Bioloog in een mensenwereld Wonderlijk leven
Frans de Jong <ul><li>Na een inspirerende studie biologie en een vormende periode in magazijnen en het Nederlandse leger s...
Inhoud <ul><li>De oude vraag: “Hoe orden je de grote verscheidenheid van het leven?” </li></ul><ul><ul><li>Vormen  </li></...
Wonderlijk leven ordeningsprincipes
Afstamming versus overeenkomst
Verwantschappen in beeld <ul><li>Een aantal Italiaanse wilde katten,  Felis silvestris silvestris , is gesorteerd op overe...
Beginnen met wat we kennen… <ul><li>Mens IUCN-status: Veilig </li></ul><ul><li>Fossiel voorkomen: Midden Pleistoceen tot h...
Beginnen met wat we kennen… <ul><li>Bonobo </li></ul><ul><li>IUCN-status: Bedreigd </li></ul><ul><li>Taxonomische indeling...
Multatuli <ul><li>Juffrouw Laps, zei Stoffel plechtig - en er was een gewichtig ogenblik aangebroken in 't avondje van juf...
Jufrouw Laps is een chordaat
De evolutie van bouwplannen
Het bouwplan: voor en achter, binnen en buiten… de HOX-genen  (1984) <ul><li>Beesten (dwz insecten, vertebraten en de mees...
Lenen van de biologische evolutie… <ul><li>Survival of the fittest? </li></ul><ul><ul><li>Niet een universeel maar een loc...
Voor de evolutie van organisaties…  <ul><li>Voorbeeld analyse SLSwonen </li></ul><ul><ul><li>3 ontwikkelingsfasen: </li></...
<ul><li>Ordening van waarden rond BSC-velden: </li></ul><ul><ul><li>●  Innovatie </li></ul></ul><ul><ul><li>●  Organisatie...
Evolutie van organisaties de voorkeur voor bouwplannen in een veranderend politiek klimaat <ul><li>Onderhoud </li></ul><ul...
Evolutie van het toetsenbord de superioriteit van QWERTY <ul><li>In 1867 waren er meer dan 50 gepatenteerde pogingen om ee...
Upcoming SlideShare
Loading in …5
×

Bioloog in een mensenwereld

628 views
479 views

Published on

Lezing over de evolutie van organisaties... zonder verklarende tekst moeilijk te volgen... maar mooie plaatjes.

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
628
On SlideShare
0
From Embeds
0
Number of Embeds
16
Actions
Shares
0
Downloads
1
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Bioloog in een mensenwereld

  1. 1. Bioloog in een mensenwereld Wonderlijk leven
  2. 2. Frans de Jong <ul><li>Na een inspirerende studie biologie en een vormende periode in magazijnen en het Nederlandse leger studeerde ik Bedrijfskunde in Delft. Daarna, sedert 1980, stafmedewerker, manager, directeur van respectievelijk een landbouwcoöperatie, een faculteit en een grote beheersdirectie bij het Rijk. </li></ul><ul><li>Na een kort avontuur in gemeenteland in 1998 de overstap gemaakt naar het adviesvak en sedert zomer 2005 senior consultant bij Quintis. Me daar geprofileerd als een van de smaakmakers in het werkveld van de volkshuisvesting – aldus mijn carrière in vogelvlucht. </li></ul><ul><li>Rode draad: bioloog in een mensenwereld – snappen dat ook menselijke constructies, van organisatie tot flatgebouw, fasen zijn in een evolutieproces. ‘Een fruitteler begrijpt meer van een organisatie dan een ingenieur’. </li></ul><ul><li>Van persoonlijk belang zijn mijn jeugd in het dorp Lexmond, mijn vrouw en twee kinderen en mijn werk voor de kerk, natuur, milieu en welzijn. </li></ul>
