Angel Carracedo
Fundación Gallega de
Medicina Genómica-SERGAS
Universidad de Santiago de Compostela
Centro Nacional de Gen...
The Problem of Variability
“Variability is the law of life, and
as no two faces are the same,
so no two bodies are alike,
...
TAT ACT GCG TCG GAT GCT GCG ATT GCT GAC CAA CAT CGT GAC AGT TAG ACA
AAC GAT TGA CTG TTA GGA TTG ACCA CCA ATT ACG ATG ACG T...
ATT ACT GAT CGG TAG CTG AGC CAA TGG CAG
TGA TGG ATG GTA GCT GAG TGC TGG….
Why is genetic variation important?
variation
no variation
north
south
north
south
Variation
No variation
EXTINCTION!!
Envirenomental
change SURVIVAL
Sedentary populations, migratory populations
showed a higher proportion of long alleles for
DRD4 (p .001).
Adaptive value ...
Genes
Ambiente
Genes
Ambiente
Genes
Ambiente
Environmental
traits
Complex traits
Mendelian traits
But still the advance in knowledge in
genes involved in complex traits is
limited !
Why is it important to find
the genes ...
Epidemiology
• Estimated Europe prevalence 1–2% of adult population
• 75% adults often report experiencing first symptoms ...
OR for first degree relatives: 4-5
Concordance in MZ twins 70-90%
Hededability higher in<15y
P. Sklar Annu. Rev. Genomics Hum. Genet. 2002. 3:371–413OCD Heredabilility = 0.40-0.60
% explained genetic variance
Using genetics to find genes that underlie complex traits is a potential
useful tool for a be...
magnitudeofeffect
frequency of trait in the population
Linkage analysis of families
association studies in
populations
obt...
Biological Psychiatry
Volume 72, Issue 8, 15 October 2012, Pages 629–636
Matthews et al.
Genome-Wide Linkage Analysis of O...
Suicide Controls
Allele 1 Allele 2
SNP A is associated
with Phenotype
SNP A:
Allele 1 =
Allele 2 =
Human Genetic Associati...
Genotyping means patient classificationGenotyping means patient classification
SNP: SINGLE NUCLEOTIDE POLYMORPHISM
ATCGGCGTACCTGATTCCGAATCCGTATCG
ATCGGCGTACCTGAATCCGAATCCGTATCG
3.3 Gigabases Human Geno...
Coordination
NODE 1
Santiago de
Compostela (USC)
NODE 2
Madrid
(CNIO)
Scientific advisory board Board
Management unit
CENT...
Association studies
Candidate gene approach
-Causative hypothesis or
candidate genes
Genome wide analysis (GWAs)
-No need ...
SCLA1
Glutamate
transporter
9p24
Mol Psychiatry. 2012 Jun 5. doi: 10.1038/mp.2012.76. [Epub ahead of print]
Molecular gene...
Illumina 1M
Affy 6.0
AXIOM
GWAS
P<5x10-8
Genome-wide association study
(GWAS) to identify low-penetrance
genes
• Require many cases and controls (but
not always)
•...
Numero estimado de pacientes para el estudio de asociación conNumero estimado de pacientes para el estudio de asociación c...
NETWORKS
Molecular Psychiatry , 2013 Jul;18(7):788-98.
Genome-wide association study of obsessive-
compulsive disorder
S E Stewart ...
Molecular Psychiatry advance online publication 14 August 2012.
doi:10.1038/mp.2012.85
The lowest two P-values were locate...
Genes within the imprinted
genomic region chr15q11-
13 have been reproducibly
associated with repetitive
behaviors, obsess...
The use of the current classification schemas including DSM-IV undoubtedly
contributes to the difficulties in finding gene...
Common variants conferring risk of schizophrenia
Nature Stefansonn et al. Aug 2009 (SGENE Consortium)
19,000 cases and 35,...
Strategies for looking missing variability in
Psychiatric Disorders
Grouping phenotypes: Phenotypes are badly defined
and ...
A polymorphism, located in an intron of ZNF804A, was reported to associate
with schizophrenia with a P-value of 1.61-7
, a...
CNVs:
Li et al.
