;  Análise de polimorfismos/mutações;  Diferenças de sequência de um único nucleótido são suficientes para que cadeias simples de DNA adquiram uma conformação tri-dimensional diferente;  Gel de Poliacrilamida permite correr as amostras (apenas em cadeia simples/desnaturadas) em função da sua conformação.Aula 4 - Técnicas Diagnóstico Virologia - Parte II 25
  26. 26. Single Strand real-time PCR Conformation Técnicas Biologia Polymorphism (SSCP) MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 26
  27. 27. Single Strand real-time PCR Conformation Técnicas Biologia Polymorphism (SSCP) Molecular APLICAÇÕES  Detecção de variantes Virais  Detecção variantes CMV – Associação com resposta a terapia  Detecção variantes HPV – Associação com agressividade  ... DESVANTAGENS  Todas as do PCR  Contaminações  Leitura gel poliacrilamidaAula 4 - Técnicas Diagnóstico Virologia - Parte II
  28. 28. real-time PCR Técnicas ReverseTranscriptase PCR Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 28
  29. 29. real-time PCR Técnicas ReverseTranscriptase PCR Biologia Molecular  Baseada na técnica da PCR;  Análise de expressão de mRNA;  Usa a enzima Transcritase Reversa para converter o mRNA em cDNA;  Protocolo PCR para aumentar exponencialmente o número de cópias do mRNA; mRNA: 5’ – AUGCGUAUCGAUAUCGAUAAGCUA (…) AAAAAAAAA – 3’ TTTTTTTTTT – 5’ Molécula AlvoAula 4 - Técnicas Diagnóstico Virologia - Parte II 29
  30. 30. real-time PCR Técnicas ReverseTranscriptase PCR Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 30
  31. 31. real-time PCR Técnicas ReverseTranscriptase PCR Biologia Molecular VANTAGENS  Permite fazer análise quantitativa da expressão de mRNA.Aula 4 - Técnicas Diagnóstico Virologia - Parte II 31
  32. 32. real-time PCR Técnicas ReverseTranscriptase PCR Biologia Molecular APLICAÇÕES  Expressão mRNA viral  Avaliação actividade viral DESVANTAGENS  Todas as do PCR  ContaminaçõesAula 4 - Técnicas Diagnóstico Virologia - Parte II
  33. 33. real-time PCR Técnicas RealTime PCR Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 33
  34. 34. real-time PCR Técnicas RealTime PCR Biologia Molecular  PCR was traditionally limited to end-point analysis using agarose gels  Limitations of end-point PCR:  Poor precision  Low sensitivity  Short dynamic range  Low resolution  Size-based discrimination  Ethidium bromide for staining does not allow for accurate quantitation  Requires post-PCR processingAula 4 - Técnicas Diagnóstico Virologia - Parte II 34
  35. 35. real-time PCR Técnicas RealTime PCR Biologia Molecular  Monitoriza a fluorescência emitida durante a reacção de PCR como um indicador da produções de amplicões em cada ciclo de PCR;  Monitorização em tempo real;  Detecção da amplificação nos estádios precoces da reacção – maior precisão;  Alvo: DNA ou RNAAula 4 - Técnicas Diagnóstico Virologia - Parte II 35
  36. 36. real-time PCR Técnicas RealTime PCR Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 36
  37. 37. real-time PCR Técnicas RealTime PCR Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 37
  38. 38. real-time PCR Técnicas RealTime PCR Biologia Molecular SYBR Green I Sonda de Hibridação Sonda TaqManAula 4 - Técnicas Diagnóstico Virologia - Parte II 38
  39. 39. real-time PCR Técnicas RealTime PCR Biologia Molecular Exponential If 100% efficiency – exact doubling of products. Specific and precise Linear PCR phases in linear view High variability. Reaction components Plateau are being consumed and PCR products are starting to degrade. [DNA] Linear Plateau End-point analysis. The reaction has stopped and if left for long – Exponential Cycle # degradation of PCR products.Aula 4 - Técnicas Diagnóstico Virologia - Parte II 39