  3. 3. Inhoud <ul><li>De oude vraag: “Hoe orden je de grote verscheidenheid van het leven?” </li></ul><ul><ul><li>Vormen </li></ul></ul><ul><ul><li>Afstamming </li></ul></ul><ul><ul><li>Juffrouw Laps is een chordaat </li></ul></ul><ul><li>Bouwplannen </li></ul><ul><li>Evolutionair denken </li></ul><ul><ul><li>In de biologie </li></ul></ul><ul><ul><li>In de bedrijfskunde </li></ul></ul><ul><ul><li>De evolutie van artefacten </li></ul></ul>
  4. 4. Wonderlijk leven ordeningsprincipes
  5. 5. Afstamming versus overeenkomst
  6. 6. Verwantschappen in beeld <ul><li>Een aantal Italiaanse wilde katten, Felis silvestris silvestris , is gesorteerd op overeenkomst in een stukje van hun mitochondriaal DNA. Voor vier katten zag een stukje DNA met 50 basen er zo uit: </li></ul><ul><li>De vier katten worden ingedeeld in twee groepen, </li></ul><ul><li>Fsi67 bij Fsi78 en Fsi71 bij Fsi90. </li></ul><ul><li>Verder verschilt kat Fsi67 van kat Fsi 78 in een base, A/G, op positie 39 van deze 50 basen. </li></ul><ul><li>Kat Fsi67 heeft daar base A, net als de katten Fsi71 en kat Fsi90 uit de andere groep. </li></ul><ul><li>Katten Fsi71 en kat Fsi90 verschillen ook in 1 base: A/G, maar op positie 17. Kat Fsi90 heeft base G, terwijl de andere drie katten base A hebben. </li></ul>FSI67 AGTATTATATACCCGTATACATAAGACATACTATGTATATCGTGCATTAA FSI78 AGTATTATATACCCGTATACATAAGACATACTATGTATGTCGTGCATTAA FSI71 GGTATTATACACCCATATACATAAGACATACTATGTATATCGTGCATTAA FSI90 GGTATTATACACCCATGTACATAAGACATACTATGTATATCGTGCATTAA
  7. 7. Beginnen met wat we kennen… <ul><li>Mens IUCN-status: Veilig </li></ul><ul><li>Fossiel voorkomen: Midden Pleistoceen tot heden </li></ul><ul><li>Taxonomische indeling </li></ul><ul><ul><li>Rijk: Animalia (Dieren) </li></ul></ul><ul><ul><li>Stam: Chordata (Chordadieren) </li></ul></ul><ul><ul><li>Klasse: Mammalia (Zoogdieren) </li></ul></ul><ul><ul><li>Orde: Primates (Primaten) </li></ul></ul><ul><ul><li>Onderorde: Haplorrhini (Apen en spookdiertjes) </li></ul></ul><ul><ul><li>Infraorde: Catarrhini (Smalneusapen) </li></ul></ul><ul><ul><li>Superfamilie: Hominoidea </li></ul></ul><ul><ul><li>Familie: Hominidae (Grote mensapen en mensachtigen) </li></ul></ul><ul><ul><li>Geslachtengroep: Hominini </li></ul></ul><ul><ul><li>Geslacht: Homo </li></ul></ul>
  8. 8. Beginnen met wat we kennen… <ul><li>Bonobo </li></ul><ul><li>IUCN-status: Bedreigd </li></ul><ul><li>Taxonomische indeling </li></ul><ul><ul><li>Rijk: Animalia (Dieren) </li></ul></ul><ul><ul><li>Stam: Chordata (Chordadieren) </li></ul></ul><ul><ul><li>Klasse: Mammalia (Zoogdieren) </li></ul></ul><ul><ul><li>Orde: Primates (Primaten) </li></ul></ul><ul><ul><li>Onderorde: Haplorrhini (Apen en spookdiertjes) </li></ul></ul><ul><ul><li>Infraorde: Catarrhini (Smalneusapen) </li></ul></ul><ul><ul><li>Superfamilie: Hominoidea </li></ul></ul><ul><ul><li>Familie: Hominidae (Grote mensapen en mensachtigen) </li></ul></ul><ul><ul><li>Geslachtengroep: Hominini </li></ul></ul><ul><ul><li>Geslacht: Pan (Chimpansees) </li></ul></ul>
