Friday, June 15, 12
We track lots of things:               100000s samples               10000s QC data points               1000s of knowledg...
We track lots of things:               100000s samples               10000s QC data points               1000s of knowledg...
We track lots of things:                                                         $$$$               100000s samples       ...
We track lots of things:                                                              $$$$               100000s samples  ...
Friday, June 15, 12
Robots                are Team Members Too!                Jim Meldrim and John Stalker                The Broad Institute...
The Broad Institute             Established 2004 - Eli and Edythe Broad             Joint Collaboration                MIT...
Organization                 Programs (Science)                     Platforms (Technology)                      Chemical B...
Organization                 Programs (Science)                     Platforms (Technology)                      Chemical B...
Genome Sequencing                         BackgroundFriday, June 15, 12
20..            2002        2003        2004         2005              2006             2007             2008             ...
20..            2002        2003        2004         2005              2006             2007             2008             ...
20..            2002        2003        2004         2005              2006             2007             2008             ...
20..            2002        2003        2004         2005              2006             2007             2008             ...
20..            2002        2003        2004         2005              2006             2007             2008             ...
20..            2002        2003        2004         2005              2006             2007             2008             ...
20..            2002        2003        2004         2005              2006             2007             2008             ...
20..            2002        2003        2004         2005              2006             2007             2008             ...
Genome Sequencing                            101Friday, June 15, 12
Genome Sequencing 101Friday, June 15, 12
Genome Sequencing 101                                     Cell                                         NucleusFriday, June...
Genome Sequencing 101Friday, June 15, 12
Genome Sequencing 101                      1      2             3                 4             5                      6  ...
Genome Sequencing 101                                          Mom                      1      2             3            ...
Genome Sequencing 101                               X   YFriday, June 15, 12
Genome Sequencing 101                            JIRA is in our DNA!Friday, June 15, 12
Genome Sequencing 101Friday, June 15, 12
Genome Sequencing 101                      DNA (Deoxyribonucleic acid)                      • Two intertwined molecules - ...
Genome Sequencing 101                      DNA (Deoxyribonucleic acid)                      • Two intertwined molecules - ...
Genome Sequencing 101                      DNA (Deoxyribonucleic acid)                      • Two intertwined molecules - ...
Genome Sequencing 101                        Adenine   Thymine                        Guanine   CytosineFriday, June 15, 12
Genome Sequencing 101Friday, June 15, 12
Genome Sequencing 101                                    TGCAGCAATGCTGAGCGCTAGCGFriday, June 15, 12
Genome Sequencing 101   TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT                                        3 Billio...
Genome Sequencing 101   TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGTFriday, June 15, 12
Genome Sequencing 101   TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT   TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGT...
Genome Sequencing 101   TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT   TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGT...
Lab Process Tracking                              withFriday, June 15, 12
Outside the Genome Sequencing Platform                      ?                    Our Process                              ...
Outside the Genome Sequencing Platform                      ?                    Our Process                              ...
Outside the Genome Sequencing Platform                      ?                                    Our Process              ...
Outside the Genome Sequencing Platform                      ?                    Our Process                              ...
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Robots are Team Members, Too!
Upcoming SlideShare
Loading in …5
×

Robots are Team Members, Too!

1,301 views
1,264 views

Published on

The Genome Sequencing Operations group at the Broad Institute rely on JIRA to manage laboratory operations and instilled a high level of collaboration and communication between lab techs, project managers, and even robots! Learn how these robots use REST APIs to become active collaborators in a number of JIRA projects, and how you can integrate your own external applications to automate your interactions with JIRA in exciting and useful ways.

Published in: Technology, Business
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,301
On SlideShare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
18
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Robots are Team Members, Too!

