Your SlideShare is downloading. ×
ICIC 2013 New Product Introductions GenomeQuest
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

ICIC 2013 New Product Introductions GenomeQuest

458
views

Published on

Published in: Technology

0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
458
On Slideshare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
8
Comments
0
Likes
1
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Henk Heus, Ph.D. IP SEQUENCE SEARCH
  • 2. THE QUESTION AND THE ANSWER CCCCGATCCTGGGGCAGAGGCGGCCTCTGGATCAT ACATATG 5 granted patents with a sequence mentioned in the claims with over 70% identity to the query
  • 3. HOW IT WAS DONE
  • 4. HOW IT WAS DONE
  • 5. PRODUCT OVERVIEW  GQ-Pat database coverage / / / / ST.25 listings and sequences in text, tables, and figures 217 million sequences 437 thousand documents in 182 thousand INPADOC families 25 authorities US, CN, WO, EP, KR, JP, IN, CA, etc.  Easy to use web interface Multiple sequence search algorithms (genePAST) Result filtering capabilities Word and Excel exports Automated search alerts Result sharing within your team  Used by almost all big pharma and ag companies worldwide     

×