  9. 9. Multatuli <ul><li>Juffrouw Laps, zei Stoffel plechtig - en er was een gewichtig ogenblik aangebroken in 't avondje van juffrouw Pieterse - juffrouw Laps, je bent een zoogdier. </li></ul><ul><li>... </li></ul><ul><li>Juffrouw Pieterse, je bent 'n keronje! Je mag zelf 'n zoogdier wezen, jij en je zoon, dat zeg ik je! Ik ben zo fatsoenlijk als jij durft te denken, want m'n vader was in de granen, en nooit heeft iemand zoveel op me te zeggen gehad! </li></ul><ul><li>Multatuli (1820-1887). </li></ul><ul><li>in: &quot;De geschiedenis van Woutertje Pieterse&quot;. </li></ul>
  10. 10. Jufrouw Laps is een chordaat
  11. 11. De evolutie van bouwplannen
  12. 12. Het bouwplan: voor en achter, binnen en buiten… de HOX-genen (1984) <ul><li>Beesten (dwz insecten, vertebraten en de meeste andere) kun je voorstellen als zo’n kartonnen cylinder waar je opgerolde platen in vervoert. </li></ul><ul><li>De mond zit direct na de voorafsluiting. De anus zit direct voor de achterafsluiting (bv insecten) of er komt nog wat cylinder tussen de anus en de achterafsluiting. </li></ul><ul><li>Van voor naar achter wordt de positie over het lijf aangeven door zogenaamde Hox-genen. </li></ul><ul><li>Bij hoofdgroep 1 (insecten en nogal wat) zijn dat 10 Hox genen, </li></ul><ul><li>bij hoofdgroep 2 (vertebraten en nog wat) zijn het er 13. </li></ul><ul><li>Hox 1 betekent voorkant, Hox10 achterkant bij insecten en zo. Anus ligt bij Hox 10. Vertebraten hebben Hox11-13 voor het stuk achter de anus: de staart. </li></ul><ul><li>Bij de aanleg van poten, voor- en achterpoten, zijn Hox11-13 nodig: Alsof de betekenis van Hox11-13 is: *uitsteeksel*. </li></ul><ul><li>De placentale zoogdieren hebben twee nieuwe structuren die ontbreken bij de andere vertebraten: uterus / vagina (v) of penis (m). Wat wordt gebruikt bij de aanleg? Hox13 . </li></ul>Cobb & D. Duboule (2005) hebben een mooi plaatje van gen-expressie van Hox 13d in een muizenembryo: vijf gekleurde uitsteekseltjes, vier poten en genital bud. Nieuw uitsteeksel, gebruik het recept *uitsteeksel*. Het idee zal zijn: “Nieuw uitsteeksel gevraagd, zoek uitsteeksel-maken op in het genenboek”.
  13. 13. Lenen van de biologische evolutie… <ul><li>Survival of the fittest? </li></ul><ul><ul><li>Niet een universeel maar een locaal criterium </li></ul></ul><ul><ul><li>De mens is niet de top – maar een top </li></ul></ul><ul><ul><li>Een palp is ook een top </li></ul></ul><ul><li>Survival: van binnen uit en van buiten af… </li></ul><ul><ul><li>Van binnen uit: </li></ul></ul><ul><ul><li>Bouwplan (HOX-genen) </li></ul></ul><ul><ul><li>Homeostase </li></ul></ul><ul><ul><li>Genetische Variëteit </li></ul></ul><ul><li>Van buiten af </li></ul><ul><ul><li>Ecologische ruimte verandert </li></ul></ul>Genetische ruimte Ecologische ruimte Fenotypische ruimte 1 2 3 Past in niche Verandering in niche leidt tot andere selectie van genen En veroorzaakt ‘spanning’ Kansrijke mutatie ‘ Schept’ nieuwe niche
  14. 14. Voor de evolutie van organisaties… <ul><li>Voorbeeld analyse SLSwonen </li></ul><ul><ul><li>3 ontwikkelingsfasen: </li></ul></ul><ul><ul><ul><li>Fase 1: vijandbeelden (wij professionals – zij passanten) </li></ul></ul></ul><ul><ul><ul><li>Actie: relaties saneren en constructief maken. </li></ul></ul></ul><ul><ul><ul><li>Risico: handelen vanuit oude interactiepatronen en oude organisatie </li></ul></ul></ul><ul><ul><ul><li>– leidt tot: </li></ul></ul></ul><ul><ul><ul><li>Fase 2: coöperatief model (wij dienstverleners – zij