  1. 1. Friday, June 15, 12
  2. 2. We track lots of things: 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendorsFriday, June 15, 12
  3. 3. We track lots of things: 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendorsFriday, June 15, 12
  4. 4. We track lots of things: $$$$ 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendorsFriday, June 15, 12
  5. 5. We track lots of things: $$$$ 100000s samples 10000s QC data points 1000s of knowledge documents 1000s small equipment pieces 1000s sequencing runs 100s of technology development projects 100s instruments (sequencing & robots) or 100s of experiments 100s of people (resource mgmt) 10s of beta tests from vendorsFriday, June 15, 12
  6. 6. Friday, June 15, 12
  7. 7. Robots are Team Members Too! Jim Meldrim and John Stalker The Broad Institute of MIT and Harvard Genome Sequencing PlatformFriday, June 15, 12
  8. 8. The Broad Institute Established 2004 - Eli and Edythe Broad Joint Collaboration MIT Harvard University Affiliated Hospitals Beth Israel Deaconess Medical Center Brigham and Women’s Hospital Children’s Hospital Dana-Farber Cancer Institute Massachusetts General HospitalFriday, June 15, 12
  9. 9. Organization Programs (Science) Platforms (Technology) Chemical Biology Genome Sequencing Medical and Population Genetics Biological Samples Cell Circuits Chemical Biology Epigenomics Genetic Analysis Genome Sequencing and Analysis Imaging Cancer Metabolite Profiling Infectious Diseases Proteomics Metabolism RNAi Psychiatric Disease Therapeutics Discovery and DevelopmentFriday, June 15, 12
  10. 10. Organization Programs (Science) Platforms (Technology) Chemical Biology Genome Sequencing Medical and Population Genetics Biological Samples Cell Circuits Chemical Biology Epigenomics Genetic Analysis Genome Sequencing and Analysis Imaging Cancer Metabolite Profiling Infectious Diseases Proteomics Metabolism RNAi Psychiatric Disease Therapeutics Discovery and DevelopmentFriday, June 15, 12
  11. 11. Genome Sequencing BackgroundFriday, June 15, 12
  12. 12. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 40K $10,000 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moores  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012Friday, June 15, 12
  13. 13. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 $3 billion 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moores  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012Friday, June 15, 12
  14. 14. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 $3 billion 30K $1,000 20K $100 Automated 10K $10 Sequencing ABI3730 / Tphi 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moores  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012Friday, June 15, 12
  15. 15. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 Next Gen $3 billion $1,000 Sequencing 30K Illumina GA 20K $100 Automated 10K $10 Sequencing ABI3730 / Tphi 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moores  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012Friday, June 15, 12
  16. 16. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 1st Human Genome 40K $10,000 2001 Next Gen $3 billion $1,000 Sequencing 30K Illumina GA 20K $100 Automated Current SofA 10K $10 Sequencing Illumina HiSeq ABI3730 / Tphi 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moores  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012Friday, June 15, 12
  17. 17. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K 50K $100,000 Running  Sum  of  Samples  (copy) Cost  per  Genome 40K $10,000 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moores  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012Friday, June 15, 12
  18. 18. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K Cumulative  Number  of  Samples $100,000 50K Cost  per  Genome 40K $10,000 30K $1,000 20K $100 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moores  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012Friday, June 15, 12
  19. 19. 20.. 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 $100,000,000 80K $10,000,000 70K $1,000,000 60K Cumulative  Number  of  Samples $100,000 50K Cost  per  Genome 40K $10,000 30K $1,000 LCSET-1 1st JIRA tracked libraries 20K $100 5/17/2010 10K $10 0K $1 April April April April April April April April April April June June June June June June June June June June August August August August August August August August August August December October October October October October October October October October February February February February February February February February February February Cost  of  Sequencing  a  Mammalian  Genome  over  time  and  compared  to  Moores  Law Genome  s equencing  c ost  d ata  c ourtesy:  Wetterstrand  KA.  D NA  Sequencing  Costs:  D ata  f rom  the  NHGRI  Large-­Scale  Genome  Sequencing  Program  Available  at:  www.genome.gov/sequencingcosts.  Accessed 5/9/2012Friday, June 15, 12
  20. 20. Genome Sequencing 101Friday, June 15, 12
  21. 21. Genome Sequencing 101Friday, June 15, 12
  22. 22. Genome Sequencing 101 Cell NucleusFriday, June 15, 12
  23. 23. Genome Sequencing 101Friday, June 15, 12
  24. 24. Genome Sequencing 101 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X YFriday, June 15, 12
  25. 25. Genome Sequencing 101 Mom 1 2 3 4 5 Pop 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X YFriday, June 15, 12
  26. 26. Genome Sequencing 101 X YFriday, June 15, 12
  27. 27. Genome Sequencing 101 JIRA is in our DNA!Friday, June 15, 12
  28. 28. Genome Sequencing 101Friday, June 15, 12
  29. 29. Genome Sequencing 101 DNA (Deoxyribonucleic acid) • Two intertwined molecules - Double HelixFriday, June 15, 12
  30. 30. Genome Sequencing 101 DNA (Deoxyribonucleic acid) • Two intertwined molecules - Double Helix • Described in 1953 by James Watson and Francis CrickFriday, June 15, 12
  31. 31. Genome Sequencing 101 DNA (Deoxyribonucleic acid) • Two intertwined molecules - Double Helix • Described in 1953 by James Watson and Francis Crick • Carries the genetic code - the instructions for lifeFriday, June 15, 12
  32. 32. Genome Sequencing 101 Adenine Thymine Guanine CytosineFriday, June 15, 12
  33. 33. Genome Sequencing 101Friday, June 15, 12
  34. 34. Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGFriday, June 15, 12
  35. 35. Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT 3 Billion Bases Long!Friday, June 15, 12
  36. 36. Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGTFriday, June 15, 12
  37. 37. Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT Normal TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGTFriday, June 15, 12
  38. 38. Genome Sequencing 101 TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT Normal TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGTGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT Tumor TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGT TGCAGCAATGCTGAGCGCTAGCGAGGTACACAGTACGTACTCTGTGACGTFriday, June 15, 12
  39. 39. Lab Process Tracking withFriday, June 15, 12
  40. 40. Outside the Genome Sequencing Platform ? Our Process “The Players” ScientistFriday, June 15, 12
  41. 41. Outside the Genome Sequencing Platform ? Our Process “The Players” ScientistFriday, June 15, 12
  42. 42. Outside the Genome Sequencing Platform ? Our Process “The Players” Scientist Cancer HIV E. Coli Ice CoreFriday, June 15, 12
  43. 43. Outside the Genome Sequencing Platform ? Our Process “The Players” ScientistFriday, June 15, 12

×