  40. 40. real-time PCR Técnicas RealTime PCR Biologia Molecular Baseline – The baseline phase contains all the amplification that is below the level of detection of the real time instrument. Threshold – where the threshold and the amplification plot intersect defines CT. Can be set manually/automatically CT – (cycle threshold) the cycle number where the fluorescence passes the threshold Rn – (Rn-baseline) NTC – no template control DRn is plotted against cycle numbers to produce the amplification curves and gives the CT value.Aula 4 - Técnicas Diagnóstico Virologia - Parte II 40
  41. 41. real-time PCR Técnicas RealTime PCR Biologia Molecular CT = threshold cycle Fracção dos ciclos de PCR a partir da qual é detectado sinal Quanto maior a quantidade de DNA, menor o valor de CtAula 4 - Técnicas Diagnóstico Virologia - Parte II 41
  42. 42. real-time PCR Técnicas RealTime PCR Biologia Molecular Aplicações  Quantificação carga viral  Monitorização carga viral  Monitorização terapêutica VANTAGENS  Amplificação monitorizada em tempo real  Ausência de processamento pós PCR (baixo risco de contaminação)  Requer pouca quantidade de amostra (DNA ou RNA)  Rápido, Específico, sensível e reprodutível  Quantitativo  BaratoAula 4 - Técnicas Diagnóstico Virologia - Parte II 42
  43. 43. real-time PCR Técnicas Sequenciação Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 43
  44. 44. real-time PCR Técnicas Sequenciação Biologia Molecular  Usada para determinar a sequência de nucleótidos  Método de sequenciação mais utilizado – método didesoxi  Adição de didesoxinucleótidos que terminam a reacção de polimerização 3’ OH – necessário para adição do nucleótido seguinteAula 4 - Técnicas Diagnóstico Virologia - Parte II 44
  45. 45. real-time PCR Técnicas Sequenciação Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 45
  46. 46. real-time PCR Técnicas Sequenciação Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 46
  47. 47. 47  Técnicas de HibridizaçãoAula 4 - Técnicas Diagnóstico Virologia - Parte II
  48. 48. real-time PCR Técnicas Técnicas de Hibridização Biologia Molecular  Alvo – DNA ou RNA  Utilização de sondas específicas  Possibilidade de diferenciação entre subtipos de vírus  Técnicas  Captura Híbrida  Hibridização em tiras  Southern Blotting  CHIPSAula 4 - Técnicas Diagnóstico Virologia - Parte II 48
  49. 49. real-time PCR Técnicas Captura Híbrida Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 49
  50. 50. real-time PCR Técnicas Captura Híbrida Biologia Molecular Principio da técnica  Hibridização de Ácidos Nucleicos  Amplificação sinal por Quimioluminescência  Método semiquantitativo Método  Hibridização amostras positivas com sondas específicas  Complexo Sonda-Amostra é capturado por anticorpos de uma microplaca  Reacção com anticorpo secundário conjudado com FA  Adição de reagente e detecção por quimioluminescênciaAula 4 - Técnicas Diagnóstico Virologia - Parte II 50
  51. 51. real-time PCR Técnicas Captura Híbrida Biologia Molecular 45 minutes at 65ºC 60 minutes at 65ºC 15 minutes 30 minutes 60 minutes agitaçãoAula 4 - Técnicas Diagnóstico Virologia - Parte II 51
  52. 52. real-time PCR Técnicas Southern Blot Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 52
  53. 53. real-time PCR Técnicas Southern Blot Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 53
  54. 54. real-time PCR Técnicas Hibridização em tiras Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 54
  55. 55. real-time PCR Técnicas Hibridização em tiras Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 55
  56. 56. real-time PCR Técnicas Chips Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 56
  57. 57. real-time PCR Técnicas Chips Biologia Molecular  Tipagem de vírus:  HPV, HCV, HIV  Tubos ou lâminas com sondas específicas para cada subtipoAula 4 - Técnicas Diagnóstico Virologia - Parte II 57
  58. 58. real-time PCR Técnicas Chips Biologia MolecularAula 4 - Técnicas Diagnóstico Virologia - Parte II 58
  59. 59. We ask the lab for a diagnosis, expecting a yes or no, but often end up with just a maybe… Professor Mark PallenAula 4 - Técnicas Diagnóstico Virologia - Parte II 59
  60. 60. VirologiaAno Lectivo 2010/11 Técnicas Diagnóstico Virologia – Parte II

×