SlideShare a Scribd company logo
1 of 4
Bioinformatics
caacaagccaaaactcgtacaa
Cgagatatctcttggaaaaact
gctcacaatattgacgtacaag
gttgttcatgaaactttcggta
Acaatcgttgacattgcgacct
aatacagcccagcaagcagaat

Managing genomic data
DNA sequencing workflows
•
•
•
•
•

Diverse formats
Redundant data
Repeated file processing
In-core processing models
Lack of persistence
Multiple Levels of Information
SNP Score
Contig Summaries
Discrepancies

Contig Qualities

Coverage Depth

Trace
Reads

Aligned bases

Read
quality

Contig
Percent match
HDF5 as format for bioinformatics

More Related Content

More from The HDF-EOS Tools and Information Center

STARE-PODS: A Versatile Data Store Leveraging the HDF Virtual Object Layer fo...
STARE-PODS: A Versatile Data Store Leveraging the HDF Virtual Object Layer fo...STARE-PODS: A Versatile Data Store Leveraging the HDF Virtual Object Layer fo...
STARE-PODS: A Versatile Data Store Leveraging the HDF Virtual Object Layer fo...The HDF-EOS Tools and Information Center
 

More from The HDF-EOS Tools and Information Center (20)

Accessing Cloud Data and Services Using EDL, Pydap, MATLAB
Accessing Cloud Data and Services Using EDL, Pydap, MATLABAccessing Cloud Data and Services Using EDL, Pydap, MATLAB
Accessing Cloud Data and Services Using EDL, Pydap, MATLAB
 
HDF - Current status and Future Directions
HDF - Current status and Future DirectionsHDF - Current status and Future Directions
HDF - Current status and Future Directions
 
HDFEOS.org User Analsys, Updates, and Future
HDFEOS.org User Analsys, Updates, and FutureHDFEOS.org User Analsys, Updates, and Future
HDFEOS.org User Analsys, Updates, and Future
 
HDF - Current status and Future Directions
HDF - Current status and Future Directions HDF - Current status and Future Directions
HDF - Current status and Future Directions
 
H5Coro: The Cloud-Optimized Read-Only Library
H5Coro: The Cloud-Optimized Read-Only LibraryH5Coro: The Cloud-Optimized Read-Only Library
H5Coro: The Cloud-Optimized Read-Only Library
 
MATLAB Modernization on HDF5 1.10
MATLAB Modernization on HDF5 1.10MATLAB Modernization on HDF5 1.10
MATLAB Modernization on HDF5 1.10
 
HDF for the Cloud - Serverless HDF
HDF for the Cloud - Serverless HDFHDF for the Cloud - Serverless HDF
HDF for the Cloud - Serverless HDF
 
HDF5 <-> Zarr
HDF5 <-> ZarrHDF5 <-> Zarr
HDF5 <-> Zarr
 
HDF for the Cloud - New HDF Server Features
HDF for the Cloud - New HDF Server FeaturesHDF for the Cloud - New HDF Server Features
HDF for the Cloud - New HDF Server Features
 
Apache Drill and Unidata THREDDS Data Server for NASA HDF-EOS on S3
Apache Drill and Unidata THREDDS Data Server for NASA HDF-EOS on S3Apache Drill and Unidata THREDDS Data Server for NASA HDF-EOS on S3
Apache Drill and Unidata THREDDS Data Server for NASA HDF-EOS on S3
 
STARE-PODS: A Versatile Data Store Leveraging the HDF Virtual Object Layer fo...
STARE-PODS: A Versatile Data Store Leveraging the HDF Virtual Object Layer fo...STARE-PODS: A Versatile Data Store Leveraging the HDF Virtual Object Layer fo...
STARE-PODS: A Versatile Data Store Leveraging the HDF Virtual Object Layer fo...
 
HDF5 and Ecosystem: What Is New?
HDF5 and Ecosystem: What Is New?HDF5 and Ecosystem: What Is New?
HDF5 and Ecosystem: What Is New?
 
HDF5 Roadmap 2019-2020
HDF5 Roadmap 2019-2020HDF5 Roadmap 2019-2020
HDF5 Roadmap 2019-2020
 
Leveraging the Cloud for HDF Software Testing
Leveraging the Cloud for HDF Software TestingLeveraging the Cloud for HDF Software Testing
Leveraging the Cloud for HDF Software Testing
 
Google Colaboratory for HDF-EOS
Google Colaboratory for HDF-EOSGoogle Colaboratory for HDF-EOS
Google Colaboratory for HDF-EOS
 
Parallel Computing with HDF Server
Parallel Computing with HDF ServerParallel Computing with HDF Server
Parallel Computing with HDF Server
 
HDF-EOS Data Product Developer's Guide
HDF-EOS Data Product Developer's GuideHDF-EOS Data Product Developer's Guide
HDF-EOS Data Product Developer's Guide
 
HDF Status Update
HDF Status UpdateHDF Status Update
HDF Status Update
 
NASA Terra Data Fusion
NASA Terra Data FusionNASA Terra Data Fusion
NASA Terra Data Fusion
 
HDF Cloud: HDF5 at Scale
HDF Cloud: HDF5 at ScaleHDF Cloud: HDF5 at Scale
HDF Cloud: HDF5 at Scale
 