klanten) </li></ul></ul></ul><ul><ul><ul><li>Actie: intelligente organisatie inrichten / info-systeem aanpassen. </li></ul></ul></ul><ul><ul><ul><li>Risico: vanuit dienstverleningsorganisatie treedt betutteling op van studenten. </li></ul></ul></ul><ul><ul><ul><li>– moet leiden tot: </li></ul></ul></ul><ul><ul><ul><li>Fase 3: antagonistische samenwerking als bron van vernieuwing (wij slim – zij ook slim…) </li></ul></ul></ul>Organisatie en communicatie aanpassen aan de gesaneerde relatie Vanuit interactiemodel relaties saneren en organisatie aanpassen Informatievoorziening gebruiken om kracht van huurders te benutten confrontatiemodel 1 2 3 mensbeeld interactiepatroon organisatie
  15. 15. <ul><li>Ordening van waarden rond BSC-velden: </li></ul><ul><ul><li>● Innovatie </li></ul></ul><ul><ul><li>● Organisatie </li></ul></ul><ul><ul><li>● Klant en markt </li></ul></ul><ul><ul><li>● Financieel </li></ul></ul>De HOX-genen van de organisatie cultuur focus Waarde voor cliënt en samenleving Interne processen Leren en groeien Goed financieel management Maatschappelijke onderneming rand- voorwaarde focus cultuur Commerciële organisatie Winst / financieel Tevreden klanten Interne processen Leren en groeien rand- voorwaarde cultuur De samenleving organiseren Tevreden burgers/kiezers Goed financieel beheer Leren en groeien Overheidsorganisatie rand- voorwaarde focus
  16. 16. Evolutie van organisaties de voorkeur voor bouwplannen in een veranderend politiek klimaat <ul><li>Onderhoud </li></ul><ul><ul><li>Systemen verfijnen </li></ul></ul><ul><ul><li>Problemen oplossen </li></ul></ul><ul><li>Efficiency bevorderen </li></ul><ul><li>Pragmatische bestuursstijl, Hoofdstructuur buiten beeld </li></ul><ul><li>Civil Society </li></ul><ul><ul><li>Terugtreden en optreden </li></ul></ul><ul><ul><li>Kaderstellen </li></ul></ul><ul><ul><li>Horizontaliseren </li></ul></ul><ul><li>Aansprekend bestuur </li></ul><ul><li>Herstel hoofdstructuur? </li></ul><ul><li>Herstel </li></ul>Balkenende IV 2007 - … Balkenende III 2003 - 2006 Balkenende I 2002 - 2003 Kok II 1998 - 2002 Kok I 1994 - 1998 Lubbers III 1989 - 1994 Lubbers II 1986 - 1989 Lubbers I 1982 - 1986 Van Agt III 1982 - 1982 Van Agt II 1981 - 1982 Van Agt I 1977 - 1981 Den Uyl 1973 - 1977 Biesheuvel 1971 - 1973 De Jong 1967 - 1971 Zijlstra 1966 - 1967 Cals 1965 - 1966 Marijnen 1963 - 1965 De Quay 1959 - 1963 Beel II 1958 - 1959 Drees III 1956 - 1958 Drees II 1952 - 1956 Drees I 1951 - 1952 Drees / Van Schaik 1948 - 1951 Beel I 1946 - 1948 Schermerhorn / Drees 1945 - 1946 De opkomst van de calculerende burger De droom van de civil society – en de participerende burger 1982 2002 1962 <ul><li>Opbouw </li></ul><ul><ul><li>Systeem van sociale zekerheid </li></ul></ul><ul><ul><li>Systeem van zorg </li></ul></ul><ul><li>Technocratische bestuursstijl </li></ul><ul><li>Grote debatten over hoofdstructuur (Vonhoff) </li></ul>focus cultuur Commerciële organisatie Winst / financieel Tevreden klanten Interne processen Leren en groeien rand- voorwaarde cultuur Rechten en plichten effectueren Tevreden klanten Goed financieel beheer Leren en groeien Overheidsorganisatie rand- voorwaarde focus cultuur focus Waarde voor cliënt en samenleving Interne processen Leren en groeien Goed financieel management Maatschappelijke onderneming rand- voorwaarde