A preliminary study of genotype-phenotype correlations
for rare copy number variants in children with Obse...
Recurrent
protein-altering
mutations were
observed in two
genes:CHD8 and
NTNG1. M
OTHER GENETIC APPROACHES
Explore correla...
EXOME SEQUENCING
Exome sequencing 50 OCDs
700 genes target resequencing
Final replication
Danielle Cath- 800 muestras
Ampl...
AXIOM EXOME ARRAYS
OTHER GENETIC APPROACHES
Explore ns SNPs i.e. Exome AXIOM arrays
rs12151009 7,85E-06
rs11685700 8,05E-06
rs114880897 1,80E-05
rs12327049 2,81E-05
rs114371521 2,84E-05
rs9523762 3,03E-05
r...
Trends Cogn Sci. 2012 Jan;16(1):81-91. Epub 2011 Dec 10.
Neurocognitive endophenotypes of impulsivity and compulsivity: to...
CLEANING THE PHENOTYPE
Explore image-endophenotype
definitions
Various animal models have confirmed the importance of the 5-HT,
and dopamine systems in the neurobiology and treatment of...
DNA methylation is a major epigenetic
modification with direct implications in gene
expression patterns
DNA methylation oc...
DEEP OMIC APPROACHES
DNA SEQUENCING AND METHYLATION
RNA SEQ (SMALL AND LONG)
METABOLITES
MICROBIOME
INTEGRATIVE BIOLOGY AP...
Expert Opin Drug Discov. 2013 Oct 23.
[Glutamate drugs and pharmacogenetics of
OCD: a pathway-based exploratory approach.
...
Pino Alonso – Hospital de Bellvitge
Xavier Estivill-CRG
Noa Carrera-JavierCostas
Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'
Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'
Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'
Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'
Upcoming SlideShare
Loading in …5
×

Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'

657 views

Published on

El 14 de noviembre de 2013, la Fundación Ramón Areces organizó y acogió en su sede un Simposio Internacional sobre 'La enfermedad de la duda: el TOC'. El Trastorno Obsesivo-Compulsivo (TOC) es un problema de salud pública, poco conocido, que afecta a un porcentaje de la población en torno a un 1-2% y que la Organización Mundial de la Salud ha situado entre las diez entidades que producen más discapacidad.

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
657
On SlideShare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • NOTES FOR PRESENTERS:
    According to some studies, OCD is the fourth most common mental disorder after depression, alcohol and substance misuse, and social phobia. It has a lifetime prevalence in community surveys of about 2–3%. However, the instruments used have been criticised and may have over-diagnosed OCD, so the true prevalence may be somewhat lower.
    There is remarkable consistency in the lifetime and annual prevalence of OCD from studies conducted across the world. The mean age of onset is in late adolescence for men and early twenties for women, although onset may occur in a wide range of ages.
    However, it may take individuals between 10–15 years or longer to seek professional help. There is often comorbidity with a range of disorders, especially depression, anxiety, alcohol or substance misuse, BDD, or an eating disorder.
  • Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'

    1. 1. Angel Carracedo Fundación Gallega de Medicina Genómica-SERGAS Universidad de Santiago de Compostela Centro Nacional de Genotipado-ISCIII Genética del transtorno obsesivo-compulsivo Fundación Ramón Areces, Madrid, 2013
    2. 2. The Problem of Variability “Variability is the law of life, and as no two faces are the same, so no two bodies are alike, and no two individuals react alike, and behave alike under the abnormal conditions which we know as disease.” Sir William Osler (1849-1919)
    3. 3. TAT ACT GCG TCG GAT GCT GCG ATT GCT GAC CAA CAT CGT GAC AGT TAG ACA AAC GAT TGA CTG TTA GGA TTG ACCA CCA ATT ACG ATG ACG TTG GAC … 3,3 x 109
    4. 4. ATT ACT GAT CGG TAG CTG AGC CAA TGG CAG TGA TGG ATG GTA GCT GAG TGC TGG….
