Your SlideShare is downloading. ×
0
The Genomics Revolution and Human
Health
Michael Snyder
August 15, 2013
Conflicts: Personalis, Genapsys, Illumina
Health Is a Product of Genome +
Environment
Exposome
Health
Genome
Health Is a Product of Genome +
Environment
Exposome
Health
Genome
• Understand and Treat Disease
– Cancer
– Mystery diseases
• Pharmacogenomics
– Determining which drug side effects and do...
Personalized Omics Profiling: Combine
Genomic and Other Omic Information
Genomic Transcriptomic, Proteomic,
Metabolomic
1....
Genome
Transcriptome
(mRNA, miRNA, isoforms, edits)
Proteome
Metabolome
Personal
Omics
Profile
Autoantibody-ome
Microbiome...
Genome
Transcriptome
(mRNA, miRNA, isoforms, edits)
Proteome
Metabolome
Personal
Omics
Profile
Autoantibody-ome
Microbiome...
Personal Omics Profile
40 months; 61 Timepoints; 6 Viral Infections
/
/
Chen et al., Cell 2012
Accurate Genome Sequencing
3.3 M Hi conf. SNVs, 217K Indels and 3K SVs
2 or more Platforms
(Plus low confidence)
Whole Gen...
Local phasing + population data= highly phased blocks
Moleculo: Volodymyr Kuleshov, Michael Kertesz
Percent SNPs phased 98...
CodingNon-Coding
miRNA Splice UTR
miRNA
targets
Seed
sequence SIFT PP2
OMIM/Curated
Mendelian disease
(51)
Nonsynonymous
(...
Missense
• ALAD, ABCC2, ACADVL, ADAMTS13, AGRN, BAAT, CDS1, CHD
7, COL4A3, CTSD, DGCR2, DLD, DYSF, EPCAM, FGFR1OP, FKR
P, ...
Integrate Over Many Markers:
Complex Disease
0% 100%
Predict Type 2 Diabetes
"# )"# %""# %)"# 200 250 300 350 400 450 500 550 600 650# +%""# +)"# 0 )"# %""# %)"# &""# &)"# '""# ')"# (""# ()"# )""#
HR...
Dynamical Outcomes for Integrated Analysis of
Proteome, Transcriptome, Metabolome
george mias
RSV 18 days
Platelet Plug Fo...
The Future?
Genomic Sequencing
1. Predict risk
2. Early Diagnose
3. Monitor
4. Treat
Omes and Other Information:
Home Sens...
Study of 10 Healthy People
5 Asian, 5 European
Dewey, Grove, Pan, Ashley, Quertermous et al
- Median 5 reportable disease ...
Many Unaddressed Challenges
1) Accuracy and coverage
2) Interpretation
1) Interpreting non-protein
coding regions
2) DNA M...
1) Accurate Genome Sequences
and Coverage
Whole Genome Sequencing
• Complete Genomics: 35 b paired ends (150X)
• Illumina:...
SNV Comparison
• Complete Genomics: 35 b paired ends (150X)
• Illumina: 100 b paired ends (120X)
3.30M
89%
100K
2%
345K
9%...
Sequencing Accuracy
Sequencing the Same Genome Twice
Personalis
146,100 SNPs (3.7%)
Exome-seq and WGS-specific detection
45X WGS vs 80X Exome
Clark et al. 2011 Nature Biotech
Overall Statistics for Finishing Medically
Interesting Genes- ACE
ACE v1 = Thick Lines
TruSeq Exome (10G) = Thin
Lines
Per...
Exons Covered by ACE, Missed
by Standard Exome
Personalis
1) Search for disease causing mutations
(highly penetrant)
GCKR (high lipids); TERT (aplastic anemia)
2) Sum over multiple...
Missing Regulatory Variation
88% of Disease Variants Lie Outside of Genes!
26
X
Two approaches:
1) Mapping transcription f...
Damaging Variation in an Individual
Gene Regulatory region
Protein Coding Non-coding
and
CAPN1: Protective against Alzheim...
3. Incorporate Methylation Data
Possible Phenotypic Consequences of
Differentially Methylated Regions?
4. Sample Size—Need to Reduce
AliveCor Measures ECG
5. Other Data Types: Sensors
71
Moves App
Conclusions
1) Personal genome sequencing is here. The
medical interpretation is difficult.
2) Genome sequencing can predi...
The Personal Omics Profiling Project
Rui Chen, George Mias, Hugo Lam, Jennifer Li-Pook-
Than, Lihua Jiang, Konrad Karczews...
Acknowledgements
34
Human Regulatory Variation:
Maya Kasowski, Fabian Grubert, Alex Urban, Alexej
A, Chris Heffelfinger, M...
Genome (1TB)
Transcriptome (0.7TB)
(mRNA, miRNA, isoforms, edits)
Proteome (0.02 TB)
Metabolome (0.02 TB)
Personal
Omics
P...
Aug2013 Mike Snyder the genomics revolution and human health
Upcoming SlideShare
Loading in...5
×