  17. 17. Evolutie van het toetsenbord de superioriteit van QWERTY <ul><li>In 1867 waren er meer dan 50 gepatenteerde pogingen om een commerciële typemachine te maken en één daarvan was van Sholes en Densmire . In hun ontwerp bevond het aanslagpunt zich onder de papierdrager, en was dus onzichtbaar voor de typist die niet zag of de type-armen waren vastgelopen. </li></ul><ul><li>Het was lastig en tijdrovend om de type-armen uit elkaar te halen. Sholes herschikte de toetsen telkens op een andere manier om de frequentie van hun vastlopen te reduceren. Op een pragmatische manier zocht hij naar een evenwicht tussen snelheid en vastlopen: Qwerty ontstond dus om de maximale snelheid van typen te vertragen en het vastlopen van type-armen te voorkomen . </li></ul><ul><li>Letters die veel worden gebruikt werden toegewezen aan zwakke vingers of verspreid naar posities die op grote afstand staan van de thuisrij (2e rij). De QWERTY-configuratie vind dus haar oorsprong in de behoefte om het vastlopen van mechanische typemachines te voorkomen. </li></ul><ul><li>In 1873 werden de fabricage-rechten aan Remington verkocht. De mechanici van Remmington concludeerden - by chance - dat de beste figuratie gebaseerd was op QWERTY. De verkoop van deze typemachines liep echter zo slecht dat Remington bijna failliet ging. In 1888 vond een belangrijke gebeurtenis plaats die het Qwerty ontwerp een voorsprong gaf op haar concurenten. </li></ul><ul><li>Ms. Longley , oprichter van het Shorthand and Typewriter Institute in Cincinnati, werd uitgedaagd om de superioriteit van haar 8-vingers methode te bewijzen. </li></ul><ul><li>Zij werd uitgedaagd door Louis Taub , een andere type-leraar uit Cincinnati, die met vier vingers werkt op een rivaliserend niet-Qwerty machine met zes rijen, geen shift en dus aparte toetsen voor gewone en hoofdletter. </li></ul><ul><li>Longley zette als haar kampioen Frank E. Gurrin in, een ervaren Qwerty-typist. Hij beschikte over een bijzonder voordeel: hij had het Qwerty-bord uit zijn hoofd geleerd en kon dus 'blind typen'. Hij won en Qwerty leek zijn superioriteit bewezen te hebben. </li></ul><ul><li>In werkelijkheid was er helemaal geen sprake van een overwinning van Qwerty: het was de overwinning van het blind typen (touch-typing) op het zoeken en aanslaan (hunt-and-peck), van acht vingers op vier vingers, van een toetsenbord met drie rijen en een shift toetst versus een toetsenbord met zes rijen met aparte toetsen voor elke letter. </li></ul>&quot;If Sholes had not gained his tie to Remington, if the first typist who decided to memorize a keyboard had use a non-QWERTY design, if McGurrin had a bellyache or drank too mich the night before, if Longley had not been so zealous, if a hundred other perfectly possible things had happened, then I might be typing this essay with more speed and much greater economy of finger motion. But why fret over lost optimality. History always works this way. If Montcalm had won a battle on the Plains of Abraham, perhaps I would be typing en français . If a portion of the African jungles had not dried to savannas, I might still be an ape up a tree&quot; [Gould 1991: 71].

×