    5. 5. Why is genetic variation important? variation no variation north south north south
    6. 6. Variation No variation EXTINCTION!! Envirenomental change SURVIVAL
    7. 7. Sedentary populations, migratory populations showed a higher proportion of long alleles for DRD4 (p .001). Adaptive value of long alleles of in migratory societies and the possibility of natural selection for a migration gene??. DRD4— has been linked in some studies to the personality trait of novelty-seeking and to hyperactivity Population Migration and the Variation of Dopamine D4 Receptor (DRD4) Allele Frequencies Around the Globe, Chen et al. Evolution and Human Behavior 20: 309–324 (1999) 2,320 individuals from 39 populations
    8. 8. Genes Ambiente Genes Ambiente Genes Ambiente Environmental traits Complex traits Mendelian traits
    9. 9. But still the advance in knowledge in genes involved in complex traits is limited ! Why is it important to find the genes involved in OCD? Disease stratification Molecular classification Target for drugs Risk prediction Many genes Low ORs
    10. 10. Epidemiology • Estimated Europe prevalence 1–2% of adult population • 75% adults often report experiencing first symptoms in childhood •Symptoms of OCD usually begin in individuals aged 10-24 years. • Prevalence in populations- Unknown (probably similar) •The overall prevalence of OCD is equal in males and females, Increased number of infections (specially stretococcal infections in childhood PANDAS as a subset OCD cases after herpes infections Evidence that serotonergic systems modulate OCD symptomatology.
    11. 11. OR for first degree relatives: 4-5 Concordance in MZ twins 70-90% Hededability higher in<15y
    12. 12. P. Sklar Annu. Rev. Genomics Hum. Genet. 2002. 3:371–413OCD Heredabilility = 0.40-0.60
    13. 13. % explained genetic variance Using genetics to find genes that underlie complex traits is a potential useful tool for a better understanding of the disease (therapeutic targets), risk stratification, subclassification and pharmacogenetics and pharmacogenomics
    14. 14. magnitudeofeffect frequency of trait in the population Linkage analysis of families association studies in populations obtainable sample size Linkage analysis or association studies ? •linkage analysis is usually more robust in the identification of mendelian traits • association studies have more power to detect genes with small effects (Risch & Merikangas, Science 1996)
    15. 15. Biological Psychiatry Volume 72, Issue 8, 15 October 2012, Pages 629–636 Matthews et al. Genome-Wide Linkage Analysis of Obsessive-Compulsive Disorder Implicates Chromosome 1p36 33 Caucasian families with ≥2 childhood-onset OCD- affected individuals from the United States (n = 245) The strongest result was on chromosome 1p36.33-p36.32 (HLOD = 3.77). At this location, several of the families showed haplotypes co- segregating with OCD
    16. 16. Suicide Controls Allele 1 Allele 2 SNP A is associated with Phenotype SNP A: Allele 1 = Allele 2 = Human Genetic Association Study Design
    17. 17. Genotyping means patient classificationGenotyping means patient classification
    18. 18. SNP: SINGLE NUCLEOTIDE POLYMORPHISM ATCGGCGTACCTGATTCCGAATCCGTATCG ATCGGCGTACCTGAATCCGAATCCGTATCG 3.3 Gigabases Human Genome / >18 M SNP 1 SNP/<200 bp 1M SNPs
    19. 19. Coordination NODE 1 Santiago de Compostela (USC) NODE 2 Madrid (CNIO) Scientific advisory board Board Management unit CENTRO NACIONAL DE GENOTIPADO – CEGEN ISCIII
    20. 20. Association studies Candidate gene approach -Causative hypothesis or candidate genes Genome wide analysis (GWAs) -No need of gene selection -Lack of bias towards specific genes
    21. 21. SCLA1 Glutamate transporter 9p24 Mol Psychiatry. 2012 Jun 5. doi: 10.1038/mp.2012.76. [Epub ahead of print] Molecular genetics of obsessive-compulsive disorder: a comprehensive meta-analysis of genetic association studies. Taylor S. A total of 230 polymorphisms from 113 genetic association studies were identified. A full meta-analysis was conducted for 20 polymorphisms that were examined in 5 or more data sets, and a secondary meta-analysis (limited to the computation of mean effect sizes) was conducted for 210 polymorphisms that were examined in fewer than 5 data sets. In the main meta-analysis, OCD was associated with serotonin-related polymorphisms (5-HTTLPR and HTR2A) and, in males only, with polymorphisms involved in catecholamine modulation (COMT and MAOA). Non significant trends were identified for two dopamine- related polymorphisms (DAT1 and DRD3) and a glutamate-related polymorphism (rs3087879). The secondary meta-analysis identified another 18 polymorphisms with significant ORs that merit further investigation.