Recently uploaded

A Framework for Development in the AI Age
A Framework for Development in the AI AgeA Framework for Development in the AI Age
A Framework for Development in the AI AgeCprime
 
Time Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsTime Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsNathaniel Shimoni
 
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024BookNet Canada
 
[Webinar] SpiraTest - Setting New Standards in Quality Assurance
[Webinar] SpiraTest - Setting New Standards in Quality Assurance[Webinar] SpiraTest - Setting New Standards in Quality Assurance
[Webinar] SpiraTest - Setting New Standards in Quality AssuranceInflectra
 
Emixa Mendix Meetup 11 April 2024 about Mendix Native development
Emixa Mendix Meetup 11 April 2024 about Mendix Native developmentEmixa Mendix Meetup 11 April 2024 about Mendix Native development
Emixa Mendix Meetup 11 April 2024 about Mendix Native developmentPim van der Noll
 
The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsPixlogix Infotech
 
Potential of AI (Generative AI) in Business: Learnings and Insights
Potential of AI (Generative AI) in Business: Learnings and InsightsPotential of AI (Generative AI) in Business: Learnings and Insights
Potential of AI (Generative AI) in Business: Learnings and InsightsRavi Sanghani
 
Generative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdfGenerative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdfIngrid Airi González
 
Decarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a realityDecarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a realityIES VE
 
Testing tools and AI - ideas what to try with some tool examples
Testing tools and AI - ideas what to try with some tool examplesTesting tools and AI - ideas what to try with some tool examples
Testing tools and AI - ideas what to try with some tool examplesKari Kakkonen
 
UiPath Community: Communication Mining from Zero to Hero
UiPath Community: Communication Mining from Zero to HeroUiPath Community: Communication Mining from Zero to Hero
UiPath Community: Communication Mining from Zero to HeroUiPathCommunity
 
So einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdfSo einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdfpanagenda
 
Data governance with Unity Catalog Presentation
Data governance with Unity Catalog PresentationData governance with Unity Catalog Presentation
Data governance with Unity Catalog PresentationKnoldus Inc.
 
Genislab builds better products and faster go-to-market with Lean project man...
Genislab builds better products and faster go-to-market with Lean project man...Genislab builds better products and faster go-to-market with Lean project man...
Genislab builds better products and faster go-to-market with Lean project man...Farhan Tariq
 
TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024Lonnie McRorey
 
Connecting the Dots for Information Discovery.pdf
Connecting the Dots for Information Discovery.pdfConnecting the Dots for Information Discovery.pdf
Connecting the Dots for Information Discovery.pdfNeo4j
 
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesHow to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesThousandEyes
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity PlanDatabarracks
 
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxPasskey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxLoriGlavin3
 
From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .Alan Dix
 

Recently uploaded (20)

A Framework for Development in the AI Age
A Framework for Development in the AI AgeA Framework for Development in the AI Age
A Framework for Development in the AI Age
 
Time Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsTime Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directions
 
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
 
[Webinar] SpiraTest - Setting New Standards in Quality Assurance
[Webinar] SpiraTest - Setting New Standards in Quality Assurance[Webinar] SpiraTest - Setting New Standards in Quality Assurance
[Webinar] SpiraTest - Setting New Standards in Quality Assurance
 
Emixa Mendix Meetup 11 April 2024 about Mendix Native development
Emixa Mendix Meetup 11 April 2024 about Mendix Native developmentEmixa Mendix Meetup 11 April 2024 about Mendix Native development
Emixa Mendix Meetup 11 April 2024 about Mendix Native development
 
The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and Cons
 
Potential of AI (Generative AI) in Business: Learnings and Insights
Potential of AI (Generative AI) in Business: Learnings and InsightsPotential of AI (Generative AI) in Business: Learnings and Insights
Potential of AI (Generative AI) in Business: Learnings and Insights
 
Generative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdfGenerative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdf
 
Decarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a realityDecarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a reality
 
Testing tools and AI - ideas what to try with some tool examples
Testing tools and AI - ideas what to try with some tool examplesTesting tools and AI - ideas what to try with some tool examples
Testing tools and AI - ideas what to try with some tool examples
 
UiPath Community: Communication Mining from Zero to Hero
UiPath Community: Communication Mining from Zero to HeroUiPath Community: Communication Mining from Zero to Hero
UiPath Community: Communication Mining from Zero to Hero
 
So einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdfSo einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdf
 
Data governance with Unity Catalog Presentation
Data governance with Unity Catalog PresentationData governance with Unity Catalog Presentation
Data governance with Unity Catalog Presentation
 
Genislab builds better products and faster go-to-market with Lean project man...
Genislab builds better products and faster go-to-market with Lean project man...Genislab builds better products and faster go-to-market with Lean project man...
Genislab builds better products and faster go-to-market with Lean project man...
 
TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024
 
Connecting the Dots for Information Discovery.pdf
Connecting the Dots for Information Discovery.pdfConnecting the Dots for Information Discovery.pdf
Connecting the Dots for Information Discovery.pdf
 
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesHow to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity Plan
 
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxPasskey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
 
From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .
 

HDF5 in Bioinformatics

Editor's Notes

  1. &lt;number&gt;