Aug2013 Mike Snyder the genomics revolution and human health

1,013

Published on

Published in: Technology
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
1,013
On Slideshare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
49
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide
  • BRCA1/BRCA2: Women with significant amily history are screened to determine their risk. Mutations in BRCA1 or BRCA2 in women with breast cancer increases the probability that they will develop secondary cancer of the ovaries. BRCA1 and BRCA2 testing is done to identify those women who need extra surveillance for possible ovarian cancer or prophylactic oophorectomyLQTS – there are a number of genetic mutations identified that affect cardiac ion channel conductance and cause long QT interval and associated increased risk of fatal arrhythmia. Patients with long QT syndrome are tested for which mutation is present. Some mutations increase the risk of arrhythmia associated with auditory stimulation during sleep, others increase the risk associated with exercise; knowing which mutation is present, the individual can be counseled to avoid the relevant trigger. Furthermore, certain drugs work better for some mutations than others, so genetic testing allows tailoring of drug therapyIn May 2004, PGx Health Pharmaceuticals, based in New Haven, CT, introduced the FAMILION™TCF7L2 testing in patients with impaired glucose tolerance is important for identifying those individuals who need aggressive lifestyle modification and drug treatmetn to prevent progression to diabetes
  • NOTE: the grey lines represent the exon boundaries- so exons such as the MYBPC3 one shown here are very, very small and thus potentially not actually an exon
  • 667 VaraintsAffecting 93 genes – half of these have heteroalelic expression
  • Transcript of "Aug2013 Mike Snyder the genomics revolution and human health"