    22. 22. Illumina 1M Affy 6.0 AXIOM GWAS P<5x10-8
    23. 23. Genome-wide association study (GWAS) to identify low-penetrance genes • Require many cases and controls (but not always) • Can improve power by selecting cases (early-onset, familial) and controls (family-free) • Search for alleles or genotypes over- represented in cases • Verify in other sample sets
    24. 24. Numero estimado de pacientes para el estudio de asociación conNumero estimado de pacientes para el estudio de asociación con la enfermedadla enfermedad NECESIDAD DE REDES-DEFINICIÓN DEL FENOTIPONECESIDAD DE REDES-DEFINICIÓN DEL FENOTIPO
    25. 25. NETWORKS
    26. 26. Molecular Psychiatry , 2013 Jul;18(7):788-98. Genome-wide association study of obsessive- compulsive disorder S E Stewart et al. The International OCD Foundation Genetics Collaborative (IOCDF-GC) 1465 cases, 5557 ancestry-matched controls and 400 complete trios remained, with a common set of 469  410 autosomal and 9657 X-chromosome single nucleotide polymorphisms (SNPs)
    27. 27. Molecular Psychiatry advance online publication 14 August 2012. doi:10.1038/mp.2012.85 The lowest two P-values were located within DLGAP1 (P=2.49 × 10−6 and P=3.44 × 10−6 ), a member of the neuronal postsynaptic density complex.
    28. 28. Genes within the imprinted genomic region chr15q11- 13 have been reproducibly associated with repetitive behaviors, obsessive compulsive behaviors, and autism (GWAS OCD consortium) . Davis et al. Partitioning the Heritability of Tourette Syndrome and Obsessive Compulsive Disorder Reveals Differences in Genetic Architecture- PLoS Genet Oct 2013
    29. 29. The use of the current classification schemas including DSM-IV undoubtedly contributes to the difficulties in finding genes for psychiatric disorders. They are based on clusters of symptoms and characteristics of clinical course that do not necessarily describe homogenous disorders, and rather reflect common final pathways of different pathophysiological processes (Charney et al, 2002). Sch 3%/75% GV CCR 8%/35% ADRs CCR 50%/80%
    30. 30. Common variants conferring risk of schizophrenia Nature Stefansonn et al. Aug 2009 (SGENE Consortium) 19,000 cases and 35,000 controls from Iceland, Denmark (Aarhus), Denmark (Copenhagen), Germany (Bonn), Germany (Munich), Hungary, the Netherlands, Norway, Russia, Sweden, Finland; Spain (Santiago) and Spain (Valencia) 1st 2,663 cases and 13,498 controls 2nd top 1,500 in 4500 cases and 4500 controls 3rd top 25 in 4,999 cases and 15,555 controls 4th top 10 in 14,000 cases and 16,000 controls Illumina 300 and 550 K
    31. 31. Strategies for looking missing variability in Psychiatric Disorders Grouping phenotypes: Phenotypes are badly defined and overlap: Join many of them to increase numbers Dissection of the phenotype: Endophenotypes The use of the current classification schemas including DSM-IV undoubtedly contributes to the difficulties in finding genes for psychiatric disorders. They are based on clusters of symptoms and characteristics of clinical course that do not necessarily describe homogenous disorders, and rather reflect common final pathways of different pathophysiological processes (Charney et al, 2002).