    1. 1. The Genomics Revolution and Human Health Michael Snyder August 15, 2013 Conflicts: Personalis, Genapsys, Illumina
    2. 2. Health Is a Product of Genome + Environment Exposome Health Genome
    3. 3. Health Is a Product of Genome + Environment Exposome Health Genome
    4. 4. • Understand and Treat Disease – Cancer – Mystery diseases • Pharmacogenomics – Determining which drug side effects and doses • Managing Health Care in Healthy Individuals Impact of Genomics on Medicine
    5. 5. Personalized Omics Profiling: Combine Genomic and Other Omic Information Genomic Transcriptomic, Proteomic, Metabolomic 1. Predict risk 2. Diagnose 3. Monitor 4. Treat & 5. Understand Disease States GGTTCCAAAAGTTTATTGGATGCCGTT TCAGTACATTTATCGTTTGCTTTGGAT GCCCTAATTAAAAGTGACCCTTTCAAA CTGAAATTCATGATACACCAATGGATA TCCTTAGTCGATAAAATTTGCGAGTAC TTTCAAAGCCAAATGAAATTATCTATG GTAGACAAAACATTGACCAATTTCATA TCGATCCTCCTGAATTTATTGGCGTTA GACACAGTTGGTATATTTCAAGTGACA AGGACAATTACTTGGACCGTAATAGAT TTTTTGAGGCTCAGCAAAAAAGAAAAT GGAAATTAATTTTGAAGTGCCATTGA ….
    6. 6. Genome Transcriptome (mRNA, miRNA, isoforms, edits) Proteome Metabolome Personal Omics Profile Autoantibody-ome Microbiome Personal “Omics” Profiling (POP) Cytokines Epigenome
    7. 7. Genome Transcriptome (mRNA, miRNA, isoforms, edits) Proteome Metabolome Personal Omics Profile Autoantibody-ome Microbiome Personal “Omics” Profiling (POP) Cytokines Epigenome Initially 40K Molecules/ Measure- ments Now Billions!
    8. 8. Personal Omics Profile 40 months; 61 Timepoints; 6 Viral Infections / / Chen et al., Cell 2012
    9. 9. Accurate Genome Sequencing 3.3 M Hi conf. SNVs, 217K Indels and 3K SVs 2 or more Platforms (Plus low confidence) Whole Genome Sequencing • Complete Genomics: 35 b paired ends (150X) • Illumina: 100 b paired ends (120X) Exome Sequencing • Nimblegen • Illumina • Aglilent 3.30M 89% 100K 2% 345K 9% CGIllumina
    10. 10. Local phasing + population data= highly phased blocks Moleculo: Volodymyr Kuleshov, Michael Kertesz Percent SNPs phased 98.2% Switch accuracy 99.9%+
    11. 11. CodingNon-Coding miRNA Splice UTR miRNA targets Seed sequence SIFT PP2 OMIM/Curated Mendelian disease (51) Nonsynonymous (1320) Synonymous mRNA stability tRNA rate I. Highly Penetrant Variants: Mendelian Disease Risk Pipeline Rick Dewey & Euan Ashley Damaging (234) All variants ~3.5M Rare/novel variants (<5%)
    12. 12. Missense • ALAD, ABCC2, ACADVL, ADAMTS13, AGRN, BAAT, CDS1, CHD 7, COL4A3, CTSD, DGCR2, DLD, DYSF, EPCAM, FGFR1OP, FKR P, GAA, GNAI2, HSPB1, IGKC, ITPR1, MED12, MKS1, NTRK1, P CM1, PKD1, PLEKHG5, PMS2, PRSS1, PTCH2, SERPINA1, SETX, SYNE1, TERT, TTN, VWF, ZFPM2, PNPLA2. Nonsense • PRAMEF2, PLCXD2, NUP54, RP1L1, PIK3C2G, ND E1, GGN, CYP2A7, IGKC Not Rare But Important • KCNJ11 , KLF4, GCKR … High Cholesterol Aplastic Anemia Rare Variants in Disease Genes (51 Total)
    13. 13. Integrate Over Many Markers: Complex Disease 0% 100% Predict Type 2 Diabetes
    14. 14. "# )"# %""# %)"# 200 250 300 350 400 450 500 550 600 650# +%""# +)"# 0 )"# %""# %)"# &""# &)"# '""# ')"# (""# ()"# )""# HRV Infection (Day 0-21) RSV Infection (Day 289-311) Life Style Change (Day 380-Current) Glucose(mg/dL) Day Number (Relative to 1st Infection) 80 90 100 110 120 130 140 150 160 -150 Glycated HgA1c (%): (Day Number) 6.4 (329) 6.7 (369) 4.9 (476) 5.4 (532) 5.3 (546) 4.7 (602) GLUCOSE LEVELS HRV INFECTION (DAY 0-21) RSV INFECTION (DAY 289-311) LIFESTYLE CHANGE (DAY 380- CURRENT) 14 HbA1c (%): 6.4 6.7 4.9 5.4 5.3 4.7 (Day Number) (329) (369) (476) (532) (546) (602)
    15. 15. Dynamical Outcomes for Integrated Analysis of Proteome, Transcriptome, Metabolome george mias RSV 18 days Platelet Plug Formation Glucose Regulation of Insulin Secretion
    16. 16. The Future? Genomic Sequencing 1. Predict risk 2. Early Diagnose 3. Monitor 4. Treat Omes and Other Information: Home Sensors http://www.baby-connect.com/ GGTTCCAAAAGTTTATTGGATGC CGTTTCAGTACATTTATCGTTTG CTTTGGATGCCCTAATTAAAAGT GACCCTTTCAAACTGAAATTCAT GATACACCAATGGATATCCTTAG TCGATAAAATTTGCGAGTACTTT CAAAGCCAAATGAAATTATCTAT GGTAGACAAAACATTGACCAATT TCATATCGATCCTCCTGAATTTAT TGGCGTTAGACACAGTTGGTATA TTTA….
    17. 17. Study of 10 Healthy People 5 Asian, 5 European Dewey, Grove, Pan, Ashley, Quertermous et al - Median 5 reportable disease risk associations (ACMG) per individual (range 2-6) - 3 followup diagnostic tests (range 0-10) - Cost $362-$1427 per individual - 54 minutes per variant