    32. 32. A polymorphism, located in an intron of ZNF804A, was reported to associate with schizophrenia with a P-value of 1.61-7 , and with psychosis (schizophrenia plus bipolar disorder) with a P-value of 1.01-8 . In this study, using 5164 schizophrenia cases and 20 709 controls, we replicated the association with schizophrenia and, by adding bipolar disorder patients, we also confirmed the association with psychosis Expanding the range of ZNF804A variants conferring risk of psychosis. Steinberg et al. Molecular Psychiatry (2010), 1–8 OCD + Depression OCD +Tourette OCD+ Anoexia Common genetic background in anorexia nervosa and obs Mas et al. J Psychiatr Res. 2013 Jun;47(6):747-54
    33. 33. CNVs: Li et al. A preliminary study of genotype-phenotype correlations for rare copy number variants in children with Obsessive-Compulsive Disorder Six CNV regions were found to be disrupting exons in functionally relevant genes involved in neurobiological processes, including NRXN1, SLC2A3, PRODH, CAPN14, ADRA2B2, NOTCH4 and PLXNA3. A patient with a deletion in NRXN1, a gene previously implicated in autism and schizophrenia, showed very early onset of severe OCD symptoms at 4 years of age. Another patient with a deletion in SLC2A3, a showed very low glutamatergic concentrations (and strong OCD) Meeting ASHG 2011
    34. 34. Recurrent protein-altering mutations were observed in two genes:CHD8 and NTNG1. M OTHER GENETIC APPROACHES Explore correlations in pathways
    35. 35. EXOME SEQUENCING Exome sequencing 50 OCDs 700 genes target resequencing Final replication Danielle Cath- 800 muestras Ampliar 68 exomas más
    36. 36. AXIOM EXOME ARRAYS
    37. 37. OTHER GENETIC APPROACHES Explore ns SNPs i.e. Exome AXIOM arrays
    38. 38. rs12151009 7,85E-06 rs11685700 8,05E-06 rs114880897 1,80E-05 rs12327049 2,81E-05 rs114371521 2,84E-05 rs9523762 3,03E-05 rs116383774 3,22E-05 rs9903348 4,69E-05 rs198857 4,74E-05 rs7997883 9,33E-05 rs6601764 9,90E-05 376 casos, 446 controles y 37.015 marcadores (nsSNPs) SLC6A15 (P = 2,81 x 10-5), gen que codifica una proteína implicada en el transporte específico neuronal de aminoácidos neutros que se ha asociado previamente a depresión mayor en un estudio de genoma completo (Khohli et al, Neuron 2011) PLXNA4 (P = 3 x 10-5), gen que codifica una proteína implicada en la guía axonal, cuya expresión se ha visto disminuida en una muestra de cerebro de pacientes con diagnóstico de autismo (Suda S et al, Mol Autism 2011). Réplica Danielle Cath 800 muestras Univ. Utrecht
    39. 39. Trends Cogn Sci. 2012 Jan;16(1):81-91. Epub 2011 Dec 10. Neurocognitive endophenotypes of impulsivity and compulsivity: towards dimensional psychiatry. Robbins TW, Gillan CM, Smith DG, de Wit S, Ersche KD.
    40. 40. CLEANING THE PHENOTYPE Explore image-endophenotype definitions
    41. 41. Various animal models have confirmed the importance of the 5-HT, and dopamine systems in the neurobiology and treatment of OCD
    42. 42. DNA methylation is a major epigenetic modification with direct implications in gene expression patterns DNA methylation occurs at the cytosine bases in CG dinucleotides, which are often located in enriched regions called CpG islands. When CpG islands become methylated, the promoter becomes stably silent New challenges: Methylation .
    43. 43. DEEP OMIC APPROACHES DNA SEQUENCING AND METHYLATION RNA SEQ (SMALL AND LONG) METABOLITES MICROBIOME INTEGRATIVE BIOLOGY APPROACHES EXPLORE G x E INTERACTIONS Genomics Micro RNA Transcriptomics Epigenomics
    44. 44. Expert Opin Drug Discov. 2013 Oct 23. [Glutamate drugs and pharmacogenetics of OCD: a pathway-based exploratory approach. Expert opinion: In the genetically informed network, known genes and identified key connecting components, including DLG4 (a developmental gene), PSD-95 (a synaptic scaffolding protein) and PSEN1 (presenilin, a regulator of secretase), conform a group of potential pharmacological targets.
    45. 45. Pino Alonso – Hospital de Bellvitge Xavier Estivill-CRG Noa Carrera-JavierCostas

    ×