    18. 18. Many Unaddressed Challenges 1) Accuracy and coverage 2) Interpretation 1) Interpreting non-protein coding regions 2) DNA Methylation 5) Sample size 6) Exposome
    19. 19. 1) Accurate Genome Sequences and Coverage Whole Genome Sequencing • Complete Genomics: 35 b paired ends (150X) • Illumina: 100 b paired ends (120X) 3.30M 89% 100K 2% 345K 9% CGIllumina Single Nucleotide Variants Getting Better. Indels and Structural Variants Need Work!
    20. 20. SNV Comparison • Complete Genomics: 35 b paired ends (150X) • Illumina: 100 b paired ends (120X) 3.30M 89% 100K 2% 345K 9% Complete Genomics Illumina Hugo Lam, Michael Clark, Rui Chen Ti/Tv = 1.68 17/18 Sanger Ti/Tv = 2.14 20/20 Sanger Ti/Tv = 1.40 2/15 Sanger 31 Disease Associated SNP 3 Disease Associated SNP
    21. 21. Sequencing Accuracy Sequencing the Same Genome Twice Personalis 146,100 SNPs (3.7%)
    22. 22. Exome-seq and WGS-specific detection 45X WGS vs 80X Exome Clark et al. 2011 Nature Biotech
    23. 23. Overall Statistics for Finishing Medically Interesting Genes- ACE ACE v1 = Thick Lines TruSeq Exome (10G) = Thin Lines Personalis Normal Exome ~2,000 Custom Exome (ACE) ~2,000
    24. 24. Exons Covered by ACE, Missed by Standard Exome Personalis
    25. 25. 1) Search for disease causing mutations (highly penetrant) GCKR (high lipids); TERT (aplastic anemia) 2) Sum over multiple common risk allele to predict risk 2. Genome Interpretation Missense Variants ALAD, ABCC2, ACADVL, ADAMTS13, AGRN, BAAT, CDS1, CHD7, COL4A3, CTSD , DGCR2, DLD, DYSF, EPCAM, FGFR1OP, FKRP, GAA, GNAI2, HSPB1, IGKC, ITP R1, MED12, MKS1, NTRK1, PCM1, PKD1, PLEKHG5, PMS2, PRSS1, PTCH2, SERPI NA1, SETX, SYNE1, TERT, TTN, VWF, ZFPM2, PNPLA2. 0% 100% Ashley, Butte et al.
    26. 26. Missing Regulatory Variation 88% of Disease Variants Lie Outside of Genes! 26 X Two approaches: 1) Mapping transcription factor binding in different people. 2) RegulomeDB: Assembling regulatory information from the ENCODE Project and other sources.
    27. 27. Damaging Variation in an Individual Gene Regulatory region Protein Coding Non-coding and CAPN1: Protective against Alzheimer’s Coding Variants Regulatory Variants
    28. 28. 3. Incorporate Methylation Data
    29. 29. Possible Phenotypic Consequences of Differentially Methylated Regions?
    30. 30. 4. Sample Size—Need to Reduce
    31. 31. AliveCor Measures ECG 5. Other Data Types: Sensors 71 Moves App
    32. 32. Conclusions 1) Personal genome sequencing is here. The medical interpretation is difficult. 2) Genome sequencing can predict disease risk that can be monitored with other omics information. 3) Integrated analysis can provide a detailed physiological perspective for what is occurring. 4) Every person’s complex disease profile is different and following many components longitudinally may provide valuable information. 5) You are responsible for your own health Data at: snyderome.stanford.edu
    33. 33. The Personal Omics Profiling Project Rui Chen, George Mias, Hugo Lam, Jennifer Li-Pook- Than, Lihua Jiang, Konrad Karczewski, Michael Clark, Maeve O’Huallachain, Manoj Hariharan,Yong Cheng, Suganthi Bali, Sara Hillemenyer, Rajini Haraksingh, Elana Miriami, Lukas Habegger, Rong Chen, Joel Dudley, Frederick Dewey, Shin Lin, Teri Klein, Russ Altman, Atul Butte, Euan Ashley, Tom Quetermous, Mark Gerstein, Kari Nadeau, Hua Tang, Phyllis Snyder
    34. 34. Acknowledgements 34 Human Regulatory Variation: Maya Kasowski, Fabian Grubert, Alex Urban, Alexej A, Chris Heffelfinger, Manoj Harihanan, Akwasi Asbere, Lukas Habegger, Joel Rozowsky, Mark Gerstein, Sebastian Waszak, Jan Korbel (EMBL, Heidelberg) Regulome DB: Alan Boyle, Manoj Hariharan, Yong Cheng, Eurie Hong, Mike Cherry Methylome: Dan Xie, Volodymyr Kuleshov, Rui Chen, Dmitry Pushkarev, Konrad Karczewski, Alan Boyle, Tim Blauwkamp, Michael Kertesz
    35. 35. Genome (1TB) Transcriptome (0.7TB) (mRNA, miRNA, isoforms, edits) Proteome (0.02 TB) Metabolome (0.02 TB) Personal Omics Profile Total = 5.74TB/Sa mple + 1 TB Genome Autoantibody-ome Microbiome (3TB) 6. Big Data Handling and Storage Cytokines Epigenome (2TB)
    1. A particular slide catching your eye?

      Clipping is a handy way to collect important slides you want to go back to